ID: 1022196425

View in Genome Browser
Species Human (GRCh38)
Location 7:28071667-28071689
Sequence GGCACTTACAGCTGATTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196420_1022196425 4 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196422_1022196425 -7 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196418_1022196425 16 Left 1022196418 7:28071628-28071650 CCACATACAGACCCAAGGACGGA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196413_1022196425 27 Left 1022196413 7:28071617-28071639 CCATTTGCCACCCACATACAGAC 0: 1
1: 0
2: 3
3: 21
4: 226
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196415_1022196425 20 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196416_1022196425 17 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303
1022196419_1022196425 5 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG 0: 1
1: 0
2: 1
3: 22
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196425 Original CRISPR GGCACTTACAGCTGATTAAA GGG Intronic
901154265 1:7124959-7124981 GGCACTTAGAGTGGATTTAAGGG - Intronic
901478749 1:9509334-9509356 TGCTCTGACAGCTGATTAGATGG - Intergenic
905465561 1:38150633-38150655 ATCACTAGCAGCTGATTAAATGG - Intergenic
905596813 1:39214689-39214711 CGCACTTACAGCTGCCAAAAGGG - Intronic
906885125 1:49636971-49636993 CGCACTGGCAGCTGGTTAAATGG - Intronic
908036848 1:60064002-60064024 TGCACTGGCAGCTGATTAGATGG - Intronic
908346373 1:63237706-63237728 TGCACTGGCAGCTGATTAGATGG - Intergenic
909100774 1:71345194-71345216 TGTGCTTACAGCTGATTAGATGG + Intergenic
911642981 1:100308473-100308495 TGCACTGGCAGCTGATTAGATGG + Intergenic
912149388 1:106838830-106838852 GGGACTTAAAGGTGATTAATAGG - Intergenic
912642146 1:111357342-111357364 GGCCCTCACAGCTGAGAAAAGGG - Intergenic
917411303 1:174762554-174762576 GGGACTGATACCTGATTAAATGG + Intronic
918711990 1:187742568-187742590 TGCACTGGCAGCTGATTAGATGG - Intergenic
918796562 1:188905607-188905629 TGCACTGGCAGCTGATTAGATGG - Intergenic
918847518 1:189637441-189637463 TGCACTGGCAGCTGATTAGATGG - Intergenic
919582366 1:199392302-199392324 CGCACTGGCAGCTGATTAGATGG + Intergenic
920313450 1:205061802-205061824 GGAGCTTCCAGCTCATTAAAAGG - Intronic
920361035 1:205416590-205416612 GGGGCTTACAGCTGGTTCAAAGG - Intronic
1063870492 10:10411713-10411735 GGCATTTAGAGATGATTAGAAGG - Intergenic
1064546093 10:16451232-16451254 TGCACTGGCAGCTGATTAGATGG + Intronic
1067332704 10:45336677-45336699 TGCACTGGCAGCTGATTAGATGG - Intergenic
1067385224 10:45812613-45812635 TGCATATACAGTTGATTAAATGG - Intergenic
1067449799 10:46375346-46375368 TGCATATACAGTTGATTAAATGG + Intergenic
1068446775 10:57134999-57135021 TGCACTGGCAGCTGATTAGATGG - Intergenic
1070848383 10:79542415-79542437 GGTAGTAACAGCTGCTTAAAAGG - Intergenic
1071610538 10:87027491-87027513 TGCACGTACAGTTGATTAAATGG + Intergenic
1071829539 10:89358076-89358098 GGCAGTTACAGGTATTTAAATGG - Intronic
1072589895 10:96819659-96819681 TGTACTGGCAGCTGATTAAATGG - Intergenic
