ID: 1022196415

View in Genome Browser
Species Human (GRCh38)
Location 7:28071624-28071646
Sequence TCCTTGGGTCTGTATGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196415_1022196427 28 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196415_1022196425 20 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196415_1022196426 25 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196415_1022196421 -1 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196421 7:28071646-28071668 ACGGACCTTCTATCCAGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 54
1022196415_1022196424 19 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196415 Original CRISPR TCCTTGGGTCTGTATGTGGG TGG (reversed) Intronic
900329092 1:2125084-2125106 CCTTTGGGTCTGTTTGAGGGTGG + Intronic
901187937 1:7387080-7387102 TTCCTGGGTCTGTCTCTGGGTGG + Intronic
903259502 1:22123791-22123813 TTCTTGGCTCCATATGTGGGAGG - Intronic
903744044 1:25574749-25574771 TCCGTGGGCCTGTATGTGCCAGG + Intergenic
903771521 1:25767330-25767352 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
903771576 1:25767647-25767669 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
903771653 1:25768077-25768099 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
903771736 1:25768568-25768590 TGTGTGGGTCTGTGTGTGGGGGG - Intronic
904872749 1:33630299-33630321 TGGTTGGGTGTGTATGTGTGAGG + Intronic
905600527 1:39246484-39246506 ACCTTGGGTCTATTTGAGGGAGG + Intronic
905768921 1:40624978-40625000 CCCTTGGGTTTGTATCTGGTAGG - Exonic
905858219 1:41329153-41329175 TGTGTGTGTCTGTATGTGGGCGG + Intergenic
906271724 1:44484537-44484559 TACTTGGGGCTTTAGGTGGGAGG + Intronic
908321228 1:62980967-62980989 TTCTTGTGTGTGTATGTGTGTGG + Intergenic
910375754 1:86567866-86567888 TCCTTGGGCTTGTAAGTGAGTGG - Intronic
911161405 1:94686011-94686033 TCCTTTGCCCTGCATGTGGGTGG + Intergenic
911861768 1:102960471-102960493 TCACTGGGTGTGTGTGTGGGGGG + Intronic
915101993 1:153507391-153507413 TCCTTGGGTGTGTGTGTGGGGGG - Intergenic
916501073 1:165387309-165387331 TTCTTGGGTCTGTCTGAGGCAGG - Intergenic
916923562 1:169494257-169494279 TCCTAGAGTCTGTATGAGGGAGG - Intergenic
918071500 1:181136477-181136499 TGTTTGTGTCTGTCTGTGGGGGG - Intergenic
920302349 1:204996789-204996811 TGCTTGGGCCTGTGTCTGGGTGG + Intronic
923353366 1:233130314-233130336 TACGTGGGTGTGTTTGTGGGTGG - Intronic
1062833185 10:619648-619670 TCCTGGGGTCTGTGTGGGTGAGG - Intronic
1064097287 10:12433294-12433316 TCCTGGGGTCTGCAGGAGGGAGG - Intronic
1066249379 10:33618184-33618206 GCCTTGGGGGCGTATGTGGGTGG - Intergenic
1066517977 10:36185031-36185053 TCCTAGTGTGTGTGTGTGGGAGG + Intergenic
1067204105 10:44198997-44199019 TCCGTGGGTATGTAGGTGGGTGG + Intergenic
