ID: 1022196413

View in Genome Browser
Species Human (GRCh38)
Location 7:28071617-28071639
Sequence GTCTGTATGTGGGTGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196413_1022196421 6 Left 1022196413 7:28071617-28071639 CCATTTGCCACCCACATACAGAC 0: 1
1: 0
2: 3
3: 21
4: 226
Right 1022196421 7:28071646-28071668 ACGGACCTTCTATCCAGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 54
1022196413_1022196424 26 Left 1022196413 7:28071617-28071639 CCATTTGCCACCCACATACAGAC 0: 1
1: 0
2: 3
3: 21
4: 226
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196413_1022196425 27 Left 1022196413 7:28071617-28071639 CCATTTGCCACCCACATACAGAC 0: 1
1: 0
2: 3
3: 21
4: 226
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196413 Original CRISPR GTCTGTATGTGGGTGGCAAA TGG (reversed) Intronic
900834521 1:4990074-4990096 GTGTGAATGTAGGTGGCTAAGGG - Intergenic
903066533 1:20702764-20702786 GTCTATCTGTGGGTGGGATAAGG - Intronic
903248793 1:22037063-22037085 CTCTGTATGTTGATAGCAAAAGG - Intergenic
903660262 1:24972782-24972804 GTCATTATGTGGTTGGGAAATGG + Intergenic
905971633 1:42146170-42146192 GTGTGTGTGTGAGTGGCATATGG - Intergenic
906534489 1:46544069-46544091 ATCAGCATGTGGGTGGGAAAGGG + Intergenic
907308045 1:53524539-53524561 GGCAGTCTGTGGGTGGTAAAGGG + Intronic
908854702 1:68412355-68412377 GTCTTTATAAGGGAGGCAAAAGG - Intergenic
913158271 1:116121628-116121650 GTCAGTCTGTGGGTTGCAGATGG + Intronic
915063977 1:153209643-153209665 ATCTTTATGTGTTTGGCAAACGG - Intergenic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
916563949 1:165956982-165957004 GTCTGGATATGGCTGGCACATGG + Intergenic
917159673 1:172043428-172043450 GTCTTCGTGTGGGAGGCAAATGG + Intronic
918358702 1:183732530-183732552 TACTGTATGTGTGTGGAAAAGGG + Intronic
918841855 1:189551026-189551048 GTGTGTATGTGTGTGTGAAAGGG + Intergenic
919112620 1:193239997-193240019 GTGTGTATGTGTGTGGCAGGAGG - Intronic
920020452 1:202951875-202951897 TTAGGTATGTGTGTGGCAAAGGG - Intronic
920449765 1:206051111-206051133 GCCTGGGTGTGGGTGGCCAAGGG - Intronic
921260564 1:213382255-213382277 ATCTGGATGCTGGTGGCAAAGGG + Intergenic
921446446 1:215252508-215252530 TTCTGTATATGAGAGGCAAAGGG - Intergenic
924697326 1:246414031-246414053 TTCTGTCTGTGGGTGGAAAGAGG + Intronic
1062975623 10:1680388-1680410 GTATGTATGTGGGTGGAGAAGGG - Intronic
1063347405 10:5324869-5324891 GCCTGCATGTGGGTGGGAAGGGG + Intergenic
1063374987 10:5548890-5548912 GTGTGTATGTGTGTGGATAAGGG - Intergenic
1063687476 10:8251247-8251269 CTCTTTATGTGGCTGGGAAAGGG + Intergenic
1065204140 10:23342211-23342233 GTGTGTGTGTGTGTGGCAAGTGG - Intronic