1073033996 10:100550387-100550409 CTCACTTACAGATGAATAAATGG + Exonic
1073370883 10:102987962-102987984 GGTGCATACAGCTGATTAACAGG - Intronic
1074133994 10:110611108-110611130 TGCACTGGCAGCTGATTAGATGG + Intergenic
1074510329 10:114105759-114105781 TGCACTGGCAGCTGATTAGATGG - Intergenic
1078030925 11:7750180-7750202 TGCACTAACAGCTAATTAGATGG - Intergenic
1078849480 11:15150968-15150990 GGCAGTGACAGCTGCTTTAAAGG + Intronic
1079027778 11:16962338-16962360 GGCACTTACTGCTCATTGACTGG - Intronic
1079670386 11:23162710-23162732 TGCACTGGCAGCTGATTAGATGG - Intergenic
1079981752 11:27158444-27158466 AGCACTTAAAGCTCATGAAATGG + Intergenic
1081379852 11:42400988-42401010 TGCACTGGCAGCTGATTAGATGG - Intergenic
1081439206 11:43061905-43061927 TGCACTGGCAGCTGATTAGATGG + Intergenic
1082208535 11:49468614-49468636 GTCACTGGCAGCTGATTAGATGG - Intergenic
1082625111 11:55475240-55475262 GAGACTTACAGCTCCTTAAAAGG + Intergenic
1085937817 11:81171181-81171203 AGCACTGGCAGCTGATTAGATGG + Intergenic
1085937977 11:81172796-81172818 GGCACTGGCAGCTGATTAGATGG + Intergenic
1086181355 11:83955712-83955734 TGCACTGGCAGCTGATTAGATGG - Intronic
1086278192 11:85157037-85157059 TGCACTGGCAGCTGATTAGATGG - Intronic
1086641083 11:89156507-89156529 GTCACTGGCAGCTGATTAGATGG + Intergenic
1086699991 11:89890367-89890389 GGAACTTACACTTGATGAAATGG - Intergenic
1086706179 11:89954149-89954171 GGAACTTACACTTGATGAAATGG + Intergenic
1087639155 11:100736653-100736675 GCCACTTGCAGCAGATTTAAAGG + Intronic
1088049887 11:105499069-105499091 GGCACTGACAGCTGATTAGATGG + Intergenic
1088102613 11:106171821-106171843 CGCACTGGCAGCTGATTAGATGG - Intergenic
1088544309 11:110944598-110944620 TGCACTGGCAGCTGATTAGACGG + Intergenic
1088600301 11:111468528-111468550 GCCACTCACAGCTGAGTCAAAGG + Intronic
1092092860 12:5818234-5818256 TGCACTGGCAGCTGATTAGATGG - Intronic
1092874438 12:12835842-12835864 GGCACTGGCAGATGATTGAAGGG - Intergenic
1095188385 12:39228077-39228099 AACACTTGAAGCTGATTAAATGG + Intergenic
1096447562 12:51707536-51707558 TTCACTGACAGCCGATTAAATGG + Intronic
1096605579 12:52763265-52763287 GGCACCTACAGCTCAGTAATCGG + Intergenic
1096953675 12:55503320-55503342 TGCACTGGCAGCTGATTAGATGG + Intergenic
1097518572 12:60638534-60638556 TGCACTGGCAGCTGATTAGATGG - Intergenic
1099526734 12:83726144-83726166 TGCACTGGCAGCTGATTAGATGG - Intergenic
1102141709 12:110620735-110620757 GACATTTCCAGCTGATTATAAGG + Intronic
1102669897 12:114609267-114609289 CGCACTGGCAGCTGATTAGATGG - Intergenic
1104346533 12:128004750-128004772 GATGCTTGCAGCTGATTAAAAGG + Intergenic
1109713127 13:66184649-66184671 TGCACTGTCAGCTGATTAGACGG + Intergenic
1109843480 13:67951789-67951811 TGCACTGGCAGCTGATTAGATGG + Intergenic
1110164505 13:72423300-72423322 TGCACTTACAGCATGTTAAAAGG - Intergenic
1111915703 13:94357685-94357707 GGCACTTACACCACAGTAAAGGG - Intronic
1112189940 13:97166541-97166563 CTCACTGACAGCTGATTAGATGG - Intergenic
1112832512 13:103471144-103471166 TGCACTGGCAGCTGATTAGATGG + Intergenic
1112900837 13:104354739-104354761 TGCACTGGCAGCTGATTAGATGG + Intergenic