1069996201 10:72343546-72343568 TACATGGGTCTGTGTGAGGGGGG + Intronic
1070733595 10:78848495-78848517 TCCTTGTGTCTGTGGCTGGGTGG - Intergenic
1071827208 10:89337110-89337132 TCCGTGGGTCTGTTTGTAAGTGG + Intronic
1072161762 10:92773758-92773780 TTCTTGTGTGTGTATGTTGGAGG - Intergenic
1073094696 10:100972480-100972502 CCCTTTGATCTGTATGTGGGTGG - Intronic
1075144870 10:119873879-119873901 TCCTTGGGGCTGTAGGAAGGGGG + Intronic
1076292527 10:129358143-129358165 TCCTTAAGTGTGTGTGTGGGGGG + Intergenic
1077544152 11:3161862-3161884 TCCTTGGATCTGCATTTGGTGGG - Intronic
1078406512 11:11074729-11074751 TCCTTGAGTCTGTATGATGGTGG + Intergenic
1080304086 11:30818119-30818141 TGCAGGGGTCTCTATGTGGGAGG + Intergenic
1080701348 11:34647087-34647109 TCTTTGTGTGTGTGTGTGGGGGG - Intronic
1081418330 11:42841883-42841905 TCCTCGTGTGTGAATGTGGGTGG + Intergenic
1081770739 11:45649436-45649458 TCCATGTGTCTGAATGGGGGGGG + Exonic
1083344108 11:61977533-61977555 ATCGTGGGTGTGTATGTGGGTGG + Intergenic
1083459547 11:62801658-62801680 TCACTGGGTTTGTGTGTGGGGGG + Intronic
1083666323 11:64276770-64276792 TCCTTGGGTGTGAACGTGGGTGG + Intronic
1086989672 11:93289192-93289214 TCCTGTGGCCTGGATGTGGGTGG - Intergenic
1087772584 11:102226828-102226850 TCCTTGCTTCTGTGTTTGGGCGG - Intronic
1087884654 11:103464773-103464795 TCATTGAGGCTGTATGTGAGTGG - Intronic
1088386539 11:109264266-109264288 TGCTAGAGTCTGTAGGTGGGTGG + Intergenic
1088447678 11:109949855-109949877 TTCTTGGGTCTGGATGATGGCGG + Intergenic
1090620512 11:128556590-128556612 TCCCTGCGTCTTTATGTGGGGGG - Intronic
1090801452 11:130175216-130175238 TTGTTGGGTCTGAATATGGGTGG + Intronic
1091434553 12:462187-462209 TCCTTTGGAGTGTGTGTGGGTGG + Intronic
1092655710 12:10682702-10682724 TCACTGGGTCTGTATGTCAGAGG + Intergenic
1095662869 12:44758071-44758093 ACCTTGTGTGTGTATGTGTGTGG - Intronic
1100618670 12:96250708-96250730 TCCTTTTCTCTGTGTGTGGGGGG + Intronic
1102201581 12:111061064-111061086 TCCTTGGGGCTGTTCATGGGAGG + Intronic
1102802585 12:115749608-115749630 TTCTTGGTTCTGTTTCTGGGAGG - Intergenic
1102861457 12:116339866-116339888 TTCATGTGTCTATATGTGGGAGG + Intergenic
1103199742 12:119078037-119078059 TCACTGGGTCTGCCTGTGGGTGG + Intronic
1104990034 12:132619716-132619738 TCCCTGGGTCTGGGAGTGGGTGG - Exonic
1106395096 13:29371982-29372004 TGCTTGTGTGTGTGTGTGGGGGG - Intronic
1108563849 13:51674718-51674740 TGTATGTGTCTGTATGTGGGTGG + Intronic
1108759444 13:53545439-53545461 TGCCTGGGTCAGAATGTGGGTGG + Intergenic
1111819342 13:93194263-93194285 TCCTGGGGTCTGTAGGATGGTGG - Intergenic
1112863499 13:103864668-103864690 TTCTTGGGTGTGTCTGTGAGGGG + Intergenic
1114376748 14:22154825-22154847 TCCTTGTGTGTGTTTGTGTGTGG - Intergenic
1115585614 14:34809193-34809215 TCCTTGGTTATCTGTGTGGGAGG - Intronic
