ID: 1022196426

View in Genome Browser
Species Human (GRCh38)
Location 7:28071672-28071694
Sequence TTACAGCTGATTAAAGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196418_1022196426 21 Left 1022196418 7:28071628-28071650 CCACATACAGACCCAAGGACGGA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196415_1022196426 25 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196419_1022196426 10 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196416_1022196426 22 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196422_1022196426 -2 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196420_1022196426 9 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1022196423_1022196426 -10 Left 1022196423 7:28071659-28071681 CCAGTGACGGCACTTACAGCTGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196426 Original CRISPR TTACAGCTGATTAAAGGGTT TGG Intronic
900945383 1:5828362-5828384 CTACAGCTGCTTAAAGAGCTGGG - Intergenic
908419666 1:63947529-63947551 TTACAGGTTATTAAAGGGCATGG - Intronic
908739512 1:67312483-67312505 GTACAGATGATTGAGGGGTTGGG + Intronic
913356072 1:117923514-117923536 TAAGAACTGATTAATGGGTTTGG + Intronic
916945779 1:169725773-169725795 TTCCATCTGATTCAAGGCTTTGG + Exonic
917857542 1:179113366-179113388 ATACAGTTGATTATATGGTTAGG - Intronic
920122932 1:203672355-203672377 TTAAAGCTGATTTAGGGGGTTGG + Intronic
921756537 1:218863095-218863117 TTACACCTGGTTAAAGGGATTGG - Intergenic
922647117 1:227299514-227299536 TTACAGCTTAAAATAGGGTTAGG - Intronic
922769084 1:228172373-228172395 TTACAGCTGAGAACAGGTTTTGG - Intronic
924604683 1:245522611-245522633 TGACAGCTGATTTAAGGCTGTGG + Intronic
1065909121 10:30286126-30286148 TAACAGCTCAGTAAAAGGTTAGG - Intergenic
1075538369 10:123290880-123290902 TTAGAGCTAATAAAAGAGTTTGG + Intergenic
1076548031 10:131258946-131258968 TTACAGCTGTGTCAAGAGTTTGG - Intronic
1076935747 10:133566813-133566835 TTACAGTTGGGTTAAGGGTTAGG + Intronic
1079343554 11:19632883-19632905 TAACATCTTCTTAAAGGGTTTGG - Intronic
1081289880 11:41311393-41311415 TAAGAGCAGATTAAAGAGTTGGG + Intronic
1084132749 11:67149558-67149580 TTACATCTGGTGAAGGGGTTAGG - Intronic
1085278906 11:75317490-75317512 TTGCAGCTCACTAAAGGCTTTGG - Intronic
1085703908 11:78769061-78769083 CAACAGCTGTTTAAAGGCTTTGG + Intronic
1087973049 11:104509375-104509397 TTCCAACTGATTAAAGTTTTTGG - Intergenic
1088532520 11:110826419-110826441 TTACAGGTGATTATATGGGTTGG - Intergenic
1091000117 11:131903819-131903841 TGACAGCTCAGTAAAGGGCTGGG - Intronic
1092297919 12:7216407-7216429 TTACAGCTTATGCAAGAGTTTGG - Intronic
1097214473 12:57399469-57399491 ATACAGCTGATTAGAAGGCTAGG - Intronic
1097788656 12:63789731-63789753 AAACAGCTTATTAAAGTGTTAGG + Intronic
1100517073 12:95338671-95338693 ATACAGCTGGTTAAAGGGGAAGG + Intergenic
1100786482 12:98084016-98084038 TTACAAATAATTAAAAGGTTGGG - Intergenic