1113096235 13:106666900-106666922 TGCACTGACAGCTGATTAGATGG + Intergenic
1113355345 13:109574352-109574374 TGCACTGGCAGCTGATTAGATGG + Intergenic
1114905661 14:27122758-27122780 TGCACTGGCAGCTGATTAGATGG + Intergenic
1116414555 14:44664996-44665018 TGCACTGGCAGCTGATTAGATGG - Intergenic
1116414641 14:44665738-44665760 AGCACTGGCAGCTGATTAGATGG - Intergenic
1117491316 14:56250697-56250719 TGCACTGGCAGCTGATTAGATGG + Intronic
1118122115 14:62857697-62857719 TGCACTGGCAGCTGATTAGATGG + Intronic
1118779986 14:69001475-69001497 TGCACTTACAGGAGATTCAAAGG - Intergenic
1120483610 14:85083237-85083259 TGCACTGGCAGCTGATTAGATGG - Intergenic
1120676847 14:87430654-87430676 CGCACTGGCAGCTGATTAGATGG - Intergenic
1122965673 14:105124127-105124149 GGCACTTACTGTTGCTTGAAAGG - Intergenic
1123886414 15:24732057-24732079 GGCAATTACAACCAATTAAATGG + Intergenic
1124392661 15:29273667-29273689 CGCACTGGCAGCTGATTAGATGG - Intronic
1126027534 15:44462353-44462375 GGCACTAGCAGCTGATTTCAGGG + Intronic
1126140804 15:45436969-45436991 GGCTCTTACAGCTTAGGAAAGGG + Intronic
1126283915 15:46988733-46988755 CACACTGGCAGCTGATTAAATGG - Intergenic
1126848125 15:52780345-52780367 GGCACTACCAGCTCATTAAAAGG - Intronic
1126973753 15:54150328-54150350 GGCAGTTACAGCTGCTCGAAAGG + Intronic
1128054735 15:64691210-64691232 CTCAATTACAGCAGATTAAAAGG + Intronic
1131651868 15:94409153-94409175 TGCACTGGCAGCTGATTAGATGG - Intronic
1132753448 16:1470136-1470158 TGCACTCACGGATGATTAAACGG + Intronic
1134100256 16:11446941-11446963 GGCACTGCCAGCTGCTTTAATGG - Intronic
1134778300 16:16872132-16872154 CACACTCACAGCTGATTAGATGG + Intergenic
1135964400 16:27023850-27023872 TGCACTGGCAGCTGATTAGATGG - Intergenic
1136134918 16:28249898-28249920 CACACTTGCAGCTGATTAGATGG - Intergenic
1138033885 16:53583042-53583064 TGCACTGGCAGCTGATTAGATGG - Intergenic
1139116729 16:63963355-63963377 TGCACTGGCAGCTGATTAGATGG - Intergenic
1140232074 16:73125544-73125566 TGCACTGGCAGCTGATTAGATGG - Intergenic
1140402131 16:74680103-74680125 GGCACTTTCAGCTGTCTATAAGG + Intronic
1143241108 17:5444090-5444112 GGCACCTTCAGCTGATTCCAAGG + Exonic
1144412354 17:15013432-15013454 TGCACTGGCAGCTGATTAGAGGG - Intergenic
1148995819 17:51708695-51708717 TGCACTGGCAGCTGATTAGATGG - Intronic
1149585628 17:57784331-57784353 GGCACAGACAGTTGATTAAGTGG - Intergenic
1150935534 17:69631325-69631347 TGCACTGGCAGCTGATTAGATGG - Intergenic
1150956232 17:69863224-69863246 GGCACTGGCAGCTGATTAGATGG + Intergenic
1151069063 17:71187351-71187373 AGCACTGGCAGCTGATTAGATGG + Intergenic
1153160892 18:2203587-2203609 GGAACTCTCAGCTGATTTAAAGG + Intergenic
1153713194 18:7820372-7820394 GGCACCTCCAACTGAATAAAAGG + Intronic
1157604060 18:48914722-48914744 GGCTCTCATAGCTGTTTAAATGG + Intergenic
1158946085 18:62448074-62448096 TGCACTGGCAGCTGATTAGATGG - Intergenic
1159136396 18:64341912-64341934 TGCACTGGCAGCTGATTAGATGG + Intergenic
1159162488 18:64661039-64661061 GGCACTGGCAGCTGATTAGATGG - Intergenic