1116528160 14:45933348-45933370 TTCTTTGGTTTGTTTGTGGGGGG - Intergenic
1117908881 14:60617452-60617474 TTCTTAGGTCTATAAGTGGGAGG - Intergenic
1118744924 14:68766839-68766861 GCCTTGGGAGTGTATGTGGGTGG + Intergenic
1119218990 14:72891835-72891857 TGCTAGTGTCTGCATGTGGGTGG + Intronic
1120288580 14:82537312-82537334 TCCTTGCGTCTGTATGACTGAGG - Intergenic
1121444569 14:93970340-93970362 TCCTTGGCTGTGTTTGTGGATGG + Intronic
1122211239 14:100175451-100175473 TGCTTGGGTGTGTTTGTGTGTGG - Intergenic
1122381965 14:101314102-101314124 TCCGTGGCTCTCTATGTGGGTGG + Intergenic
1123118105 14:105903826-105903848 TCTTTGTCTCTGAATGTGGGAGG + Intergenic
1123938863 15:25207074-25207096 TCCTTGAGTCTGGCGGTGGGTGG + Intergenic
1124053756 15:26222966-26222988 TGCTTGGGTCTGCATGTTGTGGG - Intergenic
1127045755 15:55023848-55023870 TCCTAGGGTCTGGATGTTGCTGG - Intergenic
1127286692 15:57539336-57539358 TCTTGGGGTCAGAATGTGGGTGG - Intronic
1129174374 15:73829596-73829618 GCCATGGGGCTGTAGGTGGGGGG - Intergenic
1129238236 15:74236523-74236545 CCCTGGGGCCTGGATGTGGGGGG - Exonic
1130116704 15:81011761-81011783 TCCCTGTGTGTGTATGTGTGTGG + Intronic
1133236459 16:4389475-4389497 TCCTTGGGAATGAATGAGGGAGG + Intronic
1133443152 16:5837300-5837322 CCCTTGGGGCTGTATCTGTGAGG - Intergenic
1134106847 16:11491674-11491696 GCCATGGGTGTGTGTGTGGGAGG - Intronic
1135631632 16:24039976-24039998 TTCTTGGGTCTGGATGAGGTGGG - Intronic
1136993505 16:35172178-35172200 TCCTGGTGGCTGTGTGTGGGTGG + Intergenic
1137291873 16:47057053-47057075 TGTTTGTGTCTGTATGTGTGAGG + Intergenic
1137393555 16:48101068-48101090 TAGTTGGCTCTGTATGTGTGAGG - Intronic
1138552361 16:57754709-57754731 ACCTTAGGTCTGCCTGTGGGTGG - Intronic
1138583679 16:57957264-57957286 TCCTTGGGTCTGACTGTATGTGG - Intronic
1141604366 16:85144533-85144555 GCCTGGGGTCTGGGTGTGGGTGG + Intergenic
1142899388 17:3002891-3002913 TGCTTGGGTGTGTGTGTGTGTGG + Intronic
1143359799 17:6359671-6359693 TCCTTGGGACTTTATTTGTGAGG - Intergenic
1144250946 17:13416163-13416185 TGCTTGGGTTTGGATGGGGGAGG - Intergenic
1147219458 17:38919917-38919939 TCTCTGGGCCTGTGTGTGGGTGG + Exonic
1148264220 17:46212016-46212038 TCCTTGAGTCTGTCTGTCCGGGG - Intronic
1148489893 17:48016256-48016278 TCCTTGGGGCTGGAGGTGGGAGG + Intergenic
1148699740 17:49580241-49580263 TCTGTGTGTCTGTCTGTGGGTGG + Exonic
1148805737 17:50263149-50263171 TCCCTGGGTCTGTTCCTGGGAGG - Intergenic
1150517685 17:65831131-65831153 TCCTTGCATCTTTATGTTGGTGG - Intronic
1150600432 17:66646234-66646256 TCCTCGGGGCTGTTTCTGGGTGG + Intronic
1151785939 17:76275115-76275137 TCCTTGTGAATGTCTGTGGGAGG - Intronic
1152119181 17:78407533-78407555 TCCTTGGGTGTGTCTGTGTTTGG + Intronic
1157733745 18:50028223-50028245 TTCTTGAGTGTGCATGTGGGTGG + Intronic
