ID: 1022195789

View in Genome Browser
Species Human (GRCh38)
Location 7:28066214-28066236
Sequence GCAGTTCTTAGAAATACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022195789_1022195795 25 Left 1022195789 7:28066214-28066236 CCAGAGGTATTTCTAAGAACTGC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1022195795 7:28066262-28066284 GAAAGGCTCCGGTACAGGCCAGG No data
1022195789_1022195792 8 Left 1022195789 7:28066214-28066236 CCAGAGGTATTTCTAAGAACTGC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1022195792 7:28066245-28066267 TTGTTAAAAGAACACTGGAAAGG 0: 1
1: 0
2: 0
3: 27
4: 338
1022195789_1022195791 3 Left 1022195789 7:28066214-28066236 CCAGAGGTATTTCTAAGAACTGC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1022195791 7:28066240-28066262 ATGCTTTGTTAAAAGAACACTGG 0: 1
1: 0
2: 2
3: 30
4: 254
1022195789_1022195793 14 Left 1022195789 7:28066214-28066236 CCAGAGGTATTTCTAAGAACTGC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1022195793 7:28066251-28066273 AAAGAACACTGGAAAGGCTCCGG 0: 1
1: 1
2: 0
3: 27
4: 294
1022195789_1022195796 30 Left 1022195789 7:28066214-28066236 CCAGAGGTATTTCTAAGAACTGC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1022195796 7:28066267-28066289 GCTCCGGTACAGGCCAGGTCAGG No data
1022195789_1022195794 20 Left 1022195789 7:28066214-28066236 CCAGAGGTATTTCTAAGAACTGC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1022195794 7:28066257-28066279 CACTGGAAAGGCTCCGGTACAGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022195789 Original CRISPR GCAGTTCTTAGAAATACCTC TGG (reversed) Intronic
901024264 1:6270779-6270801 GCTGTCCTCAGAAATACCTGAGG + Intronic
903404196 1:23082713-23082735 GCATTTCTGAGAAATAACCCTGG + Intronic
905379633 1:37552396-37552418 GCAGTTGTCAGAAATAATTCAGG - Intronic
909631081 1:77770639-77770661 GCAGTCCCCAGAAATACCTCAGG - Intergenic
910195188 1:84633066-84633088 GCAGTTCTGAGAATGACCTAAGG - Intronic
910631641 1:89361824-89361846 CCAGTTCTTAGAGATACTACAGG + Intergenic
912581858 1:110728219-110728241 TCAGTTCTTGGGAAGACCTCAGG + Intergenic
913121703 1:115748437-115748459 GCAGCTCCGAGGAATACCTCTGG + Intronic
914740339 1:150459389-150459411 GAAGTTCTTAGAAAGTTCTCAGG + Intronic
916319394 1:163486624-163486646 GCAGTTCTTAGCATGACCTGTGG + Intergenic
916353065 1:163874201-163874223 GCAATTCTTTGTAATGCCTCTGG + Intergenic
917617246 1:176758644-176758666 GCTGTTTCTAGAAAGACCTCTGG + Intronic
919309950 1:195894664-195894686 GCAGTTCTCAGAAATAGCTGTGG - Intergenic
923731088 1:236550895-236550917 GAAAGTCTTAGAAATAGCTCTGG + Exonic
1063252504 10:4288638-4288660 GCAGGTTATTGAAATACCTCAGG + Intergenic
1064387425 10:14909228-14909250 GCAGTCATTGAAAATACCTCAGG + Exonic
1066211552 10:33244392-33244414 GCAGTTTTAAGAAATTCCTTTGG - Intronic
1066361714 10:34737905-34737927 GCAGTTCTGAGAACCACCTGCGG - Intronic
1071147916 10:82596967-82596989 GCAGGTGTTAGAAAAACCACAGG - Intronic
1073250801 10:102119521-102119543 GCACCTCTTAGGAGTACCTCCGG + Intronic
1073633405 10:105172191-105172213 GTATTTCTTAGAAATACCTTAGG + Intronic
1080278795 11:30532531-30532553 ACTGTTCTTAGAACAACCTCTGG - Intronic
1080824447 11:35836083-35836105 GCAGGTATCAGAAATACCCCTGG - Intergenic
