ID: 1022196416

View in Genome Browser
Species Human (GRCh38)
Location 7:28071627-28071649
Sequence CCGTCCTTGGGTCTGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196416_1022196425 17 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196416_1022196421 -4 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196421 7:28071646-28071668 ACGGACCTTCTATCCAGTGACGG 0: 1
1: 0
2: 0
3: 2
4: 54
1022196416_1022196427 25 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196416_1022196424 16 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196416_1022196426 22 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196416 Original CRISPR CCGTCCTTGGGTCTGTATGT GGG (reversed) Intronic
900404870 1:2488279-2488301 CCATCCCTGGGACTGTAGGTGGG + Intronic
901898254 1:12334082-12334104 ACTTCCTTTGGTGTGTATGTTGG + Intronic
909890924 1:81005629-81005651 CCATCATTGGGTGTGTATATAGG - Intergenic
915590243 1:156866530-156866552 CCGTCCTGGGCTCTGTAGGGAGG + Intronic
916871312 1:168917610-168917632 CCTTCCTAGTGTCTGTATATAGG + Intergenic
923105199 1:230849044-230849066 CCTTCCTATGGTCTGCATGTCGG - Intronic
1065353966 10:24820989-24821011 CTGTCCTGGGGTCTGTATAGGGG + Intergenic
1070156416 10:73838329-73838351 CCTGCCCTGGGTCTGTATCTTGG + Intronic
1073480684 10:103784393-103784415 CCTGCCTTGGGTCTGCGTGTAGG - Intronic
1075144866 10:119873876-119873898 CCCTCCTTGGGGCTGTAGGAAGG + Intronic
1078718715 11:13863769-13863791 CCTTTCCTGGGTGTGTATGTGGG + Intergenic
1081224489 11:40503223-40503245 CTGTCCTGGGGTCTGTAGGAAGG - Intronic
1085763431 11:79261598-79261620 CCTTCCTTGGGTCTGGAGGCTGG + Intronic
1088447677 11:109949852-109949874 CCATTCTTGGGTCTGGATGATGG + Intergenic
1094777381 12:33746075-33746097 CCATTCTGGGGTCTGTATGATGG - Intergenic
1099189898 12:79551673-79551695 CTGTCAATGGGTGTGTATGTGGG + Intergenic
1103444971 12:120988674-120988696 CCGTCCCTGAGTCTATGTGTAGG + Intronic
1111819343 13:93194266-93194288 CCATCCTGGGGTCTGTAGGATGG - Intergenic
1118772479 14:68951475-68951497 CCCTCCTTGGGCATTTATGTTGG - Intronic
1122154154 14:99740339-99740361 CCCTCCTTGGGTGTGCAGGTGGG - Intronic
1122381964 14:101314099-101314121 CTGTCCGTGGCTCTCTATGTGGG + Intergenic
1124148537 15:27155633-27155655 CCGTCCTTGGGTTTATTTATTGG + Intronic
1127658809 15:61080896-61080918 CCATCCTTGTCTCTTTATGTAGG - Intronic
1132307373 15:100826080-100826102 TCGTCCTTGGGCCTGCATGCTGG - Intergenic
1133249836 16:4474010-4474032 CCGTCCTGGGGTCTGCAGGGAGG - Intronic
1136008695 16:27348351-27348373 CCATCCTTGGGACTCTCTGTAGG - Intronic
1142470924 17:162861-162883 CCGTCCTTGGGTCTGCCTCGGGG + Intronic
1142608460 17:1095295-1095317 CCGTCCTTGTGACTGGCTGTGGG - Intronic
1144696364 17:17306408-17306430 ACGTCCTTGGGTGTGTGTTTGGG + Intronic
1144829296 17:18122525-18122547 CAGTCTCTGGGTCTGTAAGTTGG + Intronic
1146813678 17:35924797-35924819 CCTTCCTGGGGTCTTAATGTAGG + Intronic
1146948260 17:36888799-36888821 CCTGCCTTGGGTCTGACTGTCGG - Intergenic
1152052430 17:77991454-77991476 CCTTCCTTGTGTCTAGATGTGGG + Intergenic
1156228093 18:35128901-35128923 CCCTCCTTGGGGCTGGCTGTAGG + Intronic
1166321740 19:42023004-42023026 CCAACCTTGGGTTTGTATCTGGG - Intronic