1160665414 19:325852-325874 TTCTGGGGTCTGAAGGTGGGAGG + Intronic
1161189635 19:2945835-2945857 TACGTGGTTCTGTTTGTGGGAGG - Intergenic
1162306964 19:9880887-9880909 TCCTTGGGTCTGCAGCTGAGAGG - Intronic
1163673036 19:18639829-18639851 TCCCCGGGGCTGTATGTTGGTGG - Intronic
1164434092 19:28213677-28213699 TCCTTGGGTCACCGTGTGGGAGG - Intergenic
1164598335 19:29545023-29545045 TCTTCGGGGCTGTATGTGGATGG - Intronic
1167033394 19:46978458-46978480 TAGTGGGGTCTGTGTGTGGGGGG + Intronic
1167150784 19:47708241-47708263 CCCCTGGGGTTGTATGTGGGTGG + Intergenic
1167253518 19:48414227-48414249 TCCTGGGATCTGAAGGTGGGAGG + Intronic
925091440 2:1159262-1159284 TGCATGTGTGTGTATGTGGGGGG + Intronic
925235189 2:2271828-2271850 TCCTTGGGTTTGAATTTTGGAGG + Intronic
925872432 2:8282766-8282788 GCCTTAGGGCTGTATTTGGGTGG - Intergenic
927146648 2:20170641-20170663 ATCTTGGGTCTGTATGTGTGTGG + Intergenic
927822089 2:26275997-26276019 TGTGTGGGTGTGTATGTGGGAGG + Intronic
928295252 2:30077105-30077127 TTCTTGGATCTGCATGTAGGAGG - Intergenic
928664513 2:33537326-33537348 TACTTGTGTGTGTGTGTGGGGGG - Intronic
931673540 2:64671428-64671450 TGCTTGAGTGTGTATGTGTGGGG + Intronic
931960476 2:67476956-67476978 TGCCTGGGTGTGTATGTGTGTGG + Intergenic
935211630 2:100943793-100943815 TCCATGGGTCTGTGTGGGGAGGG + Intronic
935649848 2:105372957-105372979 TTTTTGTGTGTGTATGTGGGGGG - Intronic
936267110 2:111018926-111018948 TTCTTGGGGCTGTGAGTGGGAGG - Intronic
937082498 2:119150315-119150337 TCCTTGGGGTTGTATGTGTGTGG - Intergenic
938170021 2:129067518-129067540 TGCATGTGTCTGTATGTGTGTGG + Intergenic
938386691 2:130871890-130871912 TCCATGGATCTTTATTTGGGGGG - Intronic
939072625 2:137561300-137561322 ACCTTGGGGCTTTATATGGGAGG + Intronic
941654118 2:168124958-168124980 TACTGGGGTCTGTAGGGGGGTGG + Intronic
943489086 2:188527257-188527279 TGCTTGAGTCTGGATGTGGAAGG + Intronic
945052133 2:205834123-205834145 TATTTGGGTTTGTATGTGTGTGG + Intergenic
946750158 2:222886232-222886254 CACTTGGGCCTGTAGGTGGGTGG - Intronic
1169633709 20:7663559-7663581 TTCTGGGATCTGTATTTGGGGGG + Intergenic
1171454508 20:25260005-25260027 TGCTTGGGTTTGGATGTGTGTGG + Intronic
1172116689 20:32577225-32577247 TCCTGGGGTCTGGATTTGTGAGG - Intronic
1172870658 20:38133590-38133612 ACCTGGGGTCTGTTTGTAGGAGG + Intronic
1173406311 20:42768873-42768895 ACCTTGGGTTTGTCAGTGGGAGG - Intronic
1174898833 20:54476864-54476886 TCCTTGGGACTGAATGATGGTGG + Intronic
1175067194 20:56299467-56299489 TGCTTAGGTCTGTTTGTGGCTGG - Intergenic
1175993431 20:62801334-62801356 TCCTTTGGTCTATGTGTGTGGGG - Exonic
1176965928 21:15211339-15211361 TCTTTGATTCAGTATGTGGGGGG + Intergenic
1177852481 21:26365157-26365179 TCCTTGGGTTTGTATGTCAAAGG - Intergenic
