ID: 1022196422

View in Genome Browser
Species Human (GRCh38)
Location 7:28071651-28071673
Sequence AAGTGCCGTCACTGGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196422_1022196424 -8 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196422_1022196425 -7 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196422_1022196427 1 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196422_1022196428 22 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196428 7:28071696-28071718 GGTGATGACAAAAATATGCTTGG 0: 1
1: 0
2: 0
3: 17
4: 171
1022196422_1022196426 -2 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196422 Original CRISPR AAGTGCCGTCACTGGATAGA AGG (reversed) Intronic
907455082 1:54570429-54570451 AAGTGCTGTGACTGGCCAGATGG - Intronic
911936680 1:103985142-103985164 TAATACCGTCTCTGGATAGAAGG - Intergenic
915954185 1:160209178-160209200 ATGTGCCAGCACTGGATATATGG - Intronic
919114534 1:193264132-193264154 AAGTGACGCCACTGGATTGGAGG + Intergenic
1070428600 10:76314525-76314547 AAGTGCCATCACTGAAGAGTTGG + Intronic
1075634877 10:124023764-124023786 AATTGCCTTCCCTGGAAAGAGGG - Intronic
1084633115 11:70369141-70369163 AAGTGCCTCAACTGGATAAAAGG - Intronic
1084734269 11:71094273-71094295 AAGTCCCTTGACTGAATAGAAGG + Intronic
1087675795 11:101159522-101159544 AAGTGCCATCAATGGACAAAAGG - Intergenic
1091805230 12:3351156-3351178 AAATGCAGTCACTGGTTAGGTGG - Intergenic
1097198931 12:57261779-57261801 AAGTGCTGTCACTGGGCAGAGGG - Intronic
1097695100 12:62767937-62767959 AAGTCCAGTCACTGGATTTAGGG + Intronic
1101802750 12:108036524-108036546 AAGTGCTGCTTCTGGATAGAAGG + Intergenic
1104826741 12:131716069-131716091 TAGTGCAGTCACAGGATGGAAGG - Intronic
1113085928 13:106569549-106569571 CAGTGCCCTCACATGATAGAAGG + Intergenic
1116434007 14:44876771-44876793 AAGAGTCATCACTGGATAAAAGG + Intergenic
1116734210 14:48668758-48668780 AAGTGCTGTCATTGGAGACATGG - Intergenic
1116735015 14:48678149-48678171 AAGTGTAGTCACTGGATAACTGG - Intergenic
1118283398 14:64449515-64449537 AAGTGCACTCACTGGGCAGAAGG + Exonic
1122121800 14:99558382-99558404 ACGTGCAGTCACTGGATTTAGGG - Intronic
1122158066 14:99762746-99762768 AAGTGCAGTGACTGGAAATATGG - Intronic
1122743712 14:103886011-103886033 AAGGGCCGTAACTGCATTGATGG + Intergenic
1124581970 15:30964055-30964077 AATTTCCTTAACTGGATAGAGGG + Intronic
1125259602 15:37808006-37808028 AGGTGCTGTCACTGAATGGAAGG - Intergenic
1129584579 15:76849468-76849490 CAGTGCCATCACAGGATGGAGGG - Intronic
1130082351 15:80745187-80745209 AAGGGTCATCACTGGAGAGAAGG - Intronic
1138387544 16:56646321-56646343 TTGTGCCCTGACTGGATAGATGG + Intronic
1147933875 17:44000260-44000282 TAGTGCAGGCACAGGATAGATGG + Intronic
1155777311 18:29781119-29781141 AAGTGCCTTCACTGGAGGAATGG + Intergenic
1160027540 18:75230907-75230929 AAGTGCCATCAGTGGATGGGAGG + Intronic
1163189972 19:15670507-15670529 AAGTGCCCCCAGTGGCTAGAGGG - Intergenic
