ID: 1022196420

View in Genome Browser
Species Human (GRCh38)
Location 7:28071640-28071662
Sequence CTGGATAGAAGGTCCGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196420_1022196427 12 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196420_1022196425 4 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196420_1022196426 9 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196420_1022196424 3 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196420 Original CRISPR CTGGATAGAAGGTCCGTCCT TGG (reversed) Intronic
900310875 1:2032597-2032619 CTGGGTGGAAGGCCCGCCCTTGG - Intergenic
903764573 1:25725871-25725893 CGGGGCAGAAGGTCCATCCTGGG + Intronic
913514364 1:119590469-119590491 CTGGATTAAAGGCCCCTCCTTGG - Intergenic
915955383 1:160216413-160216435 CTGGTTAGAAGAGCCATCCTTGG + Exonic
923862959 1:237910814-237910836 TTGGATAGAGGGTCAGTTCTGGG + Intergenic
1064647070 10:17470695-17470717 CTAGATAGAAAGTCCTTGCTGGG + Intergenic
1066482652 10:35812062-35812084 GTGAATAGAAGATCCTTCCTGGG - Intergenic
1067226730 10:44381484-44381506 CTGGGCAGAAGGTGGGTCCTTGG - Intronic
1069152036 10:64974852-64974874 GTGCATATAAGGTCCCTCCTAGG + Intergenic
1075942208 10:126400026-126400048 CTGAATAGTAGTTCCATCCTTGG - Intergenic
1076563787 10:131384707-131384729 CTGGAGAGAAGGTGAGTGCTTGG - Intergenic
1082813010 11:57489965-57489987 CTGGACAGAAGGGCCCTGCTAGG + Intronic
1089537789 11:119171265-119171287 CTGGGAGGAAGGTCCCTCCTTGG + Intronic
1091109090 11:132948605-132948627 CTGGAAAGACTGTCCCTCCTAGG - Intronic
1091602921 12:1928837-1928859 CAGGAGAGAAGGGCCCTCCTCGG + Intergenic
1098120616 12:67233590-67233612 TTGGATAGGAGGTCCATCCTTGG - Intergenic
1098218417 12:68243582-68243604 CTGGTTACAAAGTCCCTCCTTGG - Intergenic
1102597717 12:114005636-114005658 CTGGAGAGAATGTCCTTCCCAGG - Intergenic
1103007146 12:117430341-117430363 GTGGAGAGAAGGGCCCTCCTGGG - Intronic
1114659973 14:24337874-24337896 CTGGAAGGAGGGTCTGTCCTTGG + Exonic
1117051292 14:51862424-51862446 CTGGATCGAAGATCTATCCTAGG - Intronic
1121321196 14:92992633-92992655 CTGGAGAGTAGGTGAGTCCTCGG - Intronic
1126087428 15:45023174-45023196 CTGGATGGAAGGTGGGGCCTGGG - Exonic
1129407521 15:75329025-75329047 CTGGAGAGAAGGTGCCTACTGGG - Intergenic
1135620886 16:23954443-23954465 CTTGATAGAAGGTTCCTCCCAGG - Intronic
1138191043 16:55014439-55014461 CTGGGTAGAGAGTCCTTCCTAGG + Intergenic
1140332656 16:74072872-74072894 CTGGATAGAAGTTGCTACCTAGG - Intergenic
1141558953 16:84854057-84854079 CTGGATCAAAGGTCCCTCTTGGG - Intronic
1143734470 17:8900787-8900809 CTGGGTAGAAACTCCGTTCTGGG - Intronic
1144157738 17:12523230-12523252 CTGGTTAGAATGTCCTGCCTTGG - Intergenic
1146844790 17:36175765-36175787 CTGGATGGACCGTCCCTCCTGGG + Intronic
1146857094 17:36263700-36263722 CTGGATGGACCGTCCCTCCTGGG + Intronic
1146863521 17:36324675-36324697 CTGGATGGACCGTCCCTCCTGGG - Intronic
1146873006 17:36387610-36387632 CTGGATGGACCGTCCCTCCTGGG + Intronic
1146880364 17:36438696-36438718 CTGGATGGACCGTCCCTCCTGGG + Intronic
1147066381 17:37925263-37925285 CTGGATGGACCGTCCCTCCTGGG - Intronic
