ID: 1022197742

View in Genome Browser
Species Human (GRCh38)
Location 7:28084995-28085017
Sequence TAGAGTCCCCACTTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022197739_1022197742 -10 Left 1022197739 7:28084982-28085004 CCTCAGGACTCTGTAGAGTCCCC 0: 2
1: 26
2: 49
3: 111
4: 333
Right 1022197742 7:28084995-28085017 TAGAGTCCCCACTTGGAGGAAGG No data
1022197737_1022197742 12 Left 1022197737 7:28084960-28084982 CCTGGGCTGGCATGTTTGCACAC 0: 1
1: 0
2: 1
3: 19
4: 223
Right 1022197742 7:28084995-28085017 TAGAGTCCCCACTTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022197742 Original CRISPR TAGAGTCCCCACTTGGAGGA AGG Intronic
No off target data available for this crispr