1068828665 10:61468527-61468549 GTCTGTGTGTGGGAGGCAGGAGG - Intergenic
1070222924 10:74469785-74469807 GGCTGTATGAAGGGGGCAAAGGG - Intronic
1071762084 10:88619446-88619468 GTGTGTGTGTGTGTGGCAAGAGG - Intergenic
1072495533 10:95954223-95954245 GTATATATGTGTGTGTCAAAGGG + Intronic
1072837589 10:98733125-98733147 GTGTGTATGTGTGTGACACAGGG + Intronic
1073094694 10:100972473-100972495 ATCTGTATGTGGGTGGAAGATGG - Intronic
1073630947 10:105148603-105148625 GTCTGTATGGGTGTGGCCACTGG - Intronic
1076117172 10:127908428-127908450 GTGTGTATGTGGGTGGGGAGGGG + Intronic
1076386190 10:130057659-130057681 GTCAGCATGTGGATGGCAGAGGG + Intergenic
1078369544 11:10733559-10733581 GCCGCTATGGGGGTGGCAAATGG + Intergenic
1079152211 11:17910158-17910180 GTGTGTGTGTAGGTGGCAAATGG - Intronic
1080339280 11:31240859-31240881 GTTTGTATGTGTGTGGGTAAAGG - Intronic
1083344111 11:61977540-61977562 GTGTGTATGTGGGTGGACAGGGG + Intergenic
1083726732 11:64632392-64632414 GTCAGTCTGTGGGTGGTGAATGG - Intronic
1086107917 11:83167394-83167416 GTCTGTATAGGGGTGATAAAAGG - Exonic
1088087213 11:105995924-105995946 TGGTATATGTGGGTGGCAAATGG - Intronic
1088516440 11:110640087-110640109 GACTTTATGTGGGAAGCAAAAGG - Intronic
1089065383 11:115658786-115658808 GTTTGGGTGAGGGTGGCAAAGGG - Intergenic
1090158649 11:124467931-124467953 GTGTGTGTGTGGGAAGCAAAAGG - Intergenic
1090239672 11:125173178-125173200 ATCTGTAAGTGGTTGGCACATGG + Intronic
1090620508 11:128556583-128556605 GTCTTTATGTGGGGGGATAAGGG - Intronic
1093153935 12:15657356-15657378 GTGTCTATGTGTGTGGGAAACGG - Intronic
1095508461 12:42923843-42923865 GCCTCTATGTGGTTGGCAGAGGG + Intergenic
1095844094 12:46727542-46727564 GTCTGTAAGTGTGTGGCCAAAGG - Intergenic
1096203893 12:49706277-49706299 GTCTTTCTGTGGGTTTCAAACGG - Intronic
1100101356 12:91109477-91109499 GCTTGTATGTGGGAGGGAAATGG + Intronic
1102395036 12:112578140-112578162 GTCCCTATGTGGGTGTCAAGCGG + Intronic
1106065131 13:26340465-26340487 GTTTGTCTGTGAGTGGCTAATGG + Intronic
1108666338 13:52635567-52635589 GTGTGTGTGTGTGTTGCAAAAGG - Intergenic
1108882953 13:55143533-55143555 GTCTGTATGTGTGTGTGATAGGG + Intergenic
1109169123 13:59074645-59074667 GTATGTATGTGGTGGGGAAAAGG - Intergenic
1113168592 13:107472438-107472460 GTCTGTGTGTGTGTTGCCAAAGG + Intronic
1115024441 14:28725169-28725191 GTGTGTGTGTGTGTGGCAGAGGG - Intergenic
1117838293 14:59830413-59830435 GTCTCTATCTGGGTAGCAATAGG + Intronic
1118013084 14:61629629-61629651 GTGTGTTTGTGTGTGGCAAGAGG - Intronic
1124591739 15:31059997-31060019 GTGTGTATGTGGGTGTCATTGGG - Intronic
1125202192 15:37110104-37110126 GTCTGAATGTGAGTCACAAATGG + Intergenic