930218160 2:48718759-48718781 ATGTGCCGGCAGTGGTTAGATGG + Intronic
937154339 2:119708023-119708045 AAGTGCTGTCGCTGGAGAGCAGG - Intergenic
940065787 2:149627072-149627094 CAGAGCCTTTACTGGATAGATGG - Intergenic
947803107 2:232944287-232944309 ATGTGGCGTCACTGGGTGGAAGG - Intronic
948582817 2:238999474-238999496 AAGTGCTGAGACTGGAGAGAAGG - Intergenic
1169601739 20:7269015-7269037 AAGTTCCATCACTGGATAAATGG - Intergenic
1170001214 20:11616399-11616421 AGCTGCAGTCACTGGATTGAGGG - Intergenic
1171032933 20:21693139-21693161 AAGTGCGGTTACTGAATTGAGGG - Intergenic
1172387978 20:34547338-34547360 AAGGGAAGTGACTGGATAGAGGG + Intronic
1173747933 20:45452372-45452394 GAGTGCCGTCAGTGGGTAGAAGG + Intergenic
1174731037 20:52917930-52917952 AAGTGCTATCACTGGAGAAAAGG - Intergenic
1174979046 20:55371424-55371446 AAGTTCCATCAATGGATAAATGG - Intergenic
1178143311 21:29708677-29708699 AAGAGCAGTCACTGGGCAGAGGG - Intronic
1181651075 22:24259546-24259568 AAGTGCCCTCTCTGGGGAGAAGG - Intergenic
1182778927 22:32851842-32851864 CAGTGGTGTCTCTGGATAGAAGG - Intronic
949771819 3:7587508-7587530 AAGAGCTGACACTGGAGAGACGG + Intronic
952363878 3:32657872-32657894 ATGTGATGTCACTGAATAGAAGG - Intergenic
969635673 4:8368281-8368303 AAGTGGCCTCACTGGGAAGATGG + Intronic
969682441 4:8650814-8650836 AAATGCAGTCACTGGACAGCAGG + Intergenic
978836923 4:113162005-113162027 AAGTGCTGTCACTGTAGAGTAGG - Intronic
983633390 4:169872918-169872940 CAGTGCCCTCACTTGATAGATGG + Intergenic
986074299 5:4318696-4318718 AAATGCCTTAACTAGATAGAAGG - Intergenic
986641647 5:9877646-9877668 AAGTGCTGTCTCTGGGTAAATGG + Intergenic
988841168 5:35085350-35085372 AAGTGCAGTCATTGGAAAGTGGG + Intronic
990307646 5:54508693-54508715 AAATGCCCTCATTGGATATAAGG - Intergenic
995112934 5:108447412-108447434 AAGTGAACTCACTGGATTGAGGG + Intergenic
998328000 5:141298962-141298984 AAGTGCAGGCCCTGGACAGAGGG + Intergenic
999419371 5:151427672-151427694 AAGTGCTGTCACTGGGGCGAGGG + Intergenic
1004498377 6:16186121-16186143 CAGTGACATCACTGGGTAGAGGG + Intergenic
1007987803 6:46224664-46224686 AAGTGCCTCCACTGGATGGCTGG + Intronic
1011020664 6:82809179-82809201 AAGTGCCCTGACCGGAGAGAAGG + Intergenic
1018283070 6:162208316-162208338 AAGTACATTCACTGGATGGATGG - Intronic
1022196422 7:28071651-28071673 AAGTGCCGTCACTGGATAGAAGG - Intronic
1027418005 7:77992664-77992686 AAAGGCAGTCACTGAATAGAAGG + Intergenic
1036998224 8:13685453-13685475 AATTGTGGTCACTGGACAGATGG + Intergenic
1037252240 8:16909672-16909694 AAGTTCAGTCACGGGTTAGAAGG - Intergenic
1045290885 8:100831720-100831742 AAGTTCAGTCTCTGGAGAGACGG + Intergenic
1060236804 9:121869859-121869881 AAGTGCCCCCACAGGGTAGAGGG + Intronic
1186242415 X:7583902-7583924 AAGTGCCGTTGCTGGAGTGAAGG - Intergenic
1186602778 X:11056222-11056244 AAGTACCTTCACAGGACAGAGGG - Intergenic
1201687472 Y:16722806-16722828 AGGTGGTGTCACTGGAGAGAAGG + Intergenic