1101847178 12:108372010-108372032 ACAGAGCTGATTAAAGGGGTGGG - Intergenic
1102199736 12:111049037-111049059 GTACAGCTGGATAAAGTGTTAGG - Intronic
1106465109 13:30006515-30006537 TTAAAGTTGATTGCAGGGTTTGG + Intergenic
1107481225 13:40787882-40787904 TTACAGCAGCTTAAAGGGGTTGG - Intergenic
1108809500 13:54203920-54203942 TTAAAGGTGAGTAAAGGGATTGG - Intergenic
1108825128 13:54404026-54404048 TTACAGCTGACTACAGTATTCGG - Intergenic
1113897118 13:113771763-113771785 TTACAGCTGTTTACAGACTTTGG + Intronic
1113978463 13:114250658-114250680 GCACAGCTGATGAAAGGGTACGG + Exonic
1116619390 14:47179544-47179566 TTACACATAATTAAAGGTTTGGG + Intronic
1117025551 14:51616408-51616430 TTAGACTAGATTAAAGGGTTTGG + Intronic
1118779984 14:69001470-69001492 TTACAGGAGATTCAAAGGTTGGG - Intergenic
1121724285 14:96135229-96135251 TCACATCTGATTAATGGGTTTGG + Intergenic
1126882299 15:53112284-53112306 TTATAGCTAATCAAAGGGATAGG - Intergenic
1128173540 15:65533249-65533271 TTAGAACTGATTATAGGATTTGG + Intronic
1138727514 16:59156383-59156405 TTACCCTTGATCAAAGGGTTAGG - Intergenic
1139919446 16:70450235-70450257 TTACAGCTCATAAAAGGAGTGGG + Intergenic
1141051609 16:80770234-80770256 TTACTGCAGATTAAAAGATTAGG + Intronic
1141300450 16:82810707-82810729 CCACAGCTGACTGAAGGGTTGGG - Intronic
1143253112 17:5537215-5537237 TTAGAGCTGTTTAAAGGAGTTGG + Intronic
1143652208 17:8270226-8270248 TTCCAGCATACTAAAGGGTTAGG - Exonic
1146099542 17:29966936-29966958 ATACAGCTGATTATAGGATTGGG - Intronic
1149993264 17:61394394-61394416 TTCCAGCTGATTACAGGCTATGG - Intergenic
1150998517 17:70347067-70347089 TTACAGATAATGAAAGGGTATGG - Intergenic
1151025722 17:70674118-70674140 TTAAAGCTTACTAACGGGTTGGG + Intergenic
1151427289 17:74039228-74039250 TCACAGCTGATCAGAGGGCTGGG - Intergenic
1153484655 18:5584497-5584519 TTACAGTTGAGGAAAAGGTTGGG - Intronic
1156507182 18:37605250-37605272 TTATAGCTGAAGAAAGGGTTTGG - Intergenic
1157266819 18:46231542-46231564 TTAAAAATGATTAAAGGTTTGGG + Intronic
1157958612 18:52126825-52126847 TAACAGCTCAGTAAAGGGTCAGG - Intergenic
1158305206 18:56097680-56097702 TTACTGCTGCTTAAGGAGTTAGG + Intergenic
1162086746 19:8253999-8254021 TTCCATCTGATCAGAGGGTTTGG - Intronic
925043015 2:748206-748228 TTGCAGGTGATTGAAGGGTTTGG - Intergenic
925424315 2:3736076-3736098 TAACAGCTGATTGAAGTCTTTGG + Intronic
925495873 2:4448471-4448493 TAATAGCTGTTTAAAGGCTTGGG + Intergenic
925606513 2:5666135-5666157 TTTGAGCTGTTTAAAGGGATAGG - Intergenic
926252350 2:11162336-11162358 TCCCAGCTGGTTAAAGGTTTTGG + Intronic
929389893 2:41457976-41457998 TTAGAGTTTATTAGAGGGTTAGG - Intergenic
930891232 2:56390117-56390139 TTATAGCTTATTAAAGTTTTGGG + Intergenic
931816791 2:65911714-65911736 ATACAGCTGATGAAATAGTTGGG - Intergenic
932380634 2:71278452-71278474 TTACATATGCTTAAAGGATTTGG + Intronic