1128451406 15:67807775-67807797 GACTGGATGTGGGTGTGAAAAGG - Intergenic
1129773596 15:78218454-78218476 CTCTGAATGTGGCAGGCAAAGGG + Intronic
1132584217 16:699295-699317 GTCTGTAAGTGGGTGGCAGGGGG + Intronic
1132697053 16:1206723-1206745 CTCTGGATTTGGGTGGCAACTGG - Intronic
1133391247 16:5412041-5412063 TTCTGCATCTTGGTGGCAAATGG - Intergenic
1134281588 16:12821630-12821652 GGCTGGGTGTAGGTGGCAAATGG - Intergenic
1134739919 16:16533575-16533597 GTCAGAGGGTGGGTGGCAAAAGG + Intergenic
1134927580 16:18178589-18178611 GTCAGAGGGTGGGTGGCAAAAGG - Intergenic
1138336337 16:56256361-56256383 GTGTGTATGTGGGTGGAATTTGG - Intronic
1138920990 16:61528959-61528981 GTATGTATGTGGGAGGGATAGGG - Intergenic
1141613665 16:85198116-85198138 GCCTCTATGTGGGTGGCAGAAGG + Intergenic
1141830519 16:86507768-86507790 GTGTGTGTGTGTGTGGCAAATGG - Intergenic
1142320804 16:89381700-89381722 GTCTGAATGTGAGTAGCAGAGGG - Intronic
1143776757 17:9204630-9204652 GTCTATCAGTCGGTGGCAAATGG + Intronic
1144224844 17:13135264-13135286 GTGTGTGTGTTGGTGGCAGAGGG + Intergenic
1153135239 18:1910518-1910540 GTGTGTATGTGTGTTGCAGAGGG - Intergenic
1156106992 18:33675314-33675336 GTCTCTATCTGGCTGGCTAAAGG - Intronic
1157432989 18:47644920-47644942 CTCTGGAGGTGGGAGGCAAATGG - Intergenic
1157531026 18:48420861-48420883 GGCTGTGTGTGGGTGGGAGAGGG - Intergenic
1159672576 18:71239874-71239896 TTCTGTAAGTGGGAAGCAAAAGG - Intergenic
1159948912 18:74464965-74464987 GTTTGTGTGTGTGTGGCAAGTGG + Intergenic
1160014283 18:75128558-75128580 GTCTTTAGGTGGGGTGCAAAGGG - Intergenic
1160401890 18:78617446-78617468 GTGTGTGTGTGTGTGGGAAAAGG - Intergenic
1161012844 19:1968536-1968558 GTTTCTCTGTGGGTGGCAACAGG + Intronic
1164950845 19:32335730-32335752 GTGTGTGTGTGGGTGGGGAAGGG - Intergenic
1166102091 19:40576964-40576986 ATCTGAATGTGGGAGGCAAGAGG + Exonic
1166376203 19:42328576-42328598 GTGTGTGTGTGTGTGGCGAAGGG + Intronic
1166536182 19:43576322-43576344 GTGTGTGTGTGTGTGGCAAGGGG - Intronic
1168145458 19:54418041-54418063 GTGTGTATGTGTGTGGACAAAGG + Intronic
1168191952 19:54745052-54745074 CTCTGTATATGGGTGAGAAATGG + Intronic
1168595038 19:57668617-57668639 GCCTGTATGAGGGTGGAAAGTGG + Intergenic
926593187 2:14761431-14761453 ATGTGTATGTGCGTTGCAAATGG + Intergenic
929716323 2:44314585-44314607 GTGTGTGTGTGTGTGGCAGAGGG - Intronic
929794856 2:45051332-45051354 GTCGGGAGGTGGGAGGCAAAGGG - Intergenic
931668046 2:64624282-64624304 GGGTGTGTGTGGGTGGGAAAGGG + Intergenic
932146165 2:69319198-69319220 GTCTAGATGTGTGTTGCAAAGGG + Intergenic
934901180 2:98161220-98161242 GAGTGTATCTGGGTGGCAACTGG - Intronic
936959712 2:118060336-118060358 GTGTGTATGTGTGTGGTTAAAGG + Intergenic
