ID: 1022196427

View in Genome Browser
Species Human (GRCh38)
Location 7:28071675-28071697
Sequence CAGCTGATTAAAGGGTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022196419_1022196427 13 Left 1022196419 7:28071639-28071661 CCCAAGGACGGACCTTCTATCCA 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196422_1022196427 1 Left 1022196422 7:28071651-28071673 CCTTCTATCCAGTGACGGCACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196420_1022196427 12 Left 1022196420 7:28071640-28071662 CCAAGGACGGACCTTCTATCCAG 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196423_1022196427 -7 Left 1022196423 7:28071659-28071681 CCAGTGACGGCACTTACAGCTGA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196415_1022196427 28 Left 1022196415 7:28071624-28071646 CCACCCACATACAGACCCAAGGA 0: 1
1: 0
2: 1
3: 20
4: 241
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196416_1022196427 25 Left 1022196416 7:28071627-28071649 CCCACATACAGACCCAAGGACGG 0: 1
1: 0
2: 0
3: 0
4: 80
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153
1022196418_1022196427 24 Left 1022196418 7:28071628-28071650 CCACATACAGACCCAAGGACGGA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022196427 Original CRISPR CAGCTGATTAAAGGGTTTGG AGG Intronic
900338303 1:2175575-2175597 CACCAGATTATAGGGGTTGGAGG - Intronic
901940941 1:12661128-12661150 CAGGTAATTCCAGGGTTTGGAGG - Intronic
903274716 1:22213075-22213097 CAGCAGATGAGAGGGGTTGGAGG + Intergenic
904007737 1:27372701-27372723 CAGCAGAGTAAAAGGTTTGCAGG - Intronic
904979675 1:34487791-34487813 CAGCATATTCAAGGGCTTGGTGG - Intergenic
907092888 1:51745239-51745261 GAGCCAATTACAGGGTTTGGGGG + Intronic
910390666 1:86739842-86739864 CAGCTCATTAAAGAGTTTCCTGG + Intronic
911018144 1:93357316-93357338 CAAAAGATGAAAGGGTTTGGGGG - Intronic
913109664 1:115646645-115646667 CTGCTGAATGAAGGGTTTTGTGG - Intronic
916406858 1:164506554-164506576 AAGCTGTTTAAAGGGCTTTGGGG + Intergenic
916946968 1:169738722-169738744 TGCCTGATTAAAGGGTGTGGAGG - Intronic
920646581 1:207808147-207808169 CAGCAGATTAAATTCTTTGGAGG + Intergenic
921714586 1:218404797-218404819 CATCTGATTAAAGTGTATGCAGG + Intronic
922667226 1:227481062-227481084 CAGTTGAGTAAAGGTTATGGAGG - Intergenic
923265409 1:232308945-232308967 CAGCTGCTTAAACGTCTTGGTGG + Intergenic
923932741 1:238721355-238721377 CAGAGGATGAAAGAGTTTGGAGG + Intergenic
924419953 1:243898481-243898503 CAGTTGATTAACGGGCCTGGAGG + Intergenic
1063241220 10:4171123-4171145 CAGCTGGTCAAAGGGTTATGTGG + Intergenic
1063254869 10:4316329-4316351 CAGCTGATGAAAGTGTGTCGTGG + Intergenic
1064034901 10:11907326-11907348 AAGCTGGTTGAAGGGTTTGTGGG + Intergenic