935497591 2:103801057-103801079 TTAGAGTTGATTAAAAGTTTTGG + Intergenic
937486604 2:122321933-122321955 CCTCAGCTGATTATAGGGTTTGG + Intergenic
939393124 2:141593875-141593897 TGACAGCTGATGACAGGCTTTGG - Intronic
939429531 2:142085007-142085029 TTACAACAGATTAAAGAGCTTGG - Intronic
941073678 2:160983684-160983706 TTTCAGGTGATTAAATGTTTTGG + Intergenic
941185111 2:162312838-162312860 TTAAAGCTGATTAAAGGATGGGG - Intronic
941254680 2:163213968-163213990 TTTCATCTTATTAAATGGTTGGG + Intergenic
942544879 2:177053287-177053309 CTACAGCTAATCAAAGGGCTTGG + Intergenic
942831092 2:180238087-180238109 TTACAGCAGATTAAATACTTAGG + Intergenic
947991850 2:234495065-234495087 TTAAAGGTGTTTAAAGGGTAAGG - Exonic
948222614 2:236284842-236284864 TTAGAGCTTATAAAAGTGTTTGG + Intergenic
1169538380 20:6572160-6572182 TTACAGATGTTGAAAGGGCTAGG - Intergenic
1169970776 20:11267495-11267517 TCACAGCTGACTGAAGGGTGGGG - Intergenic
1171097474 20:22345378-22345400 TTACAGTTTAATAAAGGATTGGG + Intergenic
1176817741 21:13621826-13621848 TTAGAGCTGAATAATGTGTTCGG + Intronic
1177083293 21:16669318-16669340 ATACAGCTGTTTCTAGGGTTGGG + Intergenic
1177813295 21:25948036-25948058 TTACAGCTGACTTAAGTATTTGG - Intronic
1181520155 22:23443193-23443215 TTACAACTGGCTAAAGGTTTGGG - Intergenic
952519245 3:34138699-34138721 TTAGAGCAGATTAATGAGTTGGG - Intergenic
955186563 3:56719892-56719914 TTACAGCTCATAAAAGCGTGTGG - Intergenic
957191173 3:77011535-77011557 TTACAAGTGATTATAGGGTAAGG + Intronic
957514901 3:81237008-81237030 TTACAGCTGATGAAAAGGCCTGG + Intergenic
959604560 3:108227878-108227900 TTACAGCTATTTAAGGGGGTGGG + Intergenic
959813543 3:110648018-110648040 TTGTAGCTGATTAAAAGGTGAGG - Intergenic
960625635 3:119679161-119679183 TTACAGCAAAATAAAGGCTTGGG + Intergenic
962110464 3:132440570-132440592 TTACAGCTGCTTACAGTATTAGG + Intronic
963447682 3:145435923-145435945 TTAATGCTGATTAAAGAGTTAGG + Intergenic
966070285 3:175868994-175869016 TTAAAGCAGATTAAAGGAATTGG + Intergenic
974135133 4:57806623-57806645 TTACAGATGATTAAATGCTCAGG + Intergenic
976911433 4:90312011-90312033 TTAAAGCAGAATAAAGGCTTAGG + Intronic
983863951 4:172740989-172741011 TTACATTTCATTAAAGGGGTAGG - Intronic
987498746 5:18678465-18678487 TAACAGCTGATTACATGGTAGGG - Intergenic
988361797 5:30245750-30245772 TTACACCTTTTTCAAGGGTTTGG - Intergenic
988498854 5:31767325-31767347 TAAAAGCTGTTTAAGGGGTTGGG - Intronic
990099925 5:52169625-52169647 TTACAGCTAATTAATAGGTCAGG - Intergenic
993639819 5:90388990-90389012 TAACAGCAGGTTAAAGGTTTGGG - Intergenic
994025749 5:95080696-95080718 TTAAAGCTAATTCAAAGGTTGGG - Intronic
994252270 5:97550187-97550209 CTACAGCTGAGTGAAAGGTTGGG + Intergenic
999905522 5:156137162-156137184 TTACAGCTGATCAGTGGGATGGG + Intronic
1001394844 5:171410332-171410354 TTATGACTGATTAAAGTGTTTGG + Intronic
1003621348 6:7704005-7704027 ATACAGCTGGGTGAAGGGTTGGG + Intergenic