937066858 2:119024047-119024069 ATCTGTATGTGGGAGGGAACTGG + Intergenic
937090916 2:119205612-119205634 GGCTGTGTGTGGAAGGCAAAGGG + Intergenic
937335244 2:121058521-121058543 GAGTGTATGTGGAGGGCAAATGG + Intergenic
943301850 2:186212407-186212429 CTCTGTACGTGTTTGGCAAAAGG - Intergenic
944474773 2:200092476-200092498 GTCTGAATGTGGGTGGGGATAGG + Intergenic
946076937 2:217082072-217082094 ATGTGTATGTGGACGGCAAATGG + Intergenic
946244896 2:218381931-218381953 GTGTGTGTGTGTGTGGCAGAGGG + Intergenic
947549429 2:231036181-231036203 GTGTGTGTGAGGGTGGCACATGG - Intergenic
948326894 2:237131523-237131545 GCATGTATATGGGTGTCAAAGGG + Intergenic
948739339 2:240032750-240032772 GACTGTATGTGGGGGGCATGTGG + Intergenic
948789585 2:240370382-240370404 TTCTGCATGTGGGTGGCCCAGGG - Intergenic
1168979172 20:1990404-1990426 GTCTCCAGGTGGTTGGCAAAGGG + Intronic
1169800960 20:9511068-9511090 GTCTGTGTGTGGGTTGCAGAGGG + Intergenic
1169810491 20:9604699-9604721 TTTGGTGTGTGGGTGGCAAAGGG - Intronic
1170177211 20:13484976-13484998 GTCAGGAGGTGGGGGGCAAAGGG + Intronic
1170869465 20:20191788-20191810 GTGTGTGTGTGTGTGTCAAATGG + Intronic
1171098070 20:22351802-22351824 GTCTGTAAGTGGATGGCATTGGG - Intergenic
1173208212 20:41011426-41011448 GTCTGTCTGTGGGTGGTTAGGGG - Intergenic
1173703421 20:45093083-45093105 GTCTGTTTGTGGGTGGCAGCGGG + Exonic
1174498850 20:50969452-50969474 GACAGTATGTGTGTGGGAAAGGG - Intergenic
1177784054 21:25650870-25650892 GTGTGTATGTGTGTGTAAAATGG + Intronic
1177890692 21:26800433-26800455 GTCTCAAAGTGGGTGGCAAGTGG + Intergenic
1178272903 21:31209639-31209661 ATCTGTATGTGTGCGGAAAAAGG + Intronic
1178750424 21:35297308-35297330 GTGTGTGTGTGTGTGGCAGAGGG - Intronic
1179680592 21:43018463-43018485 GTGTGTGTGTGGGTGGCAGGGGG - Intronic
1181087245 22:20446791-20446813 GTCTGTATGTGAGTGGGAAGTGG - Intronic
1183249017 22:36715357-36715379 CTCTGTATGTGAGTGGCATCTGG - Intergenic
1184191723 22:42899453-42899475 CTCTGTATGTGGGTGCCCAGAGG + Intronic
1184468636 22:44683416-44683438 TTCTGGGTGTGGGTGGCAGATGG - Intronic
1185089812 22:48759566-48759588 GTGTGTATGTGTGTGGTAAGAGG - Intronic
951823744 3:26843787-26843809 GTGTGTGTGTGTGTGGCAGAGGG - Intergenic
951995445 3:28722705-28722727 ATCTGTATCTGGGAGGCAAAGGG + Intergenic
952851697 3:37734864-37734886 ATCTGTATGTGGGAGGAAAGTGG - Intronic
953852723 3:46478408-46478430 GTCGCTATGTTGGTGACAAAGGG + Intronic
955117801 3:56023289-56023311 GGCTTTATGTGGGGGGCAATGGG - Intronic
955688843 3:61570881-61570903 CTCTGTCTGTGGGTAGCTAAGGG + Intronic
956251731 3:67240992-67241014 GTGTGTATGTGGGGGGCAAGTGG - Intergenic