1082175645 11:49055900-49055922 CCAGTTCTAGGAAAGACCTCAGG - Intronic
1085089044 11:73693941-73693963 AAAGTTATTAGAAATACCTCAGG + Intronic
1086690102 11:89780169-89780191 CCAGTTCTAGGAAAGACCTCAGG + Intergenic
1086698563 11:89872803-89872825 CCAGTTCTAGGAAAGACCTCAGG - Intronic
1086707607 11:89971693-89971715 CCAGTTCTAGGAAAGACCTCAGG + Intronic
1086715752 11:90059788-90059810 CCAGTTCTAGGAAAGACCTCAGG - Intergenic
1089001613 11:115056621-115056643 ACAGTTATTAAAAATACCTTAGG - Intergenic
1089497872 11:118916784-118916806 GCAGCTGTTAGGAACACCTCAGG - Intronic
1090428122 11:126624361-126624383 CGTGTTCTAAGAAATACCTCAGG - Intronic
1091060851 11:132460837-132460859 GCATTCCTTAGAAAGAGCTCTGG + Intronic
1096022730 12:48335716-48335738 GCTGTTCTTGGGAATGCCTCTGG - Intergenic
1099027787 12:77487391-77487413 TCAGTGCATATAAATACCTCTGG - Intergenic
1099557302 12:84126407-84126429 GCAGTTCTTAGAAAAATATCTGG + Intergenic
1099972951 12:89518497-89518519 TCAGTTTTTAAAAATACCTCAGG - Intronic
1104176616 12:126339097-126339119 GCAATTCATAGAAAGACCACTGG + Intergenic
1105570271 13:21596067-21596089 GCAGTTCTTAGCAACACTCCTGG - Intronic
1105820394 13:24076154-24076176 GAAGTTCTTAGAAATTCTTGAGG + Intronic
1107618938 13:42204513-42204535 TCAGTTCTTGGGAAGACCTCAGG - Intronic
1109183354 13:59241245-59241267 ATAGTTCTTAGAAATACATAAGG - Intergenic
1111348676 13:86997403-86997425 GCTGTTCTTTGTACTACCTCTGG - Intergenic
1112457739 13:99577209-99577231 GCAGGTTTTAGAAACTCCTCGGG + Intergenic
1112989469 13:105494641-105494663 GGGATTCTTAGAAATACCTAGGG - Intergenic
1114356584 14:21916136-21916158 AAAGTCCTTAGAAATACCTCTGG - Intergenic
1116563462 14:46414444-46414466 TCTTTTCTTAGAAATAGCTCTGG - Intergenic
1122860289 14:104579478-104579500 GCAGCTCTTGGAAAAACCTATGG - Intronic
1124904460 15:33855592-33855614 GCAGATATCAGAAATACCTGGGG - Intronic
1126912984 15:53434691-53434713 TCAACTCTAAGAAATACCTCTGG + Intergenic
1128437672 15:67670910-67670932 GCAGTTCTTGGTAATATCTCTGG - Intronic
1131568882 15:93512050-93512072 GCAGTTCTAAGACACACCCCAGG - Intergenic
1135507318 16:23050226-23050248 GCAATTTTTAAAAATTCCTCAGG + Intergenic
1137827143 16:51508480-51508502 GCATTTTTAAGAAATATCTCTGG + Intergenic
1139074864 16:63431935-63431957 GAAGTCCTTAGAAATTCCCCAGG + Intergenic
1139291835 16:65866240-65866262 GCAGTTCTAAGAATTACTACAGG - Intergenic
1143789779 17:9285271-9285293 GCATTTCTAACAAACACCTCAGG + Intronic
1148509857 17:48159136-48159158 TCAGTTCTCATAAATACATCTGG - Intronic
1152413066 17:80139954-80139976 GCACTTCTTACAAATACTACCGG + Intronic
1152873600 17:82772820-82772842 GCAGTTATGAGAAACATCTCGGG + Intronic
1154229965 18:12547120-12547142 TCTGTTCTCAGAAATACCTTTGG - Intronic
1155140556 18:23040543-23040565 GAAGTTCTGAGAAAAACCTGTGG + Intergenic
1156420915 18:36951937-36951959 GCATTTCATAAAGATACCTCTGG - Intronic
1157326990 18:46676468-46676490 GCAGTGCTTAGAAACAACTGAGG - Intronic
1157717550 18:49899125-49899147 GCTGTTCTCACAAATACCTTGGG + Intronic
1157854259 18:51090573-51090595 GCAGTTCTAAGAAATGACACTGG - Intergenic
1158199786 18:54926903-54926925 GCAGTTTTCAGAATAACCTCAGG - Intronic