1179496786 21:41776800-41776822 TCCTTGGGTGGGTGGGTGGGGGG + Intergenic
1183615121 22:38939449-38939471 TCCTTGATTCTGTTTGTGTGTGG + Intergenic
1184145912 22:42610407-42610429 TCCTTGGAGCTGGAAGTGGGAGG - Intronic
1184609645 22:45594595-45594617 TCCATGGGTGGGTGTGTGGGTGG + Intronic
950449784 3:13059127-13059149 TCCTTGTGTCTGGAGGTCGGGGG - Intronic
950758336 3:15196918-15196940 GCGTTGGGTGTGTGTGTGGGCGG - Intergenic
952851700 3:37734871-37734893 TCCCAGCATCTGTATGTGGGAGG - Intronic
954149519 3:48650464-48650486 GCCCTGGGTGAGTATGTGGGGGG - Exonic
954150489 3:48654825-48654847 GCCTGGGGACTGTGTGTGGGAGG + Intronic
954154051 3:48674943-48674965 TACTTGGGGCTGTCTGTGGCTGG - Intronic
954661663 3:52229912-52229934 CCCTTGAGTCTGTAGGTGAGTGG - Exonic
956168797 3:66416647-66416669 TCATTGGGTTTGTTTGGGGGAGG - Intronic
958072361 3:88630336-88630358 TCCCTGTGTGTGTGTGTGGGGGG - Intergenic
958271560 3:91506229-91506251 GCTTTGGGTATGTGTGTGGGTGG + Intergenic
958493997 3:94818748-94818770 TCCTTGGGTTTTTATATTGGTGG - Intergenic
958566023 3:95811248-95811270 TCCGTGTGTGTGTATGTGTGTGG - Intergenic
963046208 3:141104476-141104498 TCCTTGGGGGTGTGTCTGGGAGG - Intronic
964499276 3:157330778-157330800 CCCTTGGTTCTGGATGTGGCTGG - Intronic
964725113 3:159806340-159806362 TTCTTTGGTCTGTATGTGGCAGG + Intronic
965344631 3:167533528-167533550 TTCTTGTGTGTGTATGTGTGTGG + Intronic
965485676 3:169275422-169275444 TCATTGGGTCTGTTTTTGGAAGG + Intronic
965542835 3:169887657-169887679 TCTTTGAGTATGTATGTGTGTGG - Intergenic
967411465 3:189170300-189170322 GCCTGGGGTCTGTATTAGGGAGG + Intronic
968495766 4:914563-914585 ACCCTGGGGCTGTGTGTGGGGGG - Intronic
968950858 4:3690712-3690734 TCCTTGGGGCAGTATCAGGGAGG + Intergenic
969717269 4:8873795-8873817 CCCCTGGGTCTGTCTGTGAGAGG + Intergenic
970143048 4:13003502-13003524 TCTTTGTGTGTGTGTGTGGGGGG + Intergenic
970742094 4:19250808-19250830 TTCTGGGGTCTGGATGAGGGTGG - Intergenic
970884261 4:20969076-20969098 TTCCTGGGTCTGTATTTAGGAGG - Intronic
971297520 4:25410914-25410936 TGCTTGGGTCTGTAAGTGTTTGG - Intronic
972790998 4:42370951-42370973 TCAGTGTGTATGTATGTGGGAGG + Intergenic
972971549 4:44582799-44582821 TTCTGGGGTATGTTTGTGGGGGG - Intergenic
974068798 4:57105432-57105454 TCCTTGGGTCTGTCTATATGAGG + Intronic
975119338 4:70711633-70711655 TTCTGAGGTTTGTATGTGGGTGG - Intronic
977471401 4:97447872-97447894 TTCTTGGGTCTGGATAAGGGTGG - Intronic
977778609 4:100953386-100953408 TACTTGTGACTGGATGTGGGAGG + Intergenic
980775509 4:137431196-137431218 TTCTTGGGTCTGTAGGATGGTGG - Intergenic
981937488 4:150251540-150251562 TGTGTGGGTGTGTATGTGGGGGG - Intronic
982795044 4:159634384-159634406 TTATAGGGTTTGTATGTGGGGGG + Intergenic
986799724 5:11246704-11246726 TCTGTGTGTCTGTAGGTGGGTGG + Intronic