1159204212 18:65229241-65229263 TGCACTGGCAGCTGATTAGATGG + Intergenic
1159455040 18:68650738-68650760 TGCACTGGCAGCTGATTAGATGG + Intergenic
1159613262 18:70549753-70549775 AGCACTATCAACTGATTAAATGG - Intergenic
1159780681 18:72657213-72657235 TGCACTGGCAGCTGATTAGATGG - Intergenic
1159841769 18:73406545-73406567 GGCATTGTCAGCTGATTAAAGGG - Intergenic
1163344777 19:16733698-16733720 AGCACTGAGAGCTGATGAAATGG + Intronic
1163410578 19:17151477-17151499 AGCATTTACAGCTCAATAAAAGG + Intronic
1164875526 19:31683306-31683328 GGCACTGGCAGCAGATTAGATGG - Intergenic
925460279 2:4056917-4056939 TGCACTGGCAGCTGATTAGATGG - Intergenic
925539347 2:4950135-4950157 TGCACTGGCAGCTGATTAGATGG + Intergenic
925621465 2:5797463-5797485 CTCTCTTACAGCTGAGTAAATGG - Intergenic
926192884 2:10741719-10741741 GGCCCTTAGAGCTGAGGAAATGG - Intronic
926840038 2:17070191-17070213 TGCACTGACAGCTGATTAGATGG + Intergenic
927466975 2:23344374-23344396 GACACTCACACTTGATTAAATGG - Intergenic
928490158 2:31775065-31775087 CGCACTGGCAGCTGATTAAATGG - Intergenic
928565980 2:32549729-32549751 TTCAGTTACAGATGATTAAAAGG - Intronic
929115372 2:38439448-38439470 GGCACTTTCAGCTGCTTCATGGG + Intergenic
929418942 2:41771332-41771354 GTCACCTTCAGCTGATTCAAAGG + Intergenic
931477469 2:62603958-62603980 AGCTCTTACTGCTGATGAAATGG - Intergenic
933052914 2:77622607-77622629 TGCGCTGACAGCTGATTAGATGG + Intergenic
934151194 2:89149223-89149245 TGCACTGGCAGCTGATTAGATGG - Intergenic
934216066 2:90032684-90032706 TGCACTGGCAGCTGATTAGATGG + Intergenic
934305604 2:91819374-91819396 TTCACTGACAGCTGATTAAATGG - Intergenic
934327652 2:92033374-92033396 TTCACTGACAGCTGATTAAATGG + Intergenic
934466034 2:94263904-94263926 TTCACTGGCAGCTGATTAAATGG + Intergenic
935476983 2:103534767-103534789 TGCACTGACAGCTGATTGGATGG - Intergenic
935832471 2:107014671-107014693 TGCACTGGCAGCTGATTAGATGG - Intergenic
936719929 2:115239067-115239089 AGCACTGGCAGCTGATTAGATGG + Intronic
937820116 2:126300974-126300996 TGCACTGGCAGCTGATTAGATGG + Intergenic
938272462 2:129985971-129985993 TGCACTGGCAGCTGATTAGAGGG - Intergenic
939086075 2:137720058-137720080 CACACTCACAGCTGATTAGATGG - Intergenic
939832496 2:147089389-147089411 TGCACTGACAGCCGATTAGATGG + Intergenic
940701280 2:157046275-157046297 GTCACTTAAGGCAGATTAAATGG - Intergenic
940753432 2:157654568-157654590 TGCACTGGCAGCTGATTAAATGG - Intergenic
942104730 2:172621289-172621311 CACACTGACAGCTGATTAGATGG - Intergenic
942237299 2:173923816-173923838 GGCAGGTGAAGCTGATTAAAGGG - Intronic
942493334 2:176511752-176511774 AGCACTTGCAGCTGAATAGATGG + Intergenic
943006099 2:182389783-182389805 TGCACTGACAGCTGATAAGATGG - Intronic
943151010 2:184113198-184113220 TGCACTGGCAGCTGATTAGATGG + Intergenic
943490430 2:188547592-188547614 TGCACCAGCAGCTGATTAAATGG + Intronic
943830902 2:192460518-192460540 TGCACTGGCAGCTGATTAGATGG + Intergenic
944745420 2:202650847-202650869 CGCACTGGCAGCTGATTAGATGG + Intronic
944965883 2:204932827-204932849 GTCAGTGACAGCTCATTAAAGGG + Intronic