1164504642 19:28849697-28849719 GCTTTTCTTAGAAATTGCTCTGG + Intergenic
1164650669 19:29888830-29888852 GGAGCTCTTAGAAATATCTCTGG - Intergenic
1165252635 19:34553020-34553042 GCAGTTCCTAGGAATTCATCTGG - Intergenic
1167570547 19:50285453-50285475 GAAATACTTAGAAATACATCTGG - Intronic
1168616840 19:57844676-57844698 GCAGTTTTTATAACAACCTCTGG + Exonic
925823905 2:7828095-7828117 GGAGATGTTAGCAATACCTCTGG - Intergenic
931176892 2:59863070-59863092 GCTATTCTTAGAAAGTCCTCAGG - Intergenic
935271385 2:101437137-101437159 GCAGTTGTAAGAAATAATTCAGG + Intronic
935589457 2:104832597-104832619 GGAGTTATAAGAAATACCTGGGG - Intergenic
938460633 2:131493872-131493894 AAAGTTCCTAGAAATTCCTCTGG + Intergenic
938645418 2:133325451-133325473 GCAGTACATGGAAATCCCTCAGG - Intronic
938696130 2:133837139-133837161 GCACTTCGCAGAAAGACCTCGGG - Intergenic
939380835 2:141434533-141434555 GCAGCTCTTAAAAATACGTTTGG - Intronic
941155549 2:161973255-161973277 TCAGTTCAAAGAAATACTTCAGG - Intronic
941358655 2:164524026-164524048 GCAGCTTTTAGAAAAATCTCTGG + Intronic
942089117 2:172471487-172471509 GCAGTTCTTAAGAGTATCTCTGG - Intronic
1168994060 20:2119443-2119465 GCTGTTCCTATAAATACCTTTGG - Intronic
1170895399 20:20408407-20408429 GCAGTTCTGAAAAAAATCTCAGG + Intronic
1174459425 20:50672286-50672308 CCAGTGCTTAGAGCTACCTCTGG + Intronic
1177160967 21:17547431-17547453 GGAGTTCTTAGAGACACTTCAGG + Intronic
1177446942 21:21209952-21209974 GAATTTCTTAGCAATAACTCAGG + Intronic
1177900352 21:26906776-26906798 GCACTTTTTAAAAATACCTGTGG - Intergenic
1178628795 21:34241368-34241390 GCAGTTGTAAGAAATATTTCAGG - Intergenic
1179281117 21:39935260-39935282 GCAGTTTTTAAAAATTACTCTGG - Intergenic
1183836523 22:40458771-40458793 GCTGTTTTCAGAAACACCTCAGG + Intronic
1185151516 22:49166583-49166605 GCAGTTCTCAGAAACACTTTGGG + Intergenic
950687927 3:14632201-14632223 GCAGTTCTTACAAGGAGCTCTGG - Intergenic
951802396 3:26610743-26610765 TCATTTCTTTGAAATTCCTCTGG - Intergenic
953348359 3:42195213-42195235 TCAGATCTTCCAAATACCTCAGG - Intronic
955016346 3:55073854-55073876 ACAGTTCTCAGACTTACCTCAGG - Exonic
955806673 3:62743388-62743410 GCAGTTGTTACAAAGACCACAGG + Intronic
956921588 3:73935435-73935457 GCAGTTTTCATAAATACTTCAGG - Intergenic
958660237 3:97057791-97057813 TCTGTTCTTAGAAATAACACAGG - Intronic
960728494 3:120697015-120697037 GCAGTTTTAACAAATAACTCAGG - Intronic
960947090 3:122974232-122974254 GCAGTTCCCAGAAATGCTTCTGG - Intronic
970148957 4:13068944-13068966 GGATTCCTTAGAAATAACTCAGG - Intergenic
972775990 4:42240934-42240956 GAAGTACCAAGAAATACCTCTGG - Intergenic
973707114 4:53591906-53591928 GAACTTCTTAGAAATATCTGAGG + Intronic
977447833 4:97153936-97153958 CTAGTTCTTAGAAATCCCACTGG + Intergenic
981510885 4:145556978-145557000 GTAGTTTTAAGAAATACATCTGG - Intronic
982542451 4:156691082-156691104 GCAGTTCTTGGAGATACTTTAGG + Intergenic
985322266 4:188726675-188726697 GCAACTTTTAGAAATACCACAGG - Intergenic
989402135 5:41019073-41019095 GCAGTTCTTGGGAATTCCACTGG - Intronic
991169752 5:63608309-63608331 GCAGGTGTGGGAAATACCTCAGG + Intergenic
991389834 5:66130877-66130899 ACGGATCTTAGAAATACCTAAGG + Intergenic
992892214 5:81213911-81213933 GCAGTTGTAAGAAATAACGCGGG + Intronic
