ID: 1022196424

View in Genome Browser
Species Human (GRCh38)
Location 7:28071666-28071688
Sequence CGGCACTTACAGCTGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196418_1022196424 15 Left 1022196418 7:28071628-28071650 CCACATACAGACCCAAGGACGGA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196420_1022196424 3 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196419_1022196424 4 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196416_1022196424 16 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196413_1022196424 26 Left 1022196413 7:28071617-28071639 CCATTTGCCACCCACATACAGAC 0: 1
1: 0
2: 3
3: 21
4: 226
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196415_1022196424 19 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196422_1022196424 -8 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196424 Original CRISPR CGGCACTTACAGCTGATTAA AGG Intronic