956326160 3:68055296-68055318 GTATGTATGCGGGGGGCAAGAGG + Intronic
956662827 3:71616162-71616184 GTCTGTGTGTGGCTGGAAAAGGG - Intergenic
957188266 3:76971849-76971871 GTCAGGAAGTGTGTGGCAAAGGG + Intronic
964302437 3:155304011-155304033 ATATGTATTTTGGTGGCAAAAGG - Intergenic
964724747 3:159803183-159803205 GTGTGTGTGTGTGTTGCAAAGGG + Intronic
964725114 3:159806347-159806369 GTCTGTATGTGGCAGGTAACAGG + Intronic
965006931 3:163039663-163039685 GCCAGCATGTGGGTGGTAAAGGG + Intergenic
966749840 3:183311471-183311493 CTCTGTATGTGGATGCCAGACGG + Intronic
966915522 3:184582204-184582226 GTCAGTCTCTGGGGGGCAAAGGG - Exonic
967603293 3:191414776-191414798 GTCTGTCTATGAGTGTCAAATGG + Intergenic
967722503 3:192830260-192830282 GTGTGTGTGTGGGTGTCAAAGGG + Intronic
969041511 4:4300021-4300043 GACTGTATGTTGGTGGTAAAAGG + Exonic
969558292 4:7928759-7928781 CTTTGTATGTGTGTGGCATATGG - Intronic
969684653 4:8664421-8664443 GCCAGTACGTGGGTGACAAAGGG - Intergenic
971426750 4:26523490-26523512 GTGTGTGTGTGTGTGTCAAAGGG - Intergenic
971781830 4:31045372-31045394 GTCTGTGTATGTGTGTCAAAGGG + Intronic
972022109 4:34327814-34327836 GCCTGTAGGTGGGTGGGAAGTGG + Intergenic
972798715 4:42449411-42449433 CACTGTTTGTGGATGGCAAAAGG + Intronic
976589302 4:86833283-86833305 GTCTGTATGGGCCTGGGAAATGG - Intronic
977331982 4:95647973-95647995 GTGTGTGTGTGTGTGTCAAATGG + Intergenic
979041648 4:115805670-115805692 GGTTGTATGTAGGTAGCAAAGGG - Intergenic
982747831 4:159123508-159123530 GTGTGTCTGTGGGTGGGATATGG + Intronic
983074782 4:163312737-163312759 GTGTGTATGGGGGTGGCAAGGGG - Intergenic
983600886 4:169526058-169526080 GTGTGTATGTGTGTGTCAGAGGG - Intronic
984994356 4:185414067-185414089 GTCTGTATCTGGGTAGAAACTGG + Intronic
985385599 4:189444313-189444335 GTGTTTATGTTGGTGTCAAAAGG + Intergenic
987220033 5:15781975-15781997 GTCAGTGGGTGGGTGGCAAGGGG - Intronic
987402849 5:17495828-17495850 GTCTGTTTGTGGGTGGAAAAGGG - Intergenic
987404492 5:17511225-17511247 GTCTGTTTGTGGGTGGGAAAGGG - Intergenic
987409644 5:17602137-17602159 GTCTGTTTGTGGGTGAAAAAGGG - Intergenic
987412104 5:17624941-17624963 GTCTGTTTGTGGGTGGGAAAGGG - Intergenic
987414407 5:17647946-17647968 GTCTGTTCGTGGATGGAAAAGGG - Intergenic
988974001 5:36497318-36497340 ATGTATATGTGGGTGGAAAAGGG + Intergenic
989836007 5:45992306-45992328 GTTTTTCTGTGGTTGGCAAAGGG + Intergenic
994202140 5:96989027-96989049 GTGTGTATGTGTGTGGAAAGAGG + Intronic
995518754 5:112979894-112979916 GTGTGTGTGTGGGTGGGGAAGGG + Intronic
996151034 5:120035109-120035131 GTCTGTAAGAGAGAGGCAAAGGG - Intergenic
996694348 5:126377235-126377257 GTGGGGGTGTGGGTGGCAAAGGG - Intronic