1004630904 6:17420189-17420211 TTAAAGCTGATTAGAGGACTGGG - Intronic
1009626105 6:66140366-66140388 TTATAGCTGAGTAAAGGACTGGG - Intergenic
1009890183 6:69671573-69671595 CTACAGCTGATTAAAGCTATGGG - Intergenic
1010051039 6:71504801-71504823 TTACCGCTTCTTAAAGGCTTGGG + Intergenic
1010854432 6:80820582-80820604 TAATAACTGATTATAGGGTTTGG + Intergenic
1011232623 6:85179763-85179785 TTACAGCTGGTAAAAGAATTGGG - Intergenic
1012449868 6:99343772-99343794 TTACAGGTGAAAGAAGGGTTAGG - Intronic
1013421888 6:109974617-109974639 CTACAGCAGAATAAAGGGTTGGG + Intergenic
1018156494 6:160990592-160990614 TAACAGCTTAGTAAAGGGTGAGG - Intergenic
1018968133 6:168504580-168504602 ATACAGATGAATACAGGGTTGGG + Intronic
1022196426 7:28071672-28071694 TTACAGCTGATTAAAGGGTTTGG + Intronic
1023204697 7:37735372-37735394 TTTCAGCTGTTTTAAGGCTTAGG - Intronic
1023673706 7:42607009-42607031 TTACAGCTCATTTAATGGGTAGG + Intergenic
1025309839 7:57919208-57919230 TTTGAGCTGTTTGAAGGGTTTGG + Intergenic
1026435732 7:70395781-70395803 GTACAGCTAGTTAAAGAGTTGGG - Intronic
1027457144 7:78406740-78406762 TTACAGCTGTGTAAAGTGTTTGG - Intronic
1031380892 7:121084854-121084876 TAACATCTGTTTAAATGGTTAGG - Intronic
1034144476 7:148856595-148856617 AAACAGCTGATTCTAGGGTTGGG + Intronic
1036963763 8:13273836-13273858 TTTCACCTAATCAAAGGGTTTGG - Intronic
1037266583 8:17069077-17069099 TTACAGCTGAATAAAATGTCAGG - Intronic
1037506530 8:19535672-19535694 TTACATCAGATTAAATGGATGGG - Intronic
1039887458 8:41663343-41663365 TAACAGCTGTTTTCAGGGTTAGG + Intronic
1041319885 8:56602163-56602185 TTACAGCTGATTGATGGGGGTGG + Intergenic
1041481774 8:58330013-58330035 TTACAGACGATGAAATGGTTAGG - Intergenic
1042238729 8:66640939-66640961 TAACAGCTCATTGAAGGGTCAGG - Intronic
1045324497 8:101108268-101108290 TGAAAGGTGATTGAAGGGTTGGG - Intergenic
1050314212 9:4384678-4384700 TTACTGCTTATTCAAGGGCTAGG + Intergenic
1052662823 9:31457919-31457941 TTACATATGATTATATGGTTTGG + Intergenic
1058017416 9:100050410-100050432 TTAAAGTTGTTTAAATGGTTAGG + Intronic
1060110353 9:120902347-120902369 TTACAGGTGATTCAAGGGTGGGG - Intergenic
1203529619 Un_GL000213v1:127675-127697 TTAGAGCTGAATAATGTGTTCGG - Intergenic
1187197811 X:17104873-17104895 TTACAGCCAATGAAAGGCTTAGG - Intronic
1189362784 X:40366230-40366252 TGACAGCTGATGGAAGAGTTTGG + Intergenic
1190338291 X:49276457-49276479 TCACAACTCAATAAAGGGTTAGG - Intronic
1192234363 X:69286318-69286340 TTACTGATGCTTGAAGGGTTTGG - Intergenic
1196260782 X:113578385-113578407 TTAGAGCTGTTTACAGGGTATGG - Intergenic
1196385814 X:115148665-115148687 TTACAGATGTATAAAGGGTTAGG + Intronic
1197976431 X:132170700-132170722 TTACATCTGAGTAAAGACTTTGG + Intergenic
1200327932 X:155262116-155262138 TTAAAGCTTATTACAGGGTATGG + Intronic
1201957896 Y:19646327-19646349 TTAAAGCAGATTAAAGCATTTGG + Intergenic