ID: 1022196419

View in Genome Browser
Species Human (GRCh38)
Location 7:28071639-28071661
Sequence TGGATAGAAGGTCCGTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196419_1022196426 10 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196419_1022196425 5 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196419_1022196424 4 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196419_1022196427 13 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196419 Original CRISPR TGGATAGAAGGTCCGTCCTT GGG (reversed) Intronic
900310874 1:2032596-2032618 TGGGTGGAAGGCCCGCCCTTGGG - Intergenic
900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG + Intronic
905879352 1:41453597-41453619 TGGATAGACCATGCGTCCTTGGG - Intergenic
918636014 1:186775027-186775049 AGGATTGATGGTCTGTCCTTAGG + Intergenic
1062814453 10:489506-489528 TTGATTGAAGGTCAGGCCTTGGG - Intronic
1065468817 10:26055079-26055101 TGGATAGAAGCTGCTGCCTTAGG - Intronic
1098218416 12:68243581-68243603 TGGTTACAAAGTCCCTCCTTGGG - Intergenic
1102786349 12:115608159-115608181 TGGATAGAAGGCCCATCTTCTGG + Intergenic
1102786427 12:115608683-115608705 TGCCTTGAAGATCCGTCCTTTGG + Intergenic
1103007145 12:117430340-117430362 TGGAGAGAAGGGCCCTCCTGGGG - Intronic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1107242274 13:38250782-38250804 TTGATAAAAAGTCCTTCCTTTGG - Intergenic
1112956494 13:105065589-105065611 TGGAGAGAAGGTTCCCCCTTGGG + Intergenic
1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG + Exonic
1114897715 14:27012275-27012297 TGGAAAGAATGACTGTCCTTGGG - Intergenic
1123765303 15:23471909-23471931 TGGATAGAAGATTCGTTCTTTGG - Intergenic
1123836412 15:24198397-24198419 TTTATAGAAGGTCCATCCATAGG - Intergenic
1123845647 15:24298456-24298478 TTTATAGAAGGTCTGTCCATAGG - Intergenic
1123864683 15:24506165-24506187 TTTATAGAAGGTCTGTCCATAGG - Intergenic
1136549345 16:30974324-30974346 TGGATATGAGGTCGGTGCTTAGG + Intronic
1144157737 17:12523229-12523251 TGGTTAGAATGTCCTGCCTTGGG - Intergenic
1157757858 18:50234547-50234569 TGGTTACAAGGTCCCTCCTCAGG + Intronic
1157769649 18:50334663-50334685 TGGTTACAAGGTCCCTCCTCAGG - Intergenic
1158457303 18:57619531-57619553 TGGTTAAAAGTTCCTTCCTTGGG - Intronic
1158707834 18:59809670-59809692 TGGTTAGAAGTTCAGTCTTTAGG + Intergenic
1167725903 19:51212358-51212380 AGGATAGAAACTCCCTCCTTGGG + Intergenic
937706847 2:124931005-124931027 TGGAGAAAGGGTCCTTCCTTTGG - Intergenic
939127491 2:138194581-138194603 TGGATAGAAATTCAGTCCATAGG + Intergenic
945181864 2:207100180-207100202 TGGAGAGAAGGGCCCTCCCTGGG + Intronic
945877781 2:215296341-215296363 GGAATAGAATGTCCGTCTTTGGG + Intergenic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1170798491 20:19570620-19570642 TGGATAGAAGGTCTAGCGTTAGG + Intronic
1172269075 20:33642992-33643014 GGGATAGAGGGCCTGTCCTTTGG + Intronic
1173007913 20:39155320-39155342 TGGCTGGAAGGTCAATCCTTAGG + Intergenic
1178452148 21:32712037-32712059 TGGATAGTAGGCCCTTCATTTGG - Intronic
1179129340 21:38620720-38620742 TGGAGAGAAAGCCTGTCCTTGGG - Intronic
956050646 3:65244549-65244571 GGGATAGAAGCTCTATCCTTAGG - Intergenic
956984208 3:74678533-74678555 GGGAGAGAAGGTCAGACCTTTGG + Intergenic
957192286 3:77024996-77025018 AGGACAGAAGGTCTGTTCTTTGG + Intronic
962182974 3:133227491-133227513 TGGTTAGAAAGGCCTTCCTTAGG - Intronic
964532426 3:157682830-157682852 TGGGAAGAAGGTCCTACCTTTGG - Intergenic
994201311 5:96979363-96979385 TGAATAGAAGCTCAGGCCTTCGG + Exonic
1003303791 6:4908367-4908389 TGGATAGGTGGTATGTCCTTGGG + Intronic
1008325428 6:50175088-50175110 TGGGTAGAACTTCCTTCCTTGGG - Intergenic
1011502010 6:88000974-88000996 AGGATGGAAGCTCCATCCTTTGG + Intergenic
1012394431 6:98779807-98779829 TGGAGAGAGGGTGAGTCCTTTGG + Intergenic
1018323450 6:162637557-162637579 TGGATAGAAGGAATGTCCATGGG - Intronic
1018942547 6:168319266-168319288 TGGATGGAGGGGACGTCCTTTGG - Intronic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1034478493 7:151302562-151302584 TGGATAACAGGTCCCTTCTTGGG - Intergenic
1035468674 7:159096194-159096216 TGGATAGGAGGCCTGTCTTTGGG - Intronic
1036947100 8:13104889-13104911 TGGATATAAGGTCCCTCTATTGG + Intronic
1039709109 8:40037664-40037686 TGGATAGAAGAACCCTCCTGAGG - Intergenic
1042066581 8:64883836-64883858 TGGTTTGAAGGACCTTCCTTAGG - Intergenic
1053360510 9:37483260-37483282 CGGATAGAATCTCCGTCATTTGG + Intergenic
1193692515 X:84664292-84664314 TGGATACAAGTTACGTACTTTGG + Intergenic
1195868919 X:109465199-109465221 TTGATAGAAGGTCTTTTCTTGGG + Exonic