1065696033 10:28380511-28380533 CAGCAGATTAAAGGTTATAGCGG - Intergenic
1067773164 10:49142008-49142030 CAGCTTGTTAGAGGGCTTGGTGG + Intergenic
1067879318 10:50029888-50029910 CAGCTGATGAAGGGGTCTGTGGG + Intergenic
1067892577 10:50149544-50149566 CAGCTGATGAAGGGGTCTGTGGG - Intergenic
1068466459 10:57399294-57399316 CAGAGGATGAAAGGGGTTGGAGG + Intergenic
1074092179 10:110271277-110271299 CATCTGATTATACTGTTTGGAGG + Intronic
1074750015 10:116576608-116576630 CAGCTGACAAAAGGAATTGGGGG - Intergenic
1076739531 10:132476502-132476524 CAGCTGAAGATGGGGTTTGGAGG - Intergenic
1076739546 10:132476562-132476584 CAGCTGGAGACAGGGTTTGGAGG - Intergenic
1083619002 11:64039766-64039788 CAGATGATGTCAGGGTTTGGGGG + Intronic
1084851921 11:71948705-71948727 CAGCTGATTTATGACTTTGGTGG + Intronic
1084940242 11:72608603-72608625 GAGCTGGTCAAAGGATTTGGGGG + Intronic
1089678707 11:120107686-120107708 GAGGTGATTTGAGGGTTTGGTGG + Intergenic
1093993538 12:25616657-25616679 AAACTGAGTAAAGGGTATGGGGG + Intronic
1094159822 12:27378767-27378789 CAGCAGTTTAAAAGGTTTTGGGG + Intronic
1096267411 12:50134797-50134819 CAGCTGATAAAAGGGCTGGTAGG - Intronic
1097031453 12:56093074-56093096 CAAGTGAGTAAAGGGTATGGAGG + Exonic
1101318181 12:103649047-103649069 GAGCTGAGGACAGGGTTTGGGGG + Intronic
1101847177 12:108372007-108372029 GAGCTGATTAAAGGGGTGGGTGG - Intergenic
1102199735 12:111049034-111049056 CAGCTGGATAAAGTGTTAGGTGG - Intronic
1102216531 12:111165400-111165422 CAGAAGATGCAAGGGTTTGGTGG + Intronic
1102462441 12:113108253-113108275 CAGCTGAGAAGTGGGTTTGGGGG - Intronic
1104726228 12:131077229-131077251 CAGCTGAGGAAGGGGGTTGGGGG + Intronic
1106465110 13:30006518-30006540 AAGTTGATTGCAGGGTTTGGTGG + Intergenic
1107308465 13:39049074-39049096 TAGCTTATTATAGGTTTTGGAGG + Exonic
1108219708 13:48220854-48220876 CAGCTGACTATAGGCTTTAGCGG + Intergenic
1110027517 13:70560034-70560056 AAGCTGACAAAAGGATTTGGCGG - Intergenic
1111249702 13:85587304-85587326 CAGCAGGTAAAAGTGTTTGGTGG + Intergenic
1111539427 13:89651294-89651316 CAGAAGATGAAATGGTTTGGAGG - Intergenic
1115857851 14:37650288-37650310 CAGCTGAATGCAGGGTTTGGGGG - Intronic
1116936013 14:50740979-50741001 GAGCTGATTAAAGTGTTAGCTGG - Intronic
1124876931 15:33603477-33603499 CAACTAATTAAACGGTTAGGTGG + Intronic
1127866972 15:63041442-63041464 CAGCTGATCTCAGGGCTTGGGGG + Intergenic
1129109683 15:73330147-73330169 CAGCTGTTTAGGGGGTTGGGGGG - Intronic
1131508914 15:93038236-93038258 CTCCTGGTTAGAGGGTTTGGGGG + Intronic
1134863911 16:17587320-17587342 CCGCTGATTCAAGAGTTTGACGG + Intergenic
1135208572 16:20503888-20503910 CTGCTGCTGAGAGGGTTTGGAGG - Intergenic