989985719 5:50695103-50695125 TTCTTGGGTGTGTCTGTGAGGGG - Intronic
991602479 5:68367351-68367373 TCCATGGGTCAGTATGTCTGAGG + Intergenic
991664885 5:68989675-68989697 TACTTTGTTCTGTATGTGGAAGG - Intergenic
998228038 5:140341923-140341945 TCCCTGGGTAGGTGTGTGGGTGG - Intronic
999097611 5:148994565-148994587 TCATTGGTTGGGTATGTGGGTGG + Intronic
1000523247 5:162323612-162323634 TCCCGTGGTCTGTATGTGGTGGG + Intergenic
1004080383 6:12386747-12386769 TCCTTGTGTGTGTGTGTGGGGGG + Intergenic
1006082538 6:31575690-31575712 GCCGTGGGTCAGTATGTGAGAGG - Exonic
1007340691 6:41189580-41189602 TCCTTGGGTATGTGTGTCAGAGG - Intergenic
1008128782 6:47697227-47697249 TGCTTGTGTTTGCATGTGGGTGG - Intronic
1008687189 6:53938566-53938588 TTCTTAGGTATGTATGGGGGTGG - Intronic
1008983558 6:57514865-57514887 GCTTTGGGTATGTGTGTGGGTGG - Intronic
1009171612 6:60407759-60407781 GCTTTGGGTATGTGTGTGGGTGG - Intergenic
1011471371 6:87711049-87711071 TGCTTGGGTGTGTATGTGGTGGG - Intergenic
1011610285 6:89144171-89144193 TCCTTGTGTATATATGTGGGTGG - Intergenic
1013209700 6:107975341-107975363 TCCTGGAGTGTGTATGTGAGGGG + Intergenic
1014004361 6:116399760-116399782 TCTTTGTGTATGTGTGTGGGGGG + Intronic
1015276081 6:131384632-131384654 TCCTTGTGTGTGTGTGTGTGTGG - Intergenic
1015722647 6:136260229-136260251 TCCTGGGGTTGGTATGTAGGAGG - Exonic
1017996639 6:159537461-159537483 TCTTTGTGTGTGTGTGTGGGGGG - Intergenic
1018642449 6:165917153-165917175 TCCCTGGGTCTGCGTGTGGGCGG - Intronic
1018847601 6:167566358-167566380 TCCTTGGAGCTCTTTGTGGGTGG - Intergenic
1021387863 7:20053865-20053887 TCCTTGGGACAGGATGTGAGTGG - Intergenic
1021779262 7:24086132-24086154 TACTGGGGTCTGTCGGTGGGTGG - Intergenic
1022196415 7:28071624-28071646 TCCTTGGGTCTGTATGTGGGTGG - Intronic
1022405844 7:30089158-30089180 TCTTTGTGTCTGTATGGAGGAGG - Intronic
1023340761 7:39216930-39216952 TCTGTGGGTGTGTGTGTGGGTGG - Intronic
1023448438 7:40255955-40255977 TCCTTGTGTGTGCATGTTGGGGG + Intronic
1024002063 7:45196562-45196584 TTCTTGGGTTTCCATGTGGGTGG + Intergenic
1025639196 7:63351137-63351159 TCCTGGTGGCTGTGTGTGGGTGG - Intergenic
1025643503 7:63396955-63396977 TCCTGGTGGCTGTGTGTGGGTGG + Intergenic
1025713098 7:63929990-63930012 TCCTAGTGGCTGTGTGTGGGAGG + Intergenic
1026050538 7:66942851-66942873 TTCTTGGGTTTGTTGGTGGGTGG + Intronic
1029026979 7:97427161-97427183 TGCCTGGCTCCGTATGTGGGGGG - Intergenic
1029205840 7:98869189-98869211 TCCTGGGGTGTGTGTGTGGGTGG - Intronic
1030123418 7:106133025-106133047 ACCTTGTGTGTGTGTGTGGGGGG + Intergenic
1031266939 7:119592971-119592993 TCCTTGTGTCTGTGGCTGGGTGG - Intergenic
1032086750 7:128887995-128888017 TGTGTGGGTGTGTATGTGGGGGG - Intronic
1032192295 7:129771995-129772017 TCCTCCAGTGTGTATGTGGGGGG + Intergenic