928112939 2:28525263-28525285 CCGTCCCTGGGTCTGGAGGCTGG - Exonic
928362739 2:30678774-30678796 CTCTCCCTGGGTCTGTAGGTGGG + Intergenic
928639932 2:33287660-33287682 TCATCCTTGGCTCTTTATGTAGG + Intronic
944029292 2:195214531-195214553 CTGTCCTTTGTTCTGGATGTTGG - Intergenic
946184722 2:217973704-217973726 CCGTCATGGGGCCTGGATGTTGG + Intronic
946851193 2:223908738-223908760 CCGACCTTGGGTGTGTGTGCTGG - Intronic
947625259 2:231614682-231614704 CCTTCCCTGGGGCTGTACGTTGG + Intergenic
947823778 2:233090580-233090602 CTGTCCTTGTGTCTGTGTGAGGG - Intronic
1169331142 20:4717371-4717393 CCTTCTTTGGGTCTGCAGGTGGG + Intergenic
1172870657 20:38133587-38133609 CAGACCTGGGGTCTGTTTGTAGG + Intronic
1175160336 20:57003535-57003557 CCGTCCCTGTGTCTGGATGCAGG - Intergenic
1175173184 20:57093835-57093857 CCTTCCCTGTGTCTGTCTGTAGG + Intergenic
950719881 3:14875293-14875315 CCTTCCTTGTGTGTGGATGTGGG + Intronic
954322707 3:49842924-49842946 CTGTCCATGGGTCTGGGTGTTGG - Intronic
954579600 3:51696109-51696131 GTCTCCTTGGGTCTGTGTGTGGG + Intronic
956887918 3:73579011-73579033 CCTTGCTTTGGTCTGAATGTTGG + Intronic
958049155 3:88322105-88322127 CCCTCCTGGGGTCTGTAATTCGG + Intergenic
960672103 3:120164339-120164361 CTGTCTTAGGGTCTGTATTTTGG - Intergenic
966222859 3:177567711-177567733 CCATCCTTGGGTCAGAAAGTTGG - Intergenic
977545090 4:98367488-98367510 CCGTCCTGGGGTCTGGAGGATGG - Intronic
978570411 4:110130859-110130881 CTGTGCATGGGTCTGTATTTAGG + Intronic
980775510 4:137431199-137431221 CCATTCTTGGGTCTGTAGGATGG - Intergenic
987424444 5:17756640-17756662 CCTTCCTTGGGGATGTGTGTGGG + Intergenic
987533045 5:19145407-19145429 CTATCCTTGGGTGTGTGTGTCGG + Intergenic
990404911 5:55479386-55479408 CCTTCCAGGGGTCTGTATTTAGG - Intronic
997117387 5:131139666-131139688 CCTTCCTTGGTTCTATTTGTCGG - Intergenic
997319058 5:132963226-132963248 CCGGCCCTGGGTCAGTCTGTCGG + Intronic
1004080380 6:12386744-12386766 CCTTCCTTGTGTGTGTGTGTGGG + Intergenic
1018268074 6:162046964-162046986 CTGTCCTTGAGTCTGAATGCTGG + Intronic
1019107222 6:169678126-169678148 CCATCCTGGGGTCTGGATGATGG - Intronic
1022196416 7:28071627-28071649 CCGTCCTTGGGTCTGTATGTGGG - Intronic
1023860878 7:44217079-44217101 CCGGGCTTGAGTCTGTATTTTGG + Intergenic
1027208933 7:76128065-76128087 CAGTGCATGGGTTTGTATGTAGG - Intergenic
1028058387 7:86277701-86277723 CCCTGATTGGGTGTGTATGTAGG + Intergenic
1031413902 7:121472795-121472817 CCCTCCTTGTGTCCATATGTAGG + Intergenic
1032189165 7:129753294-129753316 AGGTCTTTGGGTCTGGATGTTGG + Intronic
1032324167 7:130911150-130911172 CCTTCTTTGGGTCTGTAAATGGG + Intergenic
1034961239 7:155365920-155365942 CCGTCTTTGGGTCTGTGGTTAGG + Intronic
1045340374 8:101249217-101249239 CAGTCCATGGGTCTGTGGGTGGG - Intergenic
1048673511 8:136750176-136750198 CCCACTTTGGGTCTTTATGTTGG + Intergenic
1053097622 9:35342142-35342164 AGCTCCTTGGGTCTGTTTGTCGG + Intronic
1190089199 X:47422782-47422804 CCATCCTTAGGTATCTATGTGGG + Intergenic
1192763395 X:74119253-74119275 CTGCCTTTGGGTCTGTGTGTTGG - Intergenic
1194397499 X:93403902-93403924 CCATTCTTGGGTCTGGAAGTTGG + Intergenic
1196365278 X:114916580-114916602 TCGTTCCTGGGTGTGTATGTGGG - Intergenic
1200095366 X:153657069-153657091 GTGTCCTTGGGTCTGGGTGTGGG + Intergenic