1135329055 16:21546041-21546063 CAGCTGAGAAAAGGCTTTGAGGG - Intergenic
1135488602 16:22887580-22887602 CAGCTGTGTAAATAGTTTGGAGG - Intronic
1135572667 16:23561184-23561206 CAGCTTATTAAGGGGTCTGGGGG + Intronic
1136339401 16:29632018-29632040 CAGCTGAGAAAAGGCTTTGAGGG - Intergenic
1137680467 16:50339012-50339034 CAGTTGATAAAAGGCTTTGAAGG - Intronic
1137940309 16:52677364-52677386 CAGCTGCTTAAATGCTTTGGTGG - Intergenic
1141019359 16:80480349-80480371 CAGCTCATTAAAGGGGTAGATGG - Intergenic
1141145230 16:81524652-81524674 CAGCTCATTAGTGGGTTTGGCGG + Intronic
1141760115 16:86022729-86022751 CAGCTGATGGATGGGTCTGGGGG - Intergenic
1142042067 16:87900605-87900627 CAGCTGAGAAAAGGCTTTGAGGG - Intronic
1143278547 17:5732587-5732609 CAGATGATTCATGGGTGTGGGGG + Intergenic
1145282903 17:21480713-21480735 CAGCTGTCTAAGGGGTTTGGGGG - Intergenic
1145394574 17:22485077-22485099 CAGCTGTCTAAGGGGTTTGGGGG + Intergenic
1148203414 17:45764902-45764924 CAGCTGATAAATGTGTTTTGAGG - Intergenic
1150009785 17:61493041-61493063 CAACTGTTTAAAGTGTCTGGGGG + Intergenic
1150189795 17:63226309-63226331 CACATGATTAAAGGCTTTTGAGG - Intronic
1157422262 18:47557020-47557042 CAGCTGATTGCAGGGATTGGGGG - Intergenic
1161487187 19:4542800-4542822 CAGCTGTCTAAAGGGCTTGGGGG - Exonic
1162086744 19:8253996-8254018 CATCTGATCAGAGGGTTTGGAGG - Intronic
1167947984 19:53004614-53004636 CAGCTGATGTCAGAGTTTGGTGG + Intergenic
933111611 2:78408360-78408382 CAGCTGCTTAGTGGGCTTGGGGG + Intergenic
933307797 2:80623625-80623647 CAGCTAAGCAAGGGGTTTGGGGG + Intronic
935844125 2:107146071-107146093 CAGATTATTAAAGGTCTTGGAGG - Intergenic
936814159 2:116439435-116439457 TACCTTATAAAAGGGTTTGGAGG - Intergenic
937851294 2:126638630-126638652 CACCTGGTGGAAGGGTTTGGAGG + Intergenic
939114188 2:138041629-138041651 CATCAGGTTAAAGGGTATGGAGG + Intergenic
939393123 2:141593872-141593894 CAGCTGATGACAGGCTTTGGAGG - Intronic
939804295 2:146753517-146753539 CAGATGATTAAAGGGCTTCAAGG + Intergenic
941692407 2:168514611-168514633 CATCTGATTTAGTGGTTTGGAGG - Intronic
947009155 2:225546879-225546901 CTGCTGATTAAAGAGCTTGCAGG - Intronic
947234351 2:227924319-227924341 CTGTTGAATAAAGTGTTTGGAGG + Exonic
1173014690 20:39214578-39214600 CAGGTCATTAGAGGGTCTGGTGG - Intergenic
1179249184 21:39658532-39658554 CAGCTGATTAGGGGGGTTGGGGG - Intronic
1180696667 22:17755500-17755522 CAGAAAAATAAAGGGTTTGGAGG + Intronic
1181118619 22:20650292-20650314 CAGCTGATAAAGGGGTCTGTGGG - Intergenic
1181732804 22:24859797-24859819 CAGCTGATGAACGGGTCTGTGGG + Exonic
1182022115 22:27090122-27090144 CAGATGAACAAATGGTTTGGTGG + Intergenic
1183018590 22:35009432-35009454 AAGCTGATAAAATGGTTTAGAGG - Intergenic
1183055012 22:35299889-35299911 CAGCTGATTCCCGGGGTTGGTGG + Exonic
1185314101 22:50171345-50171367 GAGCTGATTACAGGGGCTGGTGG + Intronic
949558552 3:5181671-5181693 CAGCTGCTCCAAGGGTCTGGTGG + Intergenic
952904604 3:38131480-38131502 CAGCTGCCTAAAGGGGATGGGGG + Intronic
954946137 3:54425831-54425853 CAGCAGACTAAAGCTTTTGGAGG + Intronic
955371568 3:58356288-58356310 CAGCAGATGGCAGGGTTTGGTGG + Intronic
956768678 3:72506161-72506183 TAGATGATTAAAAGGTTGGGAGG + Intergenic
957495024 3:80981580-80981602 CAGCAGTTTAAACAGTTTGGAGG + Intergenic
958433191 3:94066207-94066229 CAGCTAATTAAATGGATTTGAGG - Intronic
959497605 3:107069430-107069452 CAACTGAGACAAGGGTTTGGGGG + Intergenic
959672529 3:108995504-108995526 CAGCTCATGGAAGGGGTTGGTGG + Intronic
962437424 3:135379993-135380015 CAGCTGATGAAAGTGTTTTTGGG + Intergenic
962651241 3:137494852-137494874 CAGCAGATTAAAGGGTCTTGAGG - Intergenic
972527246 4:39926819-39926841 CAGACAATTAAAAGGTTTGGAGG - Exonic
975803726 4:78090597-78090619 CAGATGAGTTAATGGTTTGGGGG - Intronic
982466362 4:155738074-155738096 GAGCTGATTAATGGGATTGGAGG + Intergenic
983563369 4:169123946-169123968 CTCCTGGTTAAAGGTTTTGGAGG - Intronic
984114616 4:175664165-175664187 CAGCTGTCTATAGGGGTTGGGGG + Intronic
988340364 5:29962366-29962388 CACCTGACTGAAGGGATTGGGGG - Intergenic
988942061 5:36156660-36156682 CACCTGTTTAAAGGGTGGGGTGG - Intronic
989730065 5:44638441-44638463 CAGCTGATAGAAGGGCTTGCCGG - Intergenic
989829809 5:45901694-45901716 CAGATGACTGAATGGTTTGGAGG + Intergenic
990733426 5:58834115-58834137 TGGCTGATTTAATGGTTTGGTGG + Intronic
991452537 5:66768282-66768304 CAGCTGAAGAAGGTGTTTGGAGG + Intronic
991506904 5:67334631-67334653 TACCTGATTACAGGGGTTGGGGG + Intergenic
992165621 5:74047995-74048017 AAGCTGATTTTAGGGTTTGTAGG - Intergenic
993860866 5:93135581-93135603 CAGCTGAATAAATGGTATGATGG - Intergenic
993875295 5:93299689-93299711 TAGCTGCTTAAAGGTTTGGGGGG - Intergenic
994252271 5:97550190-97550212 CAGCTGAGTGAAAGGTTGGGTGG + Intergenic
995551108 5:113282330-113282352 CAGGGAATTAAAGGGTTTGAAGG + Intronic
996133408 5:119809518-119809540 CAGCACATTATAGGGTATGGTGG - Intergenic
999181382 5:149671936-149671958 CTGTTGATTGAAGGGTGTGGAGG + Intergenic
1002865053 6:1114560-1114582 CAGCTGTTCATAGGGTTGGGAGG - Intergenic
1003781706 6:9435492-9435514 CAGCTGATTAAAGGCTGCTGAGG - Intergenic
1004402820 6:15304598-15304620 GAGATGATTAAAGGGTTAGAGGG - Intronic
1005899394 6:30204828-30204850 CATCTGAGTAAAGGGAGTGGGGG - Intronic
1006601564 6:35230074-35230096 CAGCAGATATCAGGGTTTGGAGG - Intronic
1009530368 6:64804448-64804470 CAGATGGTTAATGAGTTTGGTGG - Intronic
1012491761 6:99789849-99789871 CAGCTGTTGAAAGGCTGTGGTGG + Intergenic
1013952141 6:115795917-115795939 CAGCTGATTGCAGATTTTGGGGG + Intergenic
1016097709 6:140058693-140058715 CATCTCATAAAAGGATTTGGAGG - Intergenic
1018916812 6:168137912-168137934 CAGCTGCATGAAGGGTTAGGAGG - Intergenic
1021298475 7:18939762-18939784 TCACTGAATAAAGGGTTTGGAGG - Intronic
1022196427 7:28071675-28071697 CAGCTGATTAAAGGGTTTGGAGG + Intronic
1022797317 7:33742438-33742460 CAGGAGGTTAATGGGTTTGGTGG + Intergenic
1022962108 7:35437271-35437293 AATCTGAGTAAAGGGTTTGCGGG - Intergenic
1025309840 7:57919211-57919233 GAGCTGTTTGAAGGGTTTGGTGG + Intergenic
1029267510 7:99353985-99354007 CAGCTGATGTCAGAGTTTGGTGG + Exonic
1030349127 7:108463737-108463759 CAGCTGATGCAAAGGTGTGGGGG + Intergenic
1031614676 7:123866645-123866667 AAGCTCATCAAAGGGTTTGATGG - Intronic
1034075942 7:148231314-148231336 CAGGGGATGAATGGGTTTGGGGG + Intronic
1042058848 8:64795385-64795407 CGCCTGATGAAAGGGTTTGATGG - Intronic
1042906327 8:73775995-73776017 CAGCTGACTTATCGGTTTGGAGG - Intronic
1044506958 8:93032625-93032647 AAGCAGAATTAAGGGTTTGGAGG + Intergenic
1045046874 8:98287239-98287261 CAGCTGATAGAGGTGTTTGGTGG - Intronic
1045422696 8:102032130-102032152 TAGCTGATTTTATGGTTTGGTGG - Intronic
1046920266 8:119720531-119720553 CAGCTCATGGAAGGGGTTGGTGG - Intergenic
1047353820 8:124101094-124101116 TAGGTGGTTAAAGGGCTTGGAGG + Exonic
1047995152 8:130327732-130327754 TAGCTTAGTAAAGGATTTGGAGG + Intronic
1051637861 9:19197213-19197235 CAACTGTTTAAAGGGATTTGGGG + Intergenic
1056259354 9:84832676-84832698 CAGCTGGTTCAAGGGGTTTGGGG - Intronic
1056632664 9:88306520-88306542 AAGGTGATGAAAGGGGTTGGAGG - Intergenic
1057924715 9:99134691-99134713 TAACTGATTAAAGGAATTGGTGG + Intronic
1059875529 9:118630274-118630296 CATCTGAGTAAAGTGTTTTGAGG + Intergenic
1060278051 9:122197227-122197249 CAATTGATTAAAGAGTTTGTGGG + Intronic
1061739784 9:132693308-132693330 CACCTAATTAAAAGGATTGGAGG - Exonic
1061937023 9:133863617-133863639 CAGCTGATGAAGGGCTCTGGAGG + Intronic
1186224250 X:7380436-7380458 CAGCTGATCATAGAGTTTGTTGG + Intergenic
1186792096 X:13009433-13009455 CAGCAGAGTCGAGGGTTTGGAGG + Intergenic
1187197943 X:17106024-17106046 GAGCTCACTAAAGGCTTTGGAGG + Intronic
1189242604 X:39537296-39537318 GTGCTGAGTCAAGGGTTTGGGGG + Intergenic
1189840940 X:45076936-45076958 CAGCAGATTAAATAGTTTGGGGG + Intronic
1190067905 X:47255075-47255097 CCCCTGAATGAAGGGTTTGGAGG - Intergenic
1192234362 X:69286315-69286337 CTGATGCTTGAAGGGTTTGGAGG - Intergenic
1196290091 X:113929882-113929904 CAGCTGACTAAAGTGGTTTGGGG - Intergenic
1201593723 Y:15643044-15643066 CAACTGATTATAGAGTTTGGTGG + Intergenic