ID: 1022197854

View in Genome Browser
Species Human (GRCh38)
Location 7:28086333-28086355
Sequence ATGCACCTCCCCAAATGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022197854_1022197856 1 Left 1022197854 7:28086333-28086355 CCGTTTCATTTGGGGAGGTGCAT 0: 1
1: 0
2: 1
3: 9
4: 149
Right 1022197856 7:28086357-28086379 CCAATCTGCCCAAATTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022197854 Original CRISPR ATGCACCTCCCCAAATGAAA CGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902464174 1:16604957-16604979 ATTTACCTCCCCAAGGGAAAAGG + Intronic
902500039 1:16904806-16904828 GCGCACCTCCCCAAAAGACAAGG + Intronic
902795867 1:18800044-18800066 AGGCACCTCTGCAAATGAGAAGG - Intergenic
903156924 1:21451721-21451743 ATTTACCTCCCCAAGGGAAAAGG - Intronic
907352644 1:53845530-53845552 TTGCCCCTCCCTAAATGAGAAGG + Intergenic
908101677 1:60797508-60797530 ATGCACCTCAACAAATGCCATGG + Intergenic
913153099 1:116065272-116065294 CTGCACCTCAGAAAATGAAAAGG - Intronic
913601727 1:120427659-120427681 ATTTACCTCCCCAGAGGAAAAGG - Intergenic
913992686 1:143629355-143629377 ATTTACCTCCCCAAGGGAAAAGG + Intergenic
914004570 1:143721014-143721036 GCGCACCTCCCCAAAGGACAAGG - Intergenic
914085316 1:144448941-144448963 ATTTACCTCCCCAGAGGAAAAGG + Intronic
914191205 1:145412915-145412937 ATTTACCTCCCCAGAGGAAAAGG + Intergenic
914362917 1:146951301-146951323 ATTTACCTCCCCAGAGGAAAAGG - Intronic
914488762 1:148135838-148135860 ATTTACCTCCCCAGAGGAAAAGG + Intronic
914589136 1:149090919-149090941 ATTTACCTCCCCAGAGGAAAAGG + Intronic
917265859 1:173220082-173220104 ATTCACCTTCCCAAAACAAAGGG + Intergenic
921569619 1:216762824-216762846 AAACACTTCCCCAAAGGAAAGGG + Intronic
921749959 1:218780709-218780731 ATCCACCTCCCAAAATCAATGGG + Intergenic
921991389 1:221371547-221371569 ATGCACCTCAAGAGATGAAAAGG - Intergenic
923086962 1:230709486-230709508 ATGCCCCTCCTAACATGAAAGGG + Intronic
1063710521 10:8472924-8472946 ATGCTCCTGCTCATATGAAATGG + Intergenic
1064416181 10:15152269-15152291 ATGCACCTCCCAGATTCAAAAGG + Intronic
1068825114 10:61428454-61428476 ATGCAAATCCCCAAATGGATAGG + Intronic
1075175289 10:120154707-120154729 ATGCACGTTCCCAGCTGAAATGG + Intergenic
1077915743 11:6610664-6610686 ATGCACCTCCCCAAAGCAGCAGG + Exonic
1078447227 11:11413397-11413419 AATCACCTCCCCAGATCAAATGG - Intronic
1079303961 11:19306037-19306059 ATGTGCCTCTCCAAAGGAAATGG + Intergenic
1080786289 11:35478166-35478188 AGGCCCCTCCCCAAATCCAAGGG + Intronic
1081941068 11:46942461-46942483 ATGCACCTCACCAAATTAGGTGG - Intronic
1085872765 11:80370006-80370028 ATGAACCTCCTAATATGAAAAGG - Intergenic
1088439983 11:109859473-109859495 ATTTACCTCCTCAAAAGAAATGG + Intergenic
1090401590 11:126452789-126452811 AGGCACCTCCCCAAAAGACCTGG - Intronic
1092567273 12:9680678-9680700 ATGAATCTCTCCAATTGAAAGGG + Intronic
1093276095 12:17129464-17129486 ATGCACTTTCAAAAATGAAAAGG - Intergenic
1094362208 12:29641620-29641642 CAGCACCTACCCAAATGAGAAGG + Intronic
1096967217 12:55637919-55637941 ATGCAGCACCTCAAAGGAAAAGG + Intergenic
1102099924 12:110270374-110270396 ATGCATCTTCCCAGATGGAACGG + Intergenic
1104799757 12:131546654-131546676 AGGCTGCTCCCCAAAGGAAAGGG - Intergenic
1105460634 13:20582469-20582491 TTCCATCTGCCCAAATGAAAAGG - Intronic
1108793822 13:54006281-54006303 CTGCAGCTCCCCAGATAAAATGG - Intergenic
1109461415 13:62663821-62663843 ATTCAACTCCCCTAAAGAAAAGG + Intergenic
1110042177 13:70776292-70776314 ATACCCCTACCAAAATGAAAGGG + Intergenic
1112951496 13:105002852-105002874 ATGCAACACCAAAAATGAAAAGG - Intergenic
1114544958 14:23492969-23492991 ATGGGCCTGCCCTAATGAAAAGG + Intronic
1116572220 14:46532793-46532815 ATACTCCTCAGCAAATGAAAAGG - Intergenic
1116799488 14:49428353-49428375 ATGCATTTCTCCAAAGGAAAGGG - Intergenic
1117382211 14:55175738-55175760 GTTCACATCCCCAAATGATATGG + Intronic
1118488659 14:66237819-66237841 AAGCAGCTGCCCAAATGAAATGG - Intergenic
1119866780 14:77981044-77981066 AGGCACCTGCCCAGGTGAAAGGG - Intergenic
1123427559 15:20184556-20184578 ATGCACATCCTCAAACTAAAAGG + Intergenic
1124086244 15:26552868-26552890 ATGGAACACCCCAAATGAACAGG - Intronic
1124898159 15:33796748-33796770 AAGCATCTACCCAAAGGAAATGG + Intronic
1128180490 15:65599348-65599370 AATCACCTTCCCAAATGAATGGG + Intronic
1131194870 15:90347670-90347692 ATTCATCTCTGCAAATGAAAAGG - Intergenic
1133669867 16:8007865-8007887 ATGCACCTTCCCAAATGCCAGGG - Intergenic
1137509899 16:49090035-49090057 CTGAACTTCCCCAAAGGAAAGGG + Intergenic
1138345690 16:56318671-56318693 AAGCAGCTCCTCAAATGGAAGGG + Intronic
1147276342 17:39320323-39320345 ATCCACCTCCAAAAATTAAAGGG - Intronic
1151091528 17:71445538-71445560 ATGAACCTCTCCAAATCCAACGG + Intergenic
1156454282 18:37284354-37284376 AAGCACCTCCCCAAGGCAAAAGG + Intronic
1157418847 18:47527999-47528021 AGGCATCCCCCCACATGAAAAGG + Intergenic
1157618146 18:48999833-48999855 ATGACCCTCCGCAAATGAACGGG - Intergenic
1165916039 19:39260940-39260962 ATTTAGCTCCCCAACTGAAATGG + Intergenic
929010187 2:37434514-37434536 ATACAGCTACCCAAATGAGAGGG - Intergenic
929871816 2:45765619-45765641 ATGCTTTCCCCCAAATGAAAAGG - Intronic
931008036 2:57875059-57875081 ATTCACCTTTCCAAATGAATGGG + Intergenic
934108081 2:88714623-88714645 ATACCCCTCCCAAAAAGAAATGG - Intronic
934524689 2:95044373-95044395 ATGCAGTTCCCCCATTGAAAGGG - Intronic
934636894 2:95997852-95997874 ATGCACCTGCATAAATTAAAAGG - Intergenic
934796758 2:97107573-97107595 ATGCACCTGCATAAATTAAAGGG + Intergenic
934836661 2:97595860-97595882 ATGCACCTGCATAAATTAAAGGG - Intergenic
935312316 2:101797120-101797142 GTGCTCCCCTCCAAATGAAAAGG - Intronic
935364994 2:102279835-102279857 ATGCACCTCCCCAGCTGAGGTGG + Intergenic
937103755 2:119291553-119291575 AGGCACCTCGGGAAATGAAATGG + Intergenic
937548902 2:123061724-123061746 CTGCACCTTCTCAAATGAATGGG - Intergenic
937675262 2:124583290-124583312 AAGCAACTCCTCAAATGCAATGG + Intronic
937686308 2:124701519-124701541 ATGCATACCCCCAAAAGAAATGG - Intronic
937717129 2:125045433-125045455 ATTCACCTCCTCAGATTAAAGGG + Intergenic
940015979 2:149104525-149104547 AGACACCTCACCAAAGGAAATGG - Intronic
940262625 2:151798105-151798127 ATACACATGCACAAATGAAATGG + Intronic
943212360 2:184984088-184984110 ATGCTCCTACCACAATGAAATGG + Intergenic
944873952 2:203943265-203943287 CAGCACCTACCCAAATGAGAAGG - Intronic
1169537274 20:6558640-6558662 ATGCATCACCCCAAATAATATGG - Intergenic
1170526852 20:17247332-17247354 ATTCAGGTCCCCAAATGAAATGG + Intronic
1171297680 20:24033089-24033111 ATGCACCTCCACTCATCAAAAGG + Intergenic
1175995027 20:62808163-62808185 ATGCGCCTCCCCGAAAGACACGG + Intronic
1182009575 22:26989351-26989373 ATGCACATACACCAATGAAAAGG - Intergenic
949411425 3:3769192-3769214 AAGCACTTCCCTAGATGAAATGG + Intronic
953710233 3:45263839-45263861 GTTCTCCTGCCCAAATGAAAGGG + Intergenic
954495708 3:50958815-50958837 GTGAGCCCCCCCAAATGAAATGG + Intronic
958785861 3:98595312-98595334 ATGAACCTCATCAAATGAAAAGG + Intergenic
959482820 3:106894344-106894366 ATGTACATCCCCAAATGATTTGG + Intergenic
959850053 3:111074618-111074640 ATGCACACCCCCAAAACAAACGG - Intronic
962674387 3:137743780-137743802 ATGCTCATCCCTAAATGCAAAGG + Intergenic
963607106 3:147421087-147421109 AAGCCCCTCGCCAAATGAAAAGG - Intronic
975085705 4:70336158-70336180 AGACACCTCCACAACTGAAACGG + Exonic
981688783 4:147482978-147483000 TTCCAGCTTCCCAAATGAAAGGG - Intronic
982091924 4:151887618-151887640 ACTCTCCTCCTCAAATGAAAAGG - Intergenic
983174632 4:164573861-164573883 ATGCAGCTCCTCAAAAGAAAAGG - Intergenic
983782517 4:171688573-171688595 ACCTATCTCCCCAAATGAAAAGG - Intergenic
984323666 4:178224944-178224966 CAGCACCTACCCAAATGAGAAGG + Intergenic
985997491 5:3605070-3605092 ATGCACTTCTCAAAATGACAGGG + Intergenic
986230231 5:5857325-5857347 ATGCATTTCCCCATATGATAGGG + Intergenic
988820422 5:34878840-34878862 AGGCATCTACCCAAAAGAAAAGG + Intronic
992152748 5:73922033-73922055 ATGCAAAACCCCAGATGAAAAGG + Intronic
992339984 5:75813969-75813991 TGGCACCTACCCAAATGAGAAGG - Intergenic
993471983 5:88317423-88317445 GGGCACCTACCCAAAGGAAAGGG - Intergenic
993975183 5:94471140-94471162 ATGCACCTTACAAAACGAAAGGG + Intronic
996651485 5:125882329-125882351 ATGCAACTCCCCCACTCAAAAGG + Intergenic
997682475 5:135766034-135766056 GTGCACCTCCCCCAAGGATATGG + Intergenic
998738779 5:145175412-145175434 ATGCAGCTGGCCAAATGCAATGG + Intergenic
998994197 5:147852486-147852508 ATCCAACTACCCAAATGACAAGG + Intergenic
999756118 5:154665727-154665749 TCTCACCTCCCCAAATGATATGG - Intergenic
1000699606 5:164432315-164432337 TTGCACCTTCCCCAAGGAAATGG + Intergenic
1003329079 6:5114531-5114553 TTGCACCTCCCCAGGTGATAGGG - Intronic
1009664588 6:66658843-66658865 ATGCACCATCCCCATTGAAAGGG - Intergenic
1020285494 7:6676556-6676578 AGGCCTCTCCACAAATGAAATGG + Intergenic
1020335246 7:7057804-7057826 ATGCAACTCCCCAAATCCAGGGG + Intergenic
1022197854 7:28086333-28086355 ATGCACCTCCCCAAATGAAACGG - Intronic
1022388146 7:29920970-29920992 AAGCACCTCCAAGAATGAAAGGG + Intronic
1028018994 7:85747777-85747799 TTGAACCCCCCCAAATAAAAAGG + Intergenic
1029700076 7:102240669-102240691 ATGAACTTTCCCAAATGCAAAGG - Intronic
1030711499 7:112755566-112755588 ATACACATCTTCAAATGAAAAGG + Intergenic
1031820939 7:126500486-126500508 ATGTACCTCCCCATAAGAACTGG + Intronic
1033013842 7:137651447-137651469 ATGCACCTCAGGAAATGAGATGG - Intronic
1034903321 7:154921624-154921646 AGGCCCCACCCCAAATGAAAGGG - Intergenic
1037017778 8:13929920-13929942 ATCCATCCCCCAAAATGAAAAGG + Intergenic
1039454868 8:37699620-37699642 ATGCACTTCGCAAAATGTAAGGG - Exonic
1039603171 8:38858844-38858866 ATCCACCTACACAATTGAAATGG - Intergenic
1040381503 8:46877550-46877572 ATGCACCCCCCCAGATCAACAGG + Intergenic
1040839927 8:51774277-51774299 TTGCACCTCCTAAAATTAAAAGG + Intronic
1043816793 8:84812109-84812131 CAGCGCCTACCCAAATGAAAGGG - Intronic
1044086170 8:87944503-87944525 ATACACCTCCCCAAATGGTCAGG - Intergenic
1044293137 8:90496148-90496170 ATACACATGCACAAATGAAATGG - Intergenic
1044839854 8:96328225-96328247 TTCCACCTCCCCAAACGAGAGGG - Intronic
1045555546 8:103211537-103211559 ATGGAGATCCCCAAAAGAAATGG - Intronic
1046237876 8:111450515-111450537 ATGGACCTCCCTGAAAGAAAAGG - Intergenic
1047072422 8:121360561-121360583 ATGCAACTCCCCAAATAACAGGG + Intergenic
1047991654 8:130292650-130292672 GTGCACCTACACAAATGCAATGG + Intronic
1051501702 9:17785188-17785210 ATGCCCCTCCCCAACTGATGAGG + Intronic
1053064520 9:35058400-35058422 ACAGACCTCCCAAAATGAAAAGG - Intronic
1053150465 9:35739836-35739858 ATGTACCTCCCAAGATGGAAAGG + Intronic
1055277803 9:74639727-74639749 CTGAACCTACCCAAATGCAAAGG + Intronic
1055357866 9:75455990-75456012 ATCCACCCACCCAAATGAAAAGG + Intergenic
1055858164 9:80717157-80717179 ATCCAGCTGCCCAAATGCAAGGG + Intergenic
1059857378 9:118414928-118414950 ATGTGCTTTCCCAAATGAAAGGG + Intergenic
1060909164 9:127335056-127335078 ATGCAACCCCCCACATGGAAAGG - Intronic
1061444939 9:130632382-130632404 ATGCCCCTCCCCAAATGACAAGG + Intronic
1185744290 X:2559583-2559605 ATGCAATTCTCCCAATGAAATGG + Intergenic
1185953932 X:4468293-4468315 ATCCACTTTCCCAAATTAAACGG + Intergenic
1187035788 X:15537916-15537938 ATGCACCTCCCCACAGGGCAAGG - Intronic
1188099425 X:26065131-26065153 ATACTCCTCAGCAAATGAAAGGG + Intergenic
1192107891 X:68333709-68333731 ACGCACCTCCATATATGAAATGG + Intronic
1194380662 X:93187389-93187411 ATAAACCTCCCCAAAATAAAGGG - Intergenic
1195783766 X:108493735-108493757 AGGGAGCTCCCCAAATGAATGGG + Intronic
1198937629 X:141915536-141915558 ATGCACCTCCTCTTATGACATGG + Intergenic
1198961425 X:142187327-142187349 ATGCACCTCCTCTTATGACATGG - Intergenic
1200924408 Y:8641639-8641661 ATGCAGCTCTCCAACAGAAATGG - Intergenic
1202071184 Y:20993203-20993225 AAGCTACTCTCCAAATGAAAGGG + Intergenic