ID: 1022198215

View in Genome Browser
Species Human (GRCh38)
Location 7:28090378-28090400
Sequence AGGCAGTTATTGAAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022198215 Original CRISPR AGGCAGTTATTGAAGAAACT GGG (reversed) Intronic
901075630 1:6553245-6553267 AGGAAGTTCTGGAAGAGACTTGG - Intronic
901483918 1:9544850-9544872 AGGCTGTTGTTGAAGACAGTTGG + Intronic
906233717 1:44189179-44189201 ATTTATTTATTGAAGAAACTGGG + Intergenic
906950122 1:50327947-50327969 GTGTATTTATTGAAGAAACTGGG - Intergenic
907639722 1:56175310-56175332 TGGCAGTAAAGGAAGAAACTGGG + Intergenic
907776516 1:57521394-57521416 AGGCAGTTGCTGATGAATCTTGG + Intronic
908016517 1:59843865-59843887 AGGCAGTGATTGCTGAAACCTGG + Intronic
908122497 1:60999483-60999505 AGGCAGTTATTAAACATACAAGG + Intronic
908673666 1:66577060-66577082 AGGTAGTTATTCAAGACACTGGG - Intronic
909468321 1:75999659-75999681 AGGAAGTTATTGGAGAATCCAGG - Intergenic
910315547 1:85878635-85878657 TGGCAGTTTTTTAAGAAGCTAGG - Intronic
912767779 1:112431478-112431500 AGGCATTTATAGAATGAACTGGG + Intronic
912910750 1:113757211-113757233 AGCCAGTGATTGAATAAAATGGG + Intronic
913414610 1:118591009-118591031 AGGGAATTATTGAAGAAAGAAGG - Intergenic
916346727 1:163800531-163800553 ATTGACTTATTGAAGAAACTAGG + Intergenic
919610964 1:199745135-199745157 AGGGAGTTATTGAGGCATCTAGG - Intergenic
920032859 1:203048029-203048051 TGGCAGGTATTGAAGTACCTGGG + Intronic
921499833 1:215888295-215888317 AGGCATTCACTGGAGAAACTGGG - Intronic
922930697 1:229386875-229386897 AATAAGTAATTGAAGAAACTGGG - Intergenic
1065065592 10:21960352-21960374 AGGCAGTAATTGAAGAATTCGGG + Intronic
1065653329 10:27917524-27917546 AGGCAGATATTAATGAAACAGGG + Intronic
1066105489 10:32152817-32152839 ATGTAGTTATTGAAGGAAATTGG - Intergenic
1066781961 10:38960266-38960288 AGACAGTCTTTGAACAAACTGGG + Intergenic
1068686901 10:59879862-59879884 AGGCACATATTGAACAAGCTTGG - Intronic
1068720172 10:60236477-60236499 ATTTATTTATTGAAGAAACTGGG + Intronic
1070048663 10:72865168-72865190 AGGCAGAAATTGAAAAAACAGGG + Intronic
1072396200 10:95044749-95044771 AAGGAGTTATGGAGGAAACTTGG + Intronic
1074010336 10:109472401-109472423 AGGCATTTATTGAAGACCATTGG + Intergenic
1074426634 10:113357267-113357289 AGCCAGTTATTGAAGATCCAGGG + Intergenic
1074497151 10:113990129-113990151 ATGCAGTTATTTAAAAAGCTTGG - Intergenic
1074934995 10:118169561-118169583 ATCCAGGTATTGAAGAAAATAGG + Intergenic
1076350098 10:129809765-129809787 AGGCAGCTATTGAACAGAGTGGG + Intergenic
1077869466 11:6249960-6249982 AGGCAGTAATTGCAGTAACCAGG + Intergenic
1079158107 11:17967704-17967726 AGGGAGCTACTGAACAAACTAGG - Intronic
1080416226 11:32072401-32072423 AGACAGTTCCTGAAGACACTGGG + Intronic
1090279965 11:125447332-125447354 ATGCATTTGTTGGAGAAACTAGG - Intronic
1090486432 11:127116477-127116499 AGGCAATTAGAGAAGAAAATAGG - Intergenic
1093138693 12:15481280-15481302 AGGCAGTTATTCCAGACACATGG - Intronic
1094434233 12:30403267-30403289 AGCCAGTGATTGAAACAACTAGG - Intergenic
1095546615 12:43378909-43378931 AGGCATTTATTCAATAAACATGG + Intronic
1097009532 12:55942320-55942342 AGGCACTTAGAGAAGAAACTAGG + Intronic
1098262768 12:68687407-68687429 AGCCAGTCAGTGAAGATACTGGG + Intronic
1102627327 12:114245546-114245568 AGGCAGTCATTAAAGAAATGAGG + Intergenic
1102673908 12:114643505-114643527 AGGCAGTAAATGAATAAATTAGG + Intergenic
