ID: 1022196424

View in Genome Browser
Species Human (GRCh38)
Location 7:28071666-28071688
Sequence CGGCACTTACAGCTGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196420_1022196424 3 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196419_1022196424 4 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196415_1022196424 19 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196416_1022196424 16 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196418_1022196424 15 Left 1022196418 7:28071628-28071650 CCACATACAGACCCAAGGACGGA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196422_1022196424 -8 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49
1022196413_1022196424 26 Left 1022196413 7:28071617-28071639 CCATTTGCCACCCACATACAGAC 0: 1
1: 0
2: 3
3: 21
4: 226
Right 1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196424 Original CRISPR CGGCACTTACAGCTGATTAA AGG Intronic
901154266 1:7124960-7124982 CGGCACTTAGAGTGGATTTAAGG - Intronic
905596814 1:39214690-39214712 CCGCACTTACAGCTGCCAAAAGG - Intronic
1071328230 10:84537321-84537343 CTGCACTTACAGCTATTAAATGG + Intergenic
1080281504 11:30562646-30562668 AGGCACCTACAGCTTATTAAGGG + Intronic
1092874439 12:12835843-12835865 CGGCACTGGCAGATGATTGAAGG - Intergenic
1101432148 12:104635419-104635441 CGGCAATTACATCTTCTTAAGGG - Intronic
1102329266 12:112014853-112014875 TGGCACTTGCAGCTCATTCAAGG + Intronic
1103189903 12:118992468-118992490 CAGAACTTCCAGCTGATAAAGGG + Intronic
1110463842 13:75778556-75778578 CGGTGCTTACATCTGCTTAAGGG - Intronic
1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG + Intergenic
1112787483 13:102967067-102967089 AGAAACTTACAGTTGATTAAGGG + Intergenic
1114867025 14:26608336-26608358 CACCACTTCCAGCTGATTGATGG - Intergenic
1120439994 14:84524242-84524264 TGTCACTTACAGCTGAAAAATGG - Intergenic
1124975578 15:34527082-34527104 TGACACTTAGAGCTGTTTAAAGG - Exonic
1136672803 16:31873594-31873616 CGGGTATTACAGCTAATTAAGGG - Intergenic
1144412355 17:15013433-15013455 CTGCACTGGCAGCTGATTAGAGG - Intergenic
1151217366 17:72586621-72586643 CGTCACTTAAAGCTCAATAAGGG + Intergenic
1153501089 18:5750883-5750905 CTGCACTTCCAGATGATTAGAGG + Intergenic
1159841770 18:73406546-73406568 GGGCATTGTCAGCTGATTAAAGG - Intergenic
1161523341 19:4738270-4738292 CAGCAATTACAGCTAATAAACGG - Intergenic
925242391 2:2343116-2343138 TGTCACTTAGAACTGATTAAAGG - Intergenic
926841861 2:17089760-17089782 CCACACTGGCAGCTGATTAATGG + Intergenic
927945646 2:27133693-27133715 CTGCAGCTAGAGCTGATTAATGG - Exonic
929115371 2:38439447-38439469 TGGCACTTTCAGCTGCTTCATGG + Intergenic
939351218 2:141040522-141040544 AGGCACATACAGCAGATTACAGG - Intronic
942397657 2:175568599-175568621 TGAAAATTACAGCTGATTAAAGG + Intergenic
945250341 2:207760559-207760581 AGGCACTTTCAGCTGATGAGAGG - Intronic
1170350976 20:15440634-15440656 CAGCATTTAAAGCTGATGAAGGG - Intronic
1170907700 20:20530628-20530650 CGGCACTTACAGCTGACGCCTGG - Intronic
1175857075 20:62127142-62127164 AGGCACTTACAGTAGAATAAGGG - Intronic
950588963 3:13921643-13921665 CCGCACTGGCAGCTGATTAATGG - Intergenic
950785491 3:15430694-15430716 TGGCACATTCAGCTGATTTAGGG + Intronic
952189609 3:31008860-31008882 ATGCACTTACAGCTGAGTAGGGG - Intergenic
962462270 3:135625425-135625447 CTGCATTTTTAGCTGATTAAGGG + Intergenic
965206322 3:165721913-165721935 TGGAACTTACAGCTCTTTAACGG + Intergenic
971470458 4:27020075-27020097 AGGCTTTTACAACTGATTAATGG + Intronic
974469524 4:62301361-62301383 GGGCACTTCAAGCTGAATAAAGG + Intergenic
994111074 5:96005075-96005097 CTGCCCTCACAACTGATTAATGG - Intergenic
1003781708 6:9435501-9435523 CTCCAGTTACAGCTGATTAAAGG - Intergenic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1006703248 6:35994424-35994446 CGGCAATGACAGGAGATTAAGGG - Intronic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1017575030 6:155792821-155792843 CGCCTCTTACAGGTGATTTATGG + Intergenic
1020223658 7:6262080-6262102 CAGCAATTACAGCTGAAGAAAGG + Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1030274102 7:107701044-107701066 TGGCACCTAAAGCTTATTAATGG - Intronic
1041319881 8:56602157-56602179 GGGTGCTTACAGCTGATTGATGG + Intergenic
1044814850 8:96101190-96101212 AGGCAGTTACAGCTGACTGATGG + Intergenic
1055117717 9:72623670-72623692 CAGCACTAACAGCTGATACATGG - Intronic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1059458966 9:114417728-114417750 CGGCACTTAGTGGTGAATAAAGG + Intronic
1190525515 X:51325908-51325930 TGGTACTTACAGCTGCTTCAAGG - Intergenic
1190543965 X:51505722-51505744 TGGTACTTACAGCTGCTTCAAGG + Intergenic