999538567 5:152546922-152546944 GTGTGTGTGTGTGTGGCAGAGGG + Intergenic
999805586 5:155078069-155078091 GTCTGTGAGTGTGTGGCCAAAGG - Intergenic
1000951696 5:167491791-167491813 GGTTGTATGTGGGTGGGCAAGGG - Intronic
1001485441 5:172116466-172116488 CTCTGCAGGTGGATGGCAAAAGG + Intronic
1003560901 6:7179248-7179270 GTGTGTATGTGTGTAGAAAAAGG - Intronic
1003924745 6:10867061-10867083 GTCTGGAGGTGGGGGGCAAGGGG + Intronic
1003963145 6:11228056-11228078 ATCTGTGTGTGGGAGGCAAGGGG + Intronic
1006765801 6:36505301-36505323 TTCTGTATGTGGTTGAAAAATGG - Intronic
1007732030 6:43953267-43953289 GTCTCCATGGGGGTGGCAAGTGG + Intergenic
1008181768 6:48339840-48339862 GTATGTATATTGGTGGAAAAAGG + Intergenic
1010106448 6:72174962-72174984 ATGTGTATGTGGGTGGGAATGGG - Intronic
1011752219 6:90464601-90464623 GTCTTTCTGTGGGTGGGGAATGG + Intergenic
1014079834 6:117273064-117273086 GCCTGAATGTGAGTGGCAAGTGG + Exonic
1014498991 6:122163256-122163278 GTCTGTATGGGTGTTGCTAAAGG - Intergenic
1014597370 6:123361368-123361390 GTCGGTGGGTGGGGGGCAAAGGG + Intronic
1014964770 6:127733978-127734000 GGCTGTATGTAACTGGCAAAAGG + Intronic
1015380471 6:132561511-132561533 GTGTGTATGTGGGTGGAGGAGGG + Intergenic
1016093155 6:140003508-140003530 ATCTGTGTGTGGGTGTCCAATGG - Intergenic
1016627941 6:146194627-146194649 GTCTGCAACTGGGTGTCAAATGG - Intronic
1016770680 6:147847049-147847071 GTTTGTATGTGGTTAGCAAGAGG - Intergenic
1017900241 6:158713380-158713402 GGCAGGATGTGGGTGGCACAGGG - Intronic
1017910054 6:158784790-158784812 GTTTGAATGTGGGTGGTAAGTGG - Intronic
1018042994 6:159941451-159941473 GACTGCATGTGGGTGGCTCAAGG + Intergenic
1018122843 6:160654425-160654447 GTCTGTGAGGGTGTGGCAAAAGG - Intronic
1019003657 6:168778029-168778051 CTCTTTATGTGGGTGGCACTGGG + Intergenic
1020671627 7:11122458-11122480 GTGTGTGTGTGTGTGTCAAAGGG + Intronic
1021092863 7:16503446-16503468 GTGTGTATGTGTGTGTCAAGGGG + Intronic
1022196413 7:28071617-28071639 GTCTGTATGTGGGTGGCAAATGG - Intronic
1023843568 7:44109338-44109360 GTCAGTAAGTGGGGGGCACAAGG + Exonic
1024960821 7:54973151-54973173 ATCTCTATGTGGCTTGCAAAAGG + Intergenic
1029609017 7:101616766-101616788 TTCTGTACGTGGATGCCAAAAGG + Intronic
1030365238 7:108638191-108638213 GTCTGTTTGTGGGTGCCTTAAGG - Intergenic
1030762509 7:113369033-113369055 GTGTGCATGTGGGTGGCAGGGGG - Intergenic
1030943299 7:115682473-115682495 GTGGGTATGTGGGTGGGAATAGG - Intergenic
1031061486 7:117056150-117056172 GTCTGTGTGGGTGTTGCAAAAGG - Intronic
1033478453 7:141714188-141714210 GTCTGAATGAGGATGACAAAAGG - Exonic
1033713583 7:143975769-143975791 GTCTGTATGTGGAATCCAAAGGG + Intergenic