1032290807 7:130588943-130588965 TCCTTGTGTGTATATGTGTGTGG - Intronic
1032375340 7:131410122-131410144 TATTTAGGTGTGTATGTGGGGGG + Intronic
1033597403 7:142867317-142867339 TCCCTGGGTGTGGATGTGGGAGG + Intronic
1033597421 7:142867418-142867440 TCCCTGTGTGTGGATGTGGGAGG + Intronic
1035192487 7:157183496-157183518 TCCAAGGGGCTGTCTGTGGGAGG - Intronic
1035755650 8:2029251-2029273 TTCTTGTGTGTGTATGTGTGTGG + Intergenic
1037995428 8:23348918-23348940 GACATGGGTCTGTATCTGGGAGG - Intronic
1039175798 8:34804655-34804677 TTCTTGGGTGTGTGTGTGTGTGG + Intergenic
1040645212 8:49389266-49389288 TCCTTGTGTGTGTAGGTTGGAGG - Intergenic
1042431247 8:68709221-68709243 TCCTTGGGGCTGTTTGTGTCAGG + Intronic
1043799861 8:84595015-84595037 TCATTTTGTCTGTATGTGGGTGG - Intronic
1044009829 8:86980957-86980979 TCCATGTGTGGGTATGTGGGAGG - Intronic
1046521075 8:115327126-115327148 TACTTTGGTCTGTATGGGGATGG - Intergenic
1047374537 8:124283265-124283287 GCATTGGTTCTGTATGTGGCTGG + Intergenic
1048694962 8:137016820-137016842 TCCTTGGATCTGTAAGTATGTGG + Intergenic
1049257775 8:141623073-141623095 TCCTGGGGGCTGTGTGTGCGTGG + Intergenic
1051581436 9:18680297-18680319 CCCTTGCTTCTGTAGGTGGGAGG + Exonic
1053004023 9:34592551-34592573 TCCCTTGGTGTGTGTGTGGGGGG - Intergenic
1054833492 9:69651848-69651870 TGGTTTGGTGTGTATGTGGGTGG - Intronic
1057266109 9:93619261-93619283 CCCTTGGGCCTGTGAGTGGGTGG + Intronic
1059845212 9:118268128-118268150 TCCCCGGGTGTGTATGTGTGTGG + Intergenic
1060036264 9:120258554-120258576 ATCATGGGTCTGCATGTGGGAGG - Intergenic
1061773482 9:132945074-132945096 TCCGAGGGTCTCTCTGTGGGCGG + Intergenic
1061958390 9:133975384-133975406 TCTTGGGGTCTGTTTCTGGGGGG + Intronic
1062352500 9:136145913-136145935 CCCTGGGGTCAGGATGTGGGTGG + Intergenic
1186182769 X:6988974-6988996 TACTTGGGTATGCATGTGGCAGG - Intergenic
1186526971 X:10257751-10257773 TCCTTTGGTGTGTGTGTGGGGGG - Intergenic
1186579994 X:10807557-10807579 TCCTTGCTTCTGTTTGTGGAGGG + Intronic
1189865546 X:45323533-45323555 TATTTGGGTCTGCAGGTGGGAGG - Intergenic
1189991161 X:46596430-46596452 TCCCTGGGTCTGGGGGTGGGGGG + Intronic
1193731256 X:85106755-85106777 TCCTGGGGGCTGTCTGTGGATGG + Intronic
1193944595 X:87719250-87719272 TCCTTGGGTCTCTAAATGGATGG - Intergenic
1194397500 X:93403905-93403927 TTCTTGGGTCTGGAAGTTGGTGG + Intergenic
1195460688 X:105120290-105120312 TATTTGTGTCTCTATGTGGGTGG + Intronic
1197825011 X:130579993-130580015 TCTTTGTGTCTGTGTGTGTGTGG + Intergenic
1199002519 X:142656228-142656250 TCCATTGGTCTGTATGTCTGTGG - Intergenic
1199802751 X:151267796-151267818 TCCGTGGGTCTATATATGAGAGG + Intergenic
1200860095 Y:7982251-7982273 TCCTTTTGTGTGTGTGTGGGGGG - Intergenic
1201908350 Y:19107594-19107616 TTCTTGGGTGTGTGTGTGTGGGG - Intergenic