993988004 5:94619723-94619745 TCAATTCTTGGAAATACCTGTGG + Intronic
994935820 5:106252359-106252381 GACATTCTTAGAAATAGCTCAGG - Intergenic
995323174 5:110860124-110860146 GTAGGTCTTGGAAATGCCTCTGG + Intergenic
1003899584 6:10641618-10641640 GCAGTTGAAAGAAATGCCTCTGG - Intergenic
1006411643 6:33877391-33877413 GCAGTTCTGAGGAATGGCTCTGG - Intergenic
1006599819 6:35217867-35217889 GGACTGCTTAGAAATTCCTCAGG + Intronic
1008699338 6:54080018-54080040 CCTGTTCTTAGAAGTTCCTCTGG + Intronic
1011882245 6:92043794-92043816 TCAGTTCTTTGAAAAATCTCTGG + Intergenic
1012139688 6:95609042-95609064 GCAGTTGTAATAAATACCTGAGG - Exonic
1014615896 6:123599064-123599086 GCAGTACTTAGCAATATGTCAGG + Intronic
1017366503 6:153647576-153647598 GCAGTTCTTTGGAACACCTATGG - Intergenic
1022195789 7:28066214-28066236 GCAGTTCTTAGAAATACCTCTGG - Intronic
1022273326 7:28831741-28831763 GCATTTATTAGAAGGACCTCGGG - Intergenic
1022667328 7:32423939-32423961 GCATTTGTTAGAAATTCCTCTGG - Intergenic
1023256519 7:38318086-38318108 GCAGTTTGTAAAAATACCTTGGG - Intergenic
1023350034 7:39311056-39311078 GCAGTTTTTAGCAATATTTCCGG + Intronic
1028258102 7:88625895-88625917 GCAGTTTTAAAAAATACCTGGGG + Intergenic
1030738744 7:113083751-113083773 GCAGCTGTTAGAAATCCCCCTGG + Exonic
1030830799 7:114218432-114218454 GCAGTTCTTAAATATAGGTCTGG + Intronic
1033618657 7:143041772-143041794 ACAGTTCTAGGAAATACCTGTGG + Intergenic
1033992264 7:147303087-147303109 TGAGTTCTTAGAAATGCTTCTGG - Intronic
1035336694 7:158133864-158133886 GCAGATCTTTGGAATACGTCTGG + Exonic
1035629976 8:1099750-1099772 ACAGTATTTAGAAATACCACAGG + Intergenic
1036575013 8:10019310-10019332 GCAATTCCTAGAAATAGCTGAGG + Intergenic
1037536513 8:19829397-19829419 GCAATTATTGGAAATACCGCTGG - Intronic
1037935020 8:22909599-22909621 GCAGTCCCTGGAAACACCTCAGG + Intronic
1038327517 8:26583499-26583521 ACAGTTCTTAGAAATATCTTGGG + Intronic
1040985713 8:53292057-53292079 CCAGTGCTTAGAAATATCCCTGG + Intergenic
1043143429 8:76619891-76619913 GGACTTCTAAGAAATACATCTGG - Intergenic
1043528739 8:81126351-81126373 ACAGTTTTTGGAAATTCCTCTGG + Intergenic
1044108868 8:88247029-88247051 GCAGTTCTTCCAAAGACCTTAGG + Intronic
1046123689 8:109877632-109877654 GCATTTCATAAAAATGCCTCTGG + Intergenic
1047341037 8:123980806-123980828 GCAGTGCCTAGACCTACCTCCGG - Exonic
1048559541 8:135518597-135518619 GCAATAATTAGAAATACCTTTGG - Intronic
1050526462 9:6550654-6550676 AGAGTTCTTGGAAATAACTCGGG - Intronic
1050644783 9:7707564-7707586 GCAGATATTAGAAATCCATCTGG + Intergenic
1051548178 9:18299878-18299900 CCAGTTCTTTGAAATACTTTAGG - Intergenic
1055364188 9:75526332-75526354 GCAGTTCTTATAAATCTCACAGG - Intergenic
1062713527 9:137990034-137990056 GAAGTTCTTGGAACTACCACAGG + Intronic
1187719452 X:22136076-22136098 GCAGTTCTTAAAATGACCTCTGG + Intronic
1188120000 X:26292791-26292813 TCATTTCTTAGATAAACCTCAGG - Intergenic
1192263627 X:69523998-69524020 GTAGTTTTTCAAAATACCTCAGG - Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193500349 X:82266621-82266643 GAATTTCTCAGAAATTCCTCAGG - Intergenic
1194684202 X:96891915-96891937 GCAGTTATTTGCATTACCTCTGG + Intronic
1197484166 X:127026372-127026394 CTAGTTGTTGGAAATACCTCAGG + Intergenic