1034994700 7:155570562-155570584 GTATGAAGGTGGGTGCCAAAGGG - Intergenic
1036287797 8:7459902-7459924 GTCTGTATCTGGGAGCCAAAGGG + Intronic
1036333679 8:7851626-7851648 GTCTGTATCTGGGAGCCAAAGGG - Intronic
1037143514 8:15546118-15546140 GTGTGTATGTGTGTAACAAATGG + Intronic
1037195870 8:16188656-16188678 GTCAGTAGGTGGGAGGCAAGGGG - Intronic
1037824728 8:22154541-22154563 ATCTGTGTGTGGGAGGGAAAGGG - Exonic
1037995962 8:23352550-23352572 GTCTGTCTGGGGGCGGCAGAGGG - Intronic
1038044616 8:23755587-23755609 GTATTTATGTGGATGGCACATGG + Intergenic
1039688545 8:39836461-39836483 GTCTGTATTAGGATGACAAATGG + Intronic
1040885865 8:52263130-52263152 ATCTGGATGTGAGTGGGAAATGG - Intronic
1042105929 8:65326117-65326139 GTCTGTGTGAGGGTGGCTCAGGG + Intergenic
1044574129 8:93750078-93750100 GTATGTATGTAAATGGCAAAAGG + Intergenic
1044761913 8:95527527-95527549 GTTTTAATGTGGCTGGCAAAAGG + Intergenic
1044932202 8:97261054-97261076 TTGTGAATGTGGGTGGCAGAGGG - Intergenic
1045075715 8:98564965-98564987 GACTGAATGTGGGTGGTATATGG + Intronic
1047097332 8:121639704-121639726 GTCTGTATGAGGGTGAGAACCGG - Intronic
1047382521 8:124376412-124376434 GTCTAGATGCAGGTGGCAAAGGG + Intergenic
1050794499 9:9521360-9521382 AGCTGAATGTGGGTGACAAATGG - Intronic
1050832523 9:10031310-10031332 GTCTGTATGGGTGTTGCCAAAGG + Intronic
1055166150 9:73196630-73196652 GTGTGTGTGTGTGTGGAAAAAGG - Intergenic
1055789109 9:79902460-79902482 ATCAGTGTGTGGGTTGCAAAAGG - Intergenic
1057598386 9:96436305-96436327 GTCTGAATGAGGGTGGCCCAGGG - Intergenic
1060442355 9:123653799-123653821 ATCTGTATGTGGCAGGCAACAGG + Intronic
1061266908 9:129511499-129511521 GGCTGTACGTGTGGGGCAAAGGG - Intergenic
1061346593 9:130031144-130031166 GTTTATATGTGGGTGGAATAAGG - Intronic
1061788421 9:133044899-133044921 GCCTGTGTGTGGGTGGCAGGGGG - Intronic
1062352503 9:136145920-136145942 GTCAGGATGTGGGTGGCAGGAGG + Intergenic
1062677165 9:137753323-137753345 GTCTGTCTTTGGGTGGCAGAGGG + Intronic
1186016800 X:5204805-5204827 GTGTGTGTGTGTGTGGCAGAGGG + Intergenic
1187118284 X:16375883-16375905 CCCTGTATGTGGGTGGAGAATGG + Intergenic
1194463384 X:94200616-94200638 GGATGTATGTGGGTGCCAAGTGG - Intergenic
1195467921 X:105200904-105200926 GTGTGTGTGTGGGTGTGAAACGG - Intronic
1195990168 X:110674450-110674472 GTGTGTGTGTGTGTGGTAAAGGG - Intronic
1197055049 X:122108430-122108452 GTGTGTGTGTGTGTGGCAAGGGG + Intergenic
1198236679 X:134742060-134742082 GACTGCATGAGGGTGGAAAAAGG - Intronic
1198385194 X:136122617-136122639 GTGTGTGTGTGTGTGGCGAAAGG + Intergenic
1199770568 X:150972757-150972779 GTCTGATTGTGGGTGGCATAGGG - Intergenic
1200772845 Y:7143269-7143291 GTGTGTATGTGTGTGTAAAATGG + Intergenic