ID: 1022197857

View in Genome Browser
Species Human (GRCh38)
Location 7:28086365-28086387
Sequence CAGAGCTTCCTCTTTAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022197857 Original CRISPR CAGAGCTTCCTCTTTAATTT GGG (reversed) Intronic
903005787 1:20297772-20297794 CAGAGCTTCCTCTGTGAATAGGG - Intronic
905796967 1:40821224-40821246 CAGAGCTGTCTCATTAATTATGG - Intronic
906648141 1:47490939-47490961 TAGCGCTTTCTCTTTAATTGGGG + Intergenic
907647074 1:56254839-56254861 CTGAGCTGCCTCTTTATTTATGG + Intergenic
908147250 1:61259638-61259660 CAGATCTCCGTCTTAAATTTAGG - Intronic
908508860 1:64834362-64834384 AAGGACTTCCTCTTTAAATTTGG - Exonic
909364368 1:74802110-74802132 CATAGCCTGCTTTTTAATTTAGG - Intergenic
909965314 1:81902294-81902316 CAGAACTGCCTCTTTAAATATGG - Intronic
911424479 1:97689957-97689979 GTTAGCTTTCTCTTTAATTTAGG + Intronic
913073998 1:115325734-115325756 CACTGCTCCCTCTTTAATCTGGG - Intronic
913657433 1:120974739-120974761 CAGATCTTCTTCTTTAAAATGGG + Intergenic
914008782 1:143757821-143757843 CAGATCTTCTTCTTTAAAATGGG + Intergenic
914647412 1:149666474-149666496 CAGATCTTCTTCTTTAAAATGGG + Intergenic
915652257 1:157323388-157323410 GAGAGCTACCTCTTTAAGGTAGG + Intergenic
918695109 1:187535705-187535727 CAGAATTTCCTCTTTATTTAAGG + Intergenic
919910025 1:202105561-202105583 CAGAGCCTCTTCTGTAATTTGGG - Intergenic
920714611 1:208327839-208327861 CAGTTCATCCTCTATAATTTAGG + Intergenic
921035349 1:211372635-211372657 CAGAGTGTCATCTTTAATGTAGG - Exonic
921338237 1:214109367-214109389 CTGACCTTCCTATTTTATTTAGG - Intergenic
922216308 1:223522905-223522927 CACATTTTGCTCTTTAATTTTGG - Intergenic
1062983809 10:1747900-1747922 AAGAGGTTTCACTTTAATTTTGG - Intergenic
1063171471 10:3513658-3513680 CAGAGGTTCCTCCATTATTTAGG - Intergenic
1063351470 10:5360214-5360236 CAGAGCTTTCTCTTTTCTTTTGG - Intergenic
1063777941 10:9285314-9285336 CAGATTCTCCTCTTTACTTTTGG - Intergenic
1063820319 10:9827237-9827259 CAAGATTTCCTCTTTAATTTTGG - Intergenic
1064129181 10:12693018-12693040 CAGATCATCCTCTATAATGTGGG + Intronic
1064678407 10:17784814-17784836 CAGAGCTTCCCCATTCTTTTGGG - Intronic
1065106518 10:22393282-22393304 CTGAGTTTCCTCTTAAGTTTTGG + Intronic
1065907231 10:30267003-30267025 GAGAGCTTCCTTTTTGATATAGG - Intergenic
1068709497 10:60117980-60118002 AAAAGCTTCATCTTTCATTTGGG + Intronic
1069271189 10:66529796-66529818 TAGAGTTTCTTCTATAATTTTGG - Intronic
1070063448 10:73009416-73009438 CAAAGCTTTTTCTTTAAATTTGG - Intronic
1071231000 10:83585642-83585664 CAAGGCTTTCTCTTTATTTTCGG + Intergenic
1073938575 10:108665451-108665473 CACAGGTTCCTCCTTAACTTGGG + Intergenic
1074246092 10:111695246-111695268 CTGAATTTCCTCTTTATTTTGGG - Intergenic
1075271687 10:121057749-121057771 CAGAGCTGACTATTTGATTTGGG + Intergenic
1078571608 11:12462806-12462828 CAGAGCTTCCTCCTAACTTAGGG - Intronic
1080830854 11:35892062-35892084 CAATGCTTCCTCTTGAATGTGGG + Intergenic
1084561505 11:69908072-69908094 CAGAGCTTCAACTTTAGGTTGGG + Intergenic
1086785228 11:90961024-90961046 AAGAGCTTCTTGTTTGATTTAGG - Intergenic
1087176718 11:95103062-95103084 CTTAGCTTCCTCTTTAACTGTGG - Intronic
1087784368 11:102338467-102338489 CACAGTTTCCCCTGTAATTTTGG - Intronic
1090623836 11:128587618-128587640 TAGAGCTGCCTCCTTAAATTGGG + Intergenic
1092311161 12:7355415-7355437 CATACCTTCCTTTTTAATTTTGG - Intronic
1093112282 12:15166401-15166423 CAGTGTCTCCTTTTTAATTTTGG + Intronic
1093264253 12:16982960-16982982 CAGATTTCCCTCTTTAATGTGGG - Intergenic
1093307196 12:17536053-17536075 AAGCTCTTCCTCTTTAATTTTGG + Intergenic
1094146480 12:27233708-27233730 CAGTGTTTCCACTTTCATTTAGG - Intergenic
1095081676 12:38007262-38007284 CAGAGTTTTCTCTTTATATTTGG - Intergenic
1095394774 12:41749435-41749457 CAGAGCTTCCTATTTTCTTGAGG + Intergenic
1097549008 12:61043561-61043583 CAGCACTTTCTCTTTAACTTAGG - Intergenic
1099408330 12:82290861-82290883 CATAGCTTGCTGTATAATTTGGG - Intronic
1102206952 12:111097322-111097344 CACTGCTTCCTGTTCAATTTTGG + Intronic
1104658066 12:130588779-130588801 CTGAGCTTCCTGTTTCATCTGGG - Intronic
1104662226 12:130619690-130619712 TAGAGCTTACTCTTTAACCTGGG - Intronic
1104870054 12:131988552-131988574 TCTAGCTTTCTCTTTAATTTTGG + Intronic
1105678734 13:22704206-22704228 GAGAGCTTCGTCTTAATTTTCGG + Intergenic
1107346941 13:39472037-39472059 CACAGTTTCCTGTGTAATTTTGG - Intronic
1109408170 13:61927814-61927836 CAGAGCTTCCTCTCTAGTAAGGG + Intergenic
1109941900 13:69379181-69379203 GAGAGCATACACTTTAATTTTGG - Intergenic
1111268989 13:85854799-85854821 TTGAGTTTCCTCTTGAATTTGGG - Intergenic
1111849155 13:93550089-93550111 CACCCATTCCTCTTTAATTTAGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112259017 13:97861431-97861453 TATAGCTTACTCTTTACTTTTGG - Intergenic
1112568837 13:100575034-100575056 CAGACCTTCCTTTCTAATATAGG - Intronic
1112702156 13:102022164-102022186 AAGAGCTTCCTTTTTAATCTGGG + Intronic
1114688362 14:24556699-24556721 CAGAGTTTCCTCTCTAATGTGGG - Intergenic
1114799939 14:25762052-25762074 CACTGCTTCTTCTTTAATTCAGG + Intergenic
1117424017 14:55577083-55577105 TAGACCTCCCTCTTGAATTTGGG - Intronic
1119760764 14:77149557-77149579 TAGAGCTTCATCTTCAACTTTGG + Intronic
1120125677 14:80739745-80739767 AAGAGCTTCCTGATTCATTTAGG - Intronic
1120558228 14:85956754-85956776 CAAAGCTTCCTCTGTATTTACGG + Intergenic
1121392116 14:93584442-93584464 CAGGTCTTCTACTTTAATTTAGG + Intronic
1124454486 15:29827809-29827831 CAGAGCTGCCTCTATAATCTAGG - Intronic
1125403780 15:39332187-39332209 TAGAGCTTACTCTCTATTTTGGG + Intergenic
1125825733 15:42674701-42674723 CAGCTCTTCCTCTTTTATTATGG + Intronic
1126532829 15:49730522-49730544 AAGAGCTCCCTCTTTAATTTTGG - Intergenic
1127682718 15:61313186-61313208 GAGAGCTTCCTTTTCATTTTAGG - Intergenic
1130687559 15:86052406-86052428 AAGAGCTTCCTCATATATTTTGG + Intergenic
1133583665 16:7170807-7170829 CAGAGCTTCCACTTAAATCCAGG + Intronic
1135499691 16:22983685-22983707 CATTGCTTTGTCTTTAATTTCGG - Intergenic
1135516259 16:23138083-23138105 CAGAGCTTCAACTTGAACTTAGG - Intronic
1135897150 16:26417394-26417416 CAGGATTTCCTCTTTATTTTTGG - Intergenic
1138257755 16:55582290-55582312 CAGAGATTCCTTTTTAAGTCAGG - Intronic
1139495276 16:67312359-67312381 TAGAACTTCCTGTGTAATTTGGG - Intronic
1140464496 16:75169142-75169164 CAGGGCTGACTCTTTAGTTTGGG - Intronic
1140602524 16:76494643-76494665 CAGCAGTTCCTATTTAATTTAGG - Intronic
1143219634 17:5250509-5250531 CAGAACTTCCTCTCTTATTAAGG - Intergenic
1143352578 17:6299491-6299513 CAAAGCCTCCTCTATCATTTGGG + Intergenic
1143886580 17:10069375-10069397 CAAAGCTTCCTCTTCCATGTTGG + Intronic
1146087679 17:29845141-29845163 AAGAACTTTCTCTTCAATTTTGG - Intronic
1148884583 17:50762653-50762675 CAGATCTTAATTTTTAATTTTGG - Intergenic
1149348968 17:55768160-55768182 TAGTGCTTCCTATTAAATTTTGG + Intronic
1152254917 17:79233194-79233216 CAGAGGTTCCTCTGTGATGTTGG - Intronic
1153690158 18:7584522-7584544 CTGATCTTCGTCTTTATTTTAGG - Intronic
1153726334 18:7959685-7959707 CACATCTTCATCTCTAATTTGGG + Intronic
1157368581 18:47089195-47089217 TTCAGCTTCCTCTTTATTTTTGG + Intronic
1158410270 18:57199128-57199150 CAGAGCCTCCTCCTCCATTTTGG + Intergenic
1159052677 18:63436169-63436191 CAATGCTTCCTTTTTATTTTAGG + Intergenic
1159837451 18:73356064-73356086 CTGAGCTTCATCTTTAATAATGG - Intergenic
1162612130 19:11764837-11764859 CAGATCTTTCTTTTTGATTTGGG + Intergenic
1164428209 19:28163545-28163567 CAGTGCTTCATATTTCATTTAGG - Intergenic
1166796687 19:45430451-45430473 CAGAGCTTTCTCTTAAACCTAGG + Intronic
927733875 2:25500794-25500816 CAGAGTTTCCTTTTTTGTTTTGG - Intronic
929357744 2:41046001-41046023 GAGAGCTTTCTCTTGAATTGTGG + Intergenic
929389142 2:41448549-41448571 CAGTGCTTCCTCTGAAATTCAGG - Intergenic
929970318 2:46568676-46568698 CAGAGTTTCCCCATTCATTTTGG + Intronic
931231015 2:60375003-60375025 TAGAGCTACCTCTTTGGTTTTGG - Intergenic
931925478 2:67067680-67067702 CAGAGACTGCTCTTTTATTTAGG - Intergenic
932799925 2:74732380-74732402 CAGAGCTTCCTAAATATTTTTGG + Intergenic
932863972 2:75322278-75322300 CACTGTTTCCTCTTTAATATTGG - Intergenic
932868789 2:75375262-75375284 CAGAGTTTCCTCTTGAATTAAGG + Intergenic
935426048 2:102919276-102919298 CAGTGCTTCCCCATTAATTATGG - Intergenic
937021790 2:118663972-118663994 CAGAACTTACTTTTAAATTTGGG - Intergenic
937600503 2:123725937-123725959 CACAGCATCCTCTTTATTTTAGG + Intergenic
937731171 2:125231762-125231784 CACAGCTGCCTCTTTAAGTAAGG + Intergenic
938181096 2:129184565-129184587 AAAATCTTCCTCTTTATTTTTGG + Intergenic
941021625 2:160412942-160412964 CAAAGCTTACTCTTTTATGTGGG - Intronic
941405985 2:165089398-165089420 CAGAGCTCTATATTTAATTTAGG - Exonic
941812312 2:169767425-169767447 CTGATCTTCGTGTTTAATTTTGG - Intronic
941901134 2:170679523-170679545 CAGAGCTTTCCCTTTAACTGTGG - Intergenic
942268493 2:174250518-174250540 AAGAGCTTTCTCTACAATTTTGG + Intergenic
942695006 2:178632181-178632203 CATAGCTTCTACTCTAATTTGGG + Exonic
944409760 2:199428434-199428456 CAGCACTTGCTCTTTACTTTTGG - Intronic
945448088 2:209961904-209961926 GAGAGCTTCCCCTGTATTTTTGG - Intronic
946456909 2:219833934-219833956 CAGAGCCTGCTCTTACATTTGGG + Intergenic
946614903 2:221498815-221498837 CAGAGTTTCCTCTGTCATCTAGG + Intronic
948554618 2:238799545-238799567 GAGAGCTTCCTCTTGATTTCTGG - Intergenic
1173895390 20:46546793-46546815 CAGGGTCTCCTCTATAATTTAGG + Intronic
1174693169 20:52529928-52529950 CACAGCTTCCACTTTCATCTGGG + Intergenic
1176806593 21:13489786-13489808 CCTTGCTTCCTCTTTTATTTGGG - Intergenic
1178098951 21:29245200-29245222 ATGAGCCTCCTCTGTAATTTTGG + Intronic
1178458476 21:32778498-32778520 CTGTCCTTCCTCTTTTATTTTGG - Intergenic
1180051246 21:45331963-45331985 CAGCGCTTCCTCCTTCACTTAGG - Intergenic
1180890593 22:19285322-19285344 CAGAGCTCCCTCTTTAGGCTAGG - Intronic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
1182181895 22:28357972-28357994 AATAGCTCCCTCTTTGATTTTGG - Intronic
1182694630 22:32188547-32188569 CATAGCTTCCTCTTACATATGGG - Intergenic
1185253422 22:49817784-49817806 CAGAGCAGTCTCTTGAATTTTGG - Intronic
949596776 3:5556233-5556255 CTGCTCTTCCTGTTTAATTTGGG - Intergenic
949887448 3:8707501-8707523 CAGAGCTTGCTATTTATTTGCGG + Intronic
950416306 3:12870754-12870776 GAGTGCTTCCTCTTTTGTTTTGG - Intronic
951011174 3:17681824-17681846 CAAAGCTTCCTCTGTATTTACGG + Intronic
951983567 3:28592584-28592606 CAGATTTTACTTTTTAATTTTGG + Intergenic
953860738 3:46542191-46542213 CAGAGTTTCCTTTTTCTTTTAGG - Intronic
954995635 3:54878812-54878834 ATGACCTTCATCTTTAATTTGGG - Intronic
955948897 3:64222439-64222461 AAGATCTTTCTTTTTAATTTTGG - Intronic
956056039 3:65300144-65300166 CAGAACTGGCTCTTCAATTTTGG + Intergenic
956602916 3:71042102-71042124 CCTATCTTCCTCATTAATTTTGG + Intronic
961960442 3:130848971-130848993 CAGAGATGCCTCTTTATTGTGGG - Intergenic
962815851 3:138998832-138998854 GAAAGCTTCCTCTTTAATCTTGG + Intergenic
963546923 3:146671699-146671721 CTGAGCTCCCTCTTCAACTTTGG + Intergenic
964193759 3:154037174-154037196 AAGAACTCCCTATTTAATTTGGG + Intergenic
965234978 3:166106709-166106731 CAGAGCTTGCTTTTTAATGAAGG - Intergenic
965993386 3:174847328-174847350 CAGATATTCCTCTTTAAATTTGG - Intronic
966098481 3:176237035-176237057 CAGAAATTCATATTTAATTTTGG - Intergenic
968321504 3:197772985-197773007 CAAACCTTTCTCTTTATTTTTGG + Intronic
970108615 4:12612835-12612857 CAGACTTTCCTCTCTACTTTTGG + Intergenic
970408958 4:15789516-15789538 CATAGCATCTTCTTTACTTTAGG - Intronic
971213176 4:24639595-24639617 CAGTCCTTCCTCTATAAATTTGG - Intergenic
972356740 4:38286469-38286491 CTGAGCTTCTGCTTTAATTTTGG + Intergenic
973533837 4:51860887-51860909 CAGAGCTTCCTCTGTAATTGAGG - Intronic
974825724 4:67127132-67127154 CAAACCTTCCATTTTAATTTGGG - Intergenic
978003374 4:103584945-103584967 TAGAGCTTACACTTTAATTGGGG + Intergenic
978545417 4:109867299-109867321 CTGAGCTTCATCTTTAACATAGG + Intronic
978737232 4:112097781-112097803 TAGATCATCCTCTTAAATTTAGG + Intergenic
978828325 4:113051520-113051542 CAAAACTTGCTCTTTCATTTTGG - Intronic
979130845 4:117042976-117042998 CAGAGGTTCCTCGTTATTATAGG + Intergenic
979882485 4:125979038-125979060 AATAGTTTTCTCTTTAATTTGGG + Intergenic
979958300 4:126983055-126983077 ATGGGCTTCCTCATTAATTTTGG - Intergenic
981449300 4:144878257-144878279 CTGAGTTTTCTCTGTAATTTGGG + Intergenic
982803374 4:159732356-159732378 CAGAGCTTTCGCTTTACTTCGGG + Intergenic
983331592 4:166335545-166335567 AAGAACTTCCTCTTTAACCTTGG - Intergenic
985262175 4:188125152-188125174 CAGAACTTCATCTCTAGTTTAGG + Intergenic
986825745 5:11520347-11520369 CAGGCCTTTCTCTTTAATCTAGG - Intronic
986845479 5:11747331-11747353 TAGAACTTCCTCTTTTATTCTGG - Intronic
987051950 5:14154302-14154324 CAGGGCTTCCTTTCTAACTTAGG + Intronic
987375716 5:17232145-17232167 CACAGCTTCATTTTTCATTTCGG - Intronic
988091593 5:26547717-26547739 CAGCTATTCTTCTTTAATTTGGG - Intergenic
989399170 5:40990749-40990771 CATAGCTTCTTTTTCAATTTGGG - Intergenic
990106845 5:52274277-52274299 CAAACCTCACTCTTTAATTTTGG - Intergenic
990396667 5:55388736-55388758 CAGAGCCTCCTCCTTAAAATTGG - Intronic
993216897 5:85036386-85036408 AAGAGCTTCATTTTGAATTTTGG + Intergenic
995499607 5:112790284-112790306 CACAGCTTCTTGTTTTATTTGGG + Intronic
996211511 5:120817332-120817354 CAGAGCTTCCTGTTCAGCTTGGG + Intergenic
999977744 5:156928613-156928635 CAGAGCTTCCTTTGTACTTAAGG + Intronic
1004631640 6:17426947-17426969 CAGAACTTCCACTTTAGTCTGGG + Intronic
1005115091 6:22327204-22327226 CATTGATTCCTCTTTAATTTTGG - Intergenic
1005116037 6:22338329-22338351 ATGAGCTTCCCCTTTGATTTGGG + Intergenic
1005591767 6:27336100-27336122 CATTGCTACCTCTTTAATTGTGG + Intergenic
1006296533 6:33172417-33172439 GAGAGCTCTCTGTTTAATTTGGG - Intronic
1008044020 6:46833345-46833367 CAGAGCTTTCTCTGCTATTTGGG - Exonic
1008196504 6:48529912-48529934 CAGAGCTTCCTCTACAATAAAGG - Intergenic
1008695149 6:54027329-54027351 CATAGCATCCACTTTATTTTAGG - Intronic
1009802708 6:68561537-68561559 ATGAGCTTCCTCTCTAATTCAGG + Intergenic
1009903925 6:69844986-69845008 CATAGCCTCCTCTTCAACTTAGG + Intergenic
1012390128 6:98728913-98728935 CAGTGCTTCATCTTTAAGTAGGG + Intergenic
1012450032 6:99345486-99345508 CAGAAACTCCTCTCTAATTTAGG + Intronic
1013819161 6:114134623-114134645 CAGAGATTCCCATTTAATTAGGG + Intronic
1013826909 6:114223516-114223538 CAGAAATTCTTCTTCAATTTAGG - Intronic
1015450175 6:133358206-133358228 CAGAGCTTTGTCTTTAAGGTAGG + Intronic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1020649775 7:10860250-10860272 CAGAGTTTCATCTTTGATGTGGG - Intergenic
1022197857 7:28086365-28086387 CAGAGCTTCCTCTTTAATTTGGG - Intronic
1023624831 7:42105804-42105826 CAGAGCTGCCTCTTTGCTTGAGG - Intronic
1025013788 7:55422429-55422451 CACAGTTTCCTCTTAATTTTGGG + Intronic
1026892708 7:73991920-73991942 CAGGGCTTCCTCTGTAAGCTAGG + Intergenic
1027493846 7:78863129-78863151 CAATGCTTCCTATTTAACTTTGG + Intronic
1030483663 7:110137870-110137892 CAGAGATGCCAATTTAATTTAGG - Intergenic
1033896680 7:146079766-146079788 AAAAGATTCCACTTTAATTTGGG - Intergenic
1035679812 8:1479616-1479638 TAGAGTTTGCTCTTTCATTTCGG + Intergenic
1038527446 8:28288531-28288553 CAGAGCTTGCACTTCAACTTCGG - Intergenic
1039358428 8:36847027-36847049 CTGAGGTTCCTCATTAACTTTGG + Intronic
1039733143 8:40301466-40301488 CAGTTCTTCCTCTTTGTTTTGGG - Intergenic
1040965711 8:53078918-53078940 GAGAGCTTCCTCTGTCATTTAGG + Intergenic
1042236173 8:66614938-66614960 CAGAGCTTCTGCTATATTTTAGG + Intergenic
1042836166 8:73080868-73080890 CTGAGCTTCCTATCTACTTTGGG + Intronic
1042937178 8:74071385-74071407 CAGAGTTAACTCTTTAATGTAGG + Intergenic
1043309481 8:78840499-78840521 CAGAGTTGTCTTTTTAATTTAGG - Intergenic
1043590114 8:81821523-81821545 CAAGGCTTTCTCTATAATTTTGG + Intronic
1044267182 8:90195876-90195898 GAGATCTTCCTCATTATTTTGGG - Intergenic
1044859384 8:96507861-96507883 AAGAGTTTCCTCTTGAATATTGG + Intronic
1045559973 8:103251962-103251984 CAGAGCTTCTCCTTTTGTTTTGG + Intergenic
1045886068 8:107099268-107099290 CAAAGCTTCCTTCTTAATATGGG + Intergenic
1046572782 8:115987701-115987723 CTGAGATTTCTCTTCAATTTCGG + Intergenic
1046894031 8:119453417-119453439 CAGAGGTTGCTCTTAACTTTGGG - Intergenic
1047718882 8:127620347-127620369 CACAGCTTCCCTTTTAACTTAGG - Intergenic
1048959691 8:139565720-139565742 CAGAGTTTCCTCTGTAATGTGGG - Intergenic
1052555399 9:30008004-30008026 CTGATCTTCATCTTTAACTTAGG - Intergenic
1053176079 9:35925151-35925173 AGGAGGTTTCTCTTTAATTTAGG - Intergenic
1054825455 9:69568297-69568319 CAGAGTTTTCTCTTCACTTTAGG + Intronic
1056138943 9:83655841-83655863 CAAACCCTCCTCTTAAATTTGGG + Intergenic
1058375182 9:104314697-104314719 CATAGCTTCCTCTTCAACTATGG - Intergenic
1058642023 9:107096890-107096912 CGGAGATTCCTCTGTAATGTTGG + Intergenic
1059743594 9:117179199-117179221 CAGAGCTTTCTTTCTACTTTGGG + Intronic
1061506270 9:131033570-131033592 CACAGCTTCCTCTTGACTTCTGG - Intronic
1189681424 X:43520274-43520296 CTGAGCTTCCTCATTTAATTAGG - Intergenic
1190286135 X:48962540-48962562 CAGAGGGTCCTCTTCATTTTTGG - Exonic
1190441349 X:50477603-50477625 CATATCTACCTCTTTATTTTTGG + Intergenic
1192973031 X:76253540-76253562 GACAGCTGCCTCTTTAGTTTGGG + Intergenic
1193610751 X:83629314-83629336 CAGAGATTCTTCTTTAAGCTTGG + Intergenic
1194530064 X:95036103-95036125 CAAAGCTTCCCCATTAACTTGGG - Intergenic
1196247950 X:113422948-113422970 AAAAGCTTCTTCCTTAATTTCGG + Intergenic
1196395197 X:115253548-115253570 CAGATCTTCCTCTTTTTTTCTGG - Intergenic
1197369120 X:125604151-125604173 CCTAGCTTCCTGTTTATTTTTGG + Intergenic
1199150196 X:144423334-144423356 CAGAGCTTACTCTTCAAATTAGG + Intergenic
1199405315 X:147451498-147451520 TAGATTTTGCTCTTTAATTTAGG - Intergenic
1199737463 X:150696964-150696986 AAGACCTTCCTCTTTACTTTGGG - Intronic
1199745323 X:150768815-150768837 CAGAGCTGGCTCTTGAATTTCGG + Exonic
1202267555 Y:23036730-23036752 CACAACTTCATCTTTCATTTGGG - Intergenic
1202420547 Y:24670474-24670496 CACAACTTCATCTTTCATTTGGG - Intergenic
1202450239 Y:24999608-24999630 CACAACTTCATCTTTCATTTGGG + Intergenic