1147075889 17:37988235-37988257 CTGGATGGACCGTCCCTCCTGGG + Intronic
1147077914 17:38004824-38004846 CTGGATGGACCGTCCCTCCTGGG - Intronic
1147087414 17:38067781-38067803 CTGGATGGACCGTCCCTCCTGGG + Intronic
1147093850 17:38128759-38128781 CTGGATGGACCGTCCCTCCTGGG - Intergenic
1147103358 17:38191744-38191766 CTGGATGGACCGTCCCTCCTGGG + Intergenic
1149847932 17:60018213-60018235 CTGGATGGACCGTCCCTCCTGGG + Intergenic
1150086287 17:62274830-62274852 CTGGATGGACTGTCCCTCCTGGG + Intronic
1161553718 19:4928696-4928718 CTGGACAGTGGGACCGTCCTGGG + Intronic
1163738308 19:18995326-18995348 CTGGATCAAGGGTCTGTCCTAGG + Intronic
1164864816 19:31596126-31596148 TTGCATAGAAGGTCCTTCCGAGG - Intergenic
927202038 2:20583856-20583878 CTGGAAGGAAGGTCACTCCTGGG + Intronic
928456074 2:31423702-31423724 CTGTCTAGAAAGTCCCTCCTAGG + Intergenic
935496825 2:103792360-103792382 CTGGAGAGATGGTCCCTCCCAGG - Intergenic
937530768 2:122824485-122824507 CTGAAAATAATGTCCGTCCTGGG - Intergenic
938681250 2:133692842-133692864 CTGGACAGAAGGTTGATCCTGGG - Intergenic
948931794 2:241136862-241136884 CTGGACCCAAGGTCCTTCCTGGG + Intronic
1178630839 21:34260109-34260131 CTGGATATAAGCCCCGTCCATGG + Intergenic
1185148166 22:49150350-49150372 CTGGATGGAAGGTCCAACCCCGG - Intergenic
954030706 3:47818095-47818117 CTCGAGAGATGGTCCCTCCTGGG - Exonic
954148090 3:48644161-48644183 CAGGATGGCAGGTCCCTCCTGGG - Intronic
954462067 3:50632926-50632948 CTGGATAGGGGGCCCTTCCTGGG + Intronic
960869014 3:122230687-122230709 CTGCATAGAAGGGGCTTCCTGGG + Intronic
968394077 4:217203-217225 TGGGATAGAAGGTGGGTCCTAGG - Intergenic
971007189 4:22388463-22388485 CTGAATACGAGCTCCGTCCTGGG + Exonic
976378533 4:84373429-84373451 CTGTCTAGAAAGTCCCTCCTAGG - Intergenic
981584602 4:146287209-146287231 CTGGTGAGAAGGACCGTCTTTGG + Intronic
983833098 4:172355936-172355958 CTGGATGGAAAGTCTATCCTGGG + Intronic
986436959 5:7743660-7743682 CCCGGTAGAACGTCCGTCCTGGG + Exonic
986643920 5:9897923-9897945 CTGTATTGAAGATGCGTCCTTGG - Intergenic
992417645 5:76566966-76566988 ATGGACAGAAGGGCCTTCCTTGG + Intronic
992894124 5:81232484-81232506 CTGGGTAGAAGGTTATTCCTGGG + Intergenic
1008325429 6:50175089-50175111 CTGGGTAGAACTTCCTTCCTTGG - Intergenic
1021998862 7:26205654-26205676 GTGGATACAAGGTCTGTCATAGG + Intronic
1022196420 7:28071640-28071662 CTGGATAGAAGGTCCGTCCTTGG - Intronic
1023535501 7:41204435-41204457 CTGGAGAGAAGGTTCTTCCCTGG - Intergenic
1037550100 8:19962435-19962457 CTGGGTTGAAGGTCCGGGCTGGG - Intronic
1041834403 8:62195690-62195712 CTGGATTAAAGGTCTGTGCTGGG - Intergenic
1053923071 9:43019221-43019243 CTGGGTTTAAGGTCGGTCCTGGG + Intergenic
1059365228 9:113781584-113781606 CTGTATAGCAGGACCTTCCTGGG - Intergenic
1059413950 9:114151803-114151825 CAGGATACAAGGCCCTTCCTTGG + Intergenic
1062538861 9:137032677-137032699 CCGGAGAGGAGGTCTGTCCTGGG + Exonic
1189773312 X:44447320-44447342 CTGGAGAAAAGGTCAGTCCTAGG + Intergenic
1190024203 X:46907819-46907841 CTGCATGCAAGGTCGGTCCTTGG - Intergenic
1195868918 X:109465198-109465220 CTTGATAGAAGGTCTTTTCTTGG + Exonic
1201520569 Y:14869220-14869242 CTGGATAGAACGCCACTCCTGGG - Intergenic