945780541 2:214166352-214166374 GGCACTTACAGGAGAGTGAAGGG + Intronic
947067205 2:226241100-226241122 TGCACTGACAGCTGATTAGATGG - Intergenic
1169655365 20:7916963-7916985 GTCACTTACTGCTGTTTGAAAGG + Intronic
1170425531 20:16231669-16231691 CGCACTGGCAGCTGATTAGATGG + Intergenic
1171199280 20:23228048-23228070 CGCACTGGCAGCTGATTAGATGG - Intergenic
1172605501 20:36210848-36210870 GGCACTAATAGATGATTAACTGG + Intronic
1173462983 20:43258853-43258875 TGCACTGGCAGCTGATTAGATGG - Intergenic
1174159388 20:48540110-48540132 TGCACTGGCAGCTGATTAGATGG - Intergenic
1174893028 20:54418660-54418682 CGCACTGGCAGCTGATTAGATGG + Intergenic
1175029341 20:55936903-55936925 CGCACTGGCAGCTGATTAGACGG - Intergenic
1175037797 20:56016735-56016757 GGCATTTTCAGCTGATAAAATGG + Intergenic
1175431144 20:58904212-58904234 GGCACTTCCAGTGGAGTAAATGG - Intronic
1177597039 21:23257990-23258012 CACACTGACAGCTGATTAGATGG + Intergenic
1178159424 21:29894504-29894526 TGCACTGGCAGCTGATTAGATGG + Intronic
1179084014 21:38201311-38201333 TGCACTGGCAGCTGATTAGATGG - Intronic
1180279953 22:10684539-10684561 TTCACTGGCAGCTGATTAAATGG + Intergenic
1180587169 22:16903072-16903094 TTCACTGGCAGCTGATTAAATGG + Intergenic
1180592290 22:16950890-16950912 TGCACTGGCAGCTGATTAGATGG + Intergenic
1182661891 22:31930982-31931004 AGCACTGGCAGCTGATTAGATGG - Intergenic
1183645084 22:39120876-39120898 CTCACTGGCAGCTGATTAAATGG - Intronic
949306033 3:2642308-2642330 TGCACTGGCAGCTGATTAGATGG + Intronic
949839864 3:8307975-8307997 AACACTTACACATGATTAAATGG + Intergenic
950908365 3:16559908-16559930 TGCACTGGCAGCTGATTAGATGG - Intergenic
951839266 3:27016303-27016325 GGCATTGGCAGCTGATTAGATGG - Intergenic
954935459 3:54322653-54322675 TGCTGTTACAGCTGGTTAAAGGG + Intronic
956168872 3:66417120-66417142 GGCACTTACAGCTCCTTTATAGG + Exonic
956985862 3:74699628-74699650 GGCACTTAGTGCTTATCAAAGGG - Intergenic
957634522 3:82762934-82762956 TGCACTGGCAGCTGATTAGATGG - Intergenic
957951427 3:87132204-87132226 TGCACTGGCAGCTGATTAGATGG + Intergenic
958715282 3:97773301-97773323 CGCACTGGCAGCTGATTAGATGG + Intronic
959208603 3:103345772-103345794 CACACTAACAGCTGATTAGATGG + Intergenic
959298200 3:104565116-104565138 TGGACTGACAGCTGATTAGATGG + Intergenic
959425149 3:106178146-106178168 TGCACTGGCAGCTGATTAGATGG + Intergenic
960456949 3:117883899-117883921 GGCACTTACAAATCATTACAAGG - Intergenic
962611229 3:137078119-137078141 GGCCCTGGCAGCTGAATAAATGG - Intergenic
963445748 3:145405371-145405393 CGAACTTGCAGCAGATTAAATGG + Intergenic
965101176 3:164299981-164300003 AGCACTGACAGCTAATTAGATGG + Intergenic
966121505 3:176526526-176526548 GGCACATACTGCTCAATAAATGG - Intergenic
967612924 3:191529113-191529135 TGCACTGGCAGCTGATTAGATGG + Intergenic
969162166 4:5270400-5270422 AGCACTGTCAGCTGATTAGATGG + Intronic
970415709 4:15854850-15854872 TGCACTGATAGCTGATTAGATGG + Intergenic
971113978 4:23621195-23621217 GACACTCACACTTGATTAAATGG + Intergenic
971685130 4:29756101-29756123 AGGACTGGCAGCTGATTAAATGG - Intergenic
971778596 4:31000818-31000840 GGCTCTTACAGCTAGTAAAATGG + Intronic
971979005 4:33730529-33730551 GCCACTGGCAGCTGACTAAATGG + Intergenic
972116997 4:35648935-35648957 TGCACTGGCAGCTGATTAGATGG - Intergenic
972882666 4:43445660-43445682 TGCACTGGCAGCTGATTAGATGG + Intergenic
973103225 4:46297235-46297257 TGCACTGGCAGCTGATTAGATGG - Intronic
974469525 4:62301362-62301384 GGCACTTCAAGCTGAATAAAGGG + Intergenic
975099909 4:70501059-70501081 CCCACTGGCAGCTGATTAAATGG + Intergenic
975677789 4:76844290-76844312 CTCACTGACAGCTGATTAGATGG - Intergenic
975928876 4:79493318-79493340 TGCACTGGCAGCTGATTAGATGG - Intergenic
977621589 4:99144088-99144110 GTGACTTACAGTTGATCAAAAGG - Intronic
980322568 4:131297924-131297946 AGCACTGGCAGCTGATTAGATGG - Intergenic
980807811 4:137836287-137836309 TGCACTGGCAGCTGATTAGATGG - Intergenic
981247818 4:142560747-142560769 TGCACTGACAGCTGATTAGACGG + Intronic
981454436 4:144937372-144937394 GCCACTTCCAGGGGATTAAAGGG - Intergenic
982141145 4:152319672-152319694 GGCATTTAGAGCTCAGTAAATGG - Intergenic
982450159 4:155543469-155543491 AACACTTACAGCTGATCACATGG + Intergenic
982634648 4:157879054-157879076 GGCACATACAGCTTATTATTTGG + Intergenic
983151849 4:164293973-164293995 CGCACTGGCAGCTGATTAGATGG - Intronic
983863953 4:172740994-172741016 TGCACTTACATTTCATTAAAGGG - Intronic
983939263 4:173523894-173523916 GGCACTGACAGCAACTTAAAGGG - Intergenic
985144412 4:186879925-186879947 GGCACTTAAAACTCATCAAAAGG - Intergenic
987915288 5:24205046-24205068 TGCACTGGCAGCTGATTAGATGG - Intergenic
988185391 5:27854459-27854481 TGCTCTTGCAGCTGATTAGATGG - Intergenic
988655815 5:33210349-33210371 TGTACTGGCAGCTGATTAAATGG + Intergenic
989097332 5:37793448-37793470 TGCACTGGCAGCTGATTAGATGG - Intergenic
990921594 5:60974143-60974165 AGCACTGGCAGCTGATTAGATGG - Intronic
991218247 5:64181445-64181467 GGCAATTACAGTTTTTTAAATGG + Intronic
992641884 5:78774827-78774849 TGCACTGGCAGCTGATTAGATGG - Intergenic
992717872 5:79529503-79529525 GGCACTTTCAGCCGCTTATAGGG - Intergenic
993389495 5:87300978-87301000 GGTACTAACAGCTGAGTCAATGG - Intronic
993746459 5:91603574-91603596 TGCACTGGCAGCTGATTAGATGG + Intergenic
994051872 5:95371109-95371131 TGCACTGGCAGCTGATTAGATGG - Intergenic
994805132 5:104436784-104436806 GGCACTGGCAGCCGATTAGATGG - Intergenic
995902258 5:117083563-117083585 TGCATTTACAGGTGATGAAAAGG - Intergenic
995902430 5:117085801-117085823 TTCACTGACAGCTGATTAGATGG + Intergenic
996761946 5:126995026-126995048 TGCACTGGCAGCTGATTAGATGG + Intronic
996909171 5:128635722-128635744 CGCACTGGCAGCTGATTGAATGG + Intronic
1000628613 5:163566837-163566859 GGTGCTTTCAGCTGATTAACAGG + Intergenic
1000853879 5:166375295-166375317 TGCACTGGCAGCTGATTAGATGG - Intergenic
1003484837 6:6566702-6566724 GGCTATTAAAGTTGATTAAAAGG - Intergenic
1003694728 6:8392437-8392459 GACAGTAGCAGCTGATTAAATGG - Intergenic
1005911093 6:30310235-30310257 GGGACTAGCAGCTGATGAAAAGG - Intergenic
1008399837 6:51051932-51051954 TGTACTGGCAGCTGATTAAATGG - Intergenic
1009711674 6:67330206-67330228 TGCACTGGCAGCTGATTAGATGG - Intergenic
1009815655 6:68730652-68730674 TGCAGTTACAGCAGAATAAAAGG + Intronic
1010617656 6:78031986-78032008 TGCACTGGCAGCTGATTAGATGG + Intergenic
1010842024 6:80657733-80657755 TGCACTGGCAGCTGATTAGATGG + Intergenic
1012870531 6:104667991-104668013 TGCACTGGCAGCTGATTAGATGG - Intergenic
1014364907 6:120527436-120527458 TGAACTTACAGCTAGTTAAATGG - Intergenic
1015719501 6:136226750-136226772 GGTTCTCACAGCTGATTAAGTGG - Intergenic
1016439718 6:144070459-144070481 GGCACTGGCAGCTGATTAGATGG - Intergenic
1019947494 7:4341658-4341680 TGCACTGGCAGCTGATTAGATGG + Intergenic
1019954551 7:4402963-4402985 TGCACTGGCAGCTGATTAGATGG + Intergenic
1020623713 7:10551101-10551123 TGCACTGGCAGCTGATTAGATGG - Intergenic
1022047117 7:26630723-26630745 GGCATTTACTGCCGATTAGAAGG - Intergenic
1022196425 7:28071667-28071689 GGCACTTACAGCTGATTAAAGGG + Intronic
1022532199 7:31074029-31074051 GGCAGCTACAGCTGCCTAAAGGG - Intronic
1023180295 7:37475537-37475559 CGCACTAGCAGCTGATTAGATGG + Intergenic
1023565337 7:41518652-41518674 CACACTCACAGCTGATTAGATGG + Intergenic
1023998041 7:45174038-45174060 GGCACTCCCAGCTGAGGAAATGG + Intronic
1024744571 7:52391246-52391268 TGCACTGACAGTTGATTAGATGG - Intergenic
1024747264 7:52422434-52422456 TGCACTGGCAGCTGATTAGATGG + Intergenic
1024884794 7:54128230-54128252 TGCACTGGCAGCTGATTAGATGG + Intergenic
1026072204 7:67131959-67131981 TGCACTGGCAGCTGATTAGATGG + Intronic
1026181231 7:68042672-68042694 GCCACTCACAGCTGACTAGATGG - Intergenic
1026704696 7:72680307-72680329 TGCACTGGCAGCTGATTAGATGG - Intronic
1027777508 7:82484976-82484998 TGCACCTGCAGCTGATTAGATGG - Intergenic
1028204283 7:87998172-87998194 CACACTTGCAGCTGATTAGATGG + Intronic
1030360201 7:108587652-108587674 TGCACTGGCAGCTGATTAGATGG + Intergenic
1030696724 7:112593061-112593083 CGCACTGGCAGCTGATTAGATGG - Intergenic
1032211452 7:129918212-129918234 CGCACATACAGTTGATTAACAGG + Intronic
1032553725 7:132809984-132810006 GGGACTTTCAGGAGATTAAAAGG - Intronic
1034076922 7:148240932-148240954 TGCACTGGCAGCTGATTAGATGG + Intronic
1034921582 7:155087669-155087691 GCCACTGTCAGCTGATTAAATGG + Intergenic
1035656116 8:1307073-1307095 GACACTTTCAGCTGAATGAAAGG + Intergenic
1036916013 8:12804823-12804845 AGCACTTAAAACTGATTAATTGG - Intergenic
1038127171 8:24687597-24687619 TGCACTGGCAGCTGATTACATGG - Intergenic
1039624456 8:39033619-39033641 GGCATTTAGATTTGATTAAATGG - Intronic
1040611057 8:48982693-48982715 GGCACCTGCAGCTGATTCAAAGG + Intergenic
1041210782 8:55549006-55549028 TGCACTGGCAGCTGATTAGATGG - Intergenic
1041319882 8:56602158-56602180 GGTGCTTACAGCTGATTGATGGG + Intergenic
1043886294 8:85604457-85604479 TGCACTGGCAGCTGATTAGATGG + Intergenic
1043948149 8:86277493-86277515 TGCACTGGCAGCTGATTAGATGG - Intronic
1044201957 8:89448943-89448965 TGCACTGGCAGCTGATTAGATGG - Intergenic
1046417291 8:113934663-113934685 CACACTGGCAGCTGATTAAATGG + Intergenic
1047015507 8:120719224-120719246 GACACTGGCAGCTGATTAGATGG - Intronic
1047196435 8:122726118-122726140 TGCACTGGCAGCTGATTAGATGG - Intergenic
1047325402 8:123830984-123831006 TGCACTGGCAGCTGATTAGATGG - Intergenic
1047580260 8:126206261-126206283 TGCACTGACAGTTGATTAGATGG - Intergenic
1048217320 8:132508251-132508273 CGCACTGGCAGCTGATTAGATGG + Intergenic
1048746953 8:137625018-137625040 TGCACTGACAGCTGATCAGATGG + Intergenic
1048776003 8:137947197-137947219 GGCACTGACACCTCATTAACAGG + Intergenic
1048916454 8:139188739-139188761 TGCACTGGCAGCTGATTAGATGG + Intergenic
1051011230 9:12416786-12416808 CGCACTGGCAGCTGATTAGATGG + Intergenic
1053696091 9:40640670-40640692 TTCACTGGCAGCTGATTAAATGG + Intergenic
1054307338 9:63439888-63439910 TTCACTGGCAGCTGATTAAATGG + Intergenic
1054406069 9:64763898-64763920 TTCACTGGCAGCTGATTAAATGG + Intergenic
1054439695 9:65249371-65249393 TTCACTGGCAGCTGATTAAATGG + Intergenic
1054490712 9:65772568-65772590 TTCACTGGCAGCTGATTAAATGG - Intergenic
1057742366 9:97723002-97723024 TTCACTTGCAGCAGATTAAATGG + Intergenic
1058543857 9:106040254-106040276 TGCACTGGCAGCTGATTAGATGG + Intergenic
1059033575 9:110728788-110728810 GGCACTTAGAGCTGTTTATAAGG - Intronic
1059882802 9:118710313-118710335 GCCAGTTAGAGCTTATTAAAAGG - Intergenic
1060704454 9:125785333-125785355 TGCACTGGCAGCTGATTGAATGG - Intronic
1202778538 9_KI270717v1_random:14329-14351 TTCACTGGCAGCTGATTAAATGG + Intergenic
1190959408 X:55230593-55230615 TGCACTGGCAGCTGATTAGATGG + Intronic
1191178520 X:57534043-57534065 GACACTGACAGCTGATTGGATGG - Intergenic
1191226749 X:58052141-58052163 TGCACTGACAGCTGATTAGATGG - Intergenic
1192324558 X:70121809-70121831 TGCACTGGCAGCTGATTAGATGG + Intergenic
1193461739 X:81798255-81798277 TGCACTGGCAGCTGATTAGATGG - Intergenic
1193905050 X:87232050-87232072 TGCACTAGCAGCTGATTAGATGG + Intergenic
1194143103 X:90229802-90229824 TGCACTGGCAGCTGATTAGATGG - Intergenic
1194278945 X:91923359-91923381 TGCACTGGCAGCTGATTAGATGG - Intronic
1194358388 X:92917519-92917541 GGCATTTTCAGATGTTTAAAAGG + Intergenic
1194591056 X:95800283-95800305 TGCACTGGCAGCTGATTAGATGG - Intergenic
1194911430 X:99649731-99649753 TGCACTGGCAGCTGATTAGATGG + Intergenic
1194933478 X:99917967-99917989 TGCCCTTGCAGCTGATTGAATGG - Intergenic
1195003468 X:100664809-100664831 GGCACTTACACCTGCACAAATGG + Exonic
1195540448 X:106056936-106056958 TGCACTGGCAGCTGATTAGATGG + Intergenic
1196275370 X:113760549-113760571 TGCACTGGCAGCTGATTAGATGG - Intergenic
1196534063 X:116820206-116820228 TTCACTTGCAGCTGATTAGATGG - Intergenic
1197481688 X:126994679-126994701 TGCGCTGGCAGCTGATTAAATGG - Intergenic
1197845642 X:130799137-130799159 TGCACTAGCAGCTGATTAGATGG - Intronic
1198132769 X:133715100-133715122 CACACTGACAGCTGATTAAATGG - Intronic
1200488856 Y:3799123-3799145 TGCACTGGCAGCTGATTAGATGG - Intergenic
1200596423 Y:5146860-5146882 TGCACTGGCAGCTGATTAGATGG - Intronic
1201594764 Y:15655941-15655963 GGCAGTTATAGCATATTAAAAGG + Intergenic
1202100016 Y:21297766-21297788 TGCACTGGCAGCTGATTAGATGG - Intergenic