1104832472 12:131763083-131763105 AGGCAGTTGTTGATGAAAAGTGG + Intronic
1110107865 13:71701593-71701615 AGGTAGTTAAGGAAGTAACTAGG + Intronic
1111060621 13:83014106-83014128 AGTCAGTTATAGAAAGAACTTGG + Intergenic
1113241178 13:108339078-108339100 AAAGAGCTATTGAAGAAACTAGG + Intergenic
1113355431 13:109575513-109575535 ATGCAGTTAGTGAATAAACAGGG + Intergenic
1118083026 14:62383486-62383508 AGGCAATGATTGCAGAAAATAGG + Intergenic
1119728845 14:76938459-76938481 AGGCAGTCAATGAAGAGCCTTGG - Intergenic
1120977539 14:90262450-90262472 AGACAGTTTTTGAAGTAACTTGG + Intronic
1121056083 14:90854829-90854851 AGGTATTTTTTGAAGTAACTAGG - Exonic
1123394512 15:19917584-19917606 AGACAGTCTTTGAACAAACTGGG + Intergenic
1125775811 15:42212627-42212649 ATGCAGTTTCTGAAGAAAGTAGG - Intronic
1126177038 15:45745523-45745545 AGGCAGTTAGTGAGAAAACTGGG - Intergenic
1126854355 15:52823557-52823579 TGGAAGTTATGGAAGGAACTGGG + Intergenic
1127759622 15:62125823-62125845 AGGCAGCAATTAAATAAACTTGG - Intergenic
1127981750 15:64040385-64040407 GGGCAGTTCTTGAAGAACCAAGG - Intronic
1128202319 15:65819742-65819764 GGGCAAGTAATGAAGAAACTGGG - Intronic
1128329005 15:66743520-66743542 AGCCAGTTAGTGAAGGAGCTGGG + Intronic
1129338403 15:74868342-74868364 AGGCACTTAATAAAGAACCTTGG + Intronic
1131964951 15:97832181-97832203 ACTTAGTTAATGAAGAAACTGGG + Intergenic
1132000197 15:98171257-98171279 ACGCAGATATTTAAGAAAGTTGG + Intergenic
1135568396 16:23529643-23529665 AGGCAGTCATTGAATGCACTAGG + Intronic
1136700541 16:32135700-32135722 AGACAGTCTTTGAACAAACTGGG + Intergenic
1136767115 16:32791765-32791787 AGACAGTCTTTGAACAAACTGGG - Intergenic
1136801033 16:33078936-33078958 AGACAGTCTTTGAACAAACTGGG + Intergenic
1136936869 16:34477015-34477037 AGACAGTCTTTGAACAAACTAGG - Intergenic
1136947805 16:34676067-34676089 AGACAGTCTTTGAACAAACTGGG + Intergenic
1136962950 16:34871555-34871577 AGACAGTCTTTGAACAAACTAGG + Intergenic
1136967048 16:34925760-34925782 AGACAGTCTTTGAACAAACTGGG + Intergenic
1137087649 16:36147869-36147891 AGACAGTCTTTGAACAAACTGGG + Intergenic
1137092094 16:36206042-36206064 AGACAGTCTTTGAACAAACTGGG + Intergenic
1137221742 16:46459577-46459599 AGACAGTCTTTGAACAAACTGGG - Intergenic
1139723420 16:68875902-68875924 AGGCAGATATTAAATAAACAAGG + Intronic
1140034809 16:71364056-71364078 ACGCTGTTAGTGAAAAAACTGGG - Intronic
1140431030 16:74903394-74903416 AATGAGTTATTTAAGAAACTAGG + Intronic
1140579766 16:76215928-76215950 AGGCAATTCTTGAAGAAACTGGG + Intergenic
1203069513 16_KI270728v1_random:1054011-1054033 AGACAGTCTTTGAACAAACTGGG - Intergenic
1142841248 17:2632474-2632496 TGGTATTTATTGAAGAAACTGGG + Intronic
1144856753 17:18273196-18273218 TGCTAGTTGTTGAAGAAACTAGG - Intronic
1145179050 17:20728890-20728912 AATGATTTATTGAAGAAACTGGG + Intergenic
1145320286 17:21763147-21763169 ATTTATTTATTGAAGAAACTGGG - Intergenic
1145689385 17:26721585-26721607 AGACAGTCTTTGAACAAACTGGG + Intergenic
1145711223 17:26980707-26980729 AGACAGTCTTTGAACAAACTGGG + Intergenic
1146643295 17:34557114-34557136 AGGCAGTATTTGCAGAAGCTGGG + Intergenic
1146777474 17:35634207-35634229 TGCCAGGTATTGAAGAAACTAGG + Intronic
1147501797 17:40972576-40972598 AGGCTGTTCTGGAAGAGACTCGG + Intergenic
1149838716 17:59938497-59938519 TGTGATTTATTGAAGAAACTGGG + Intronic
1150357522 17:64499834-64499856 AGATAGTTATTTAAGAAACATGG - Exonic
1203182644 17_KI270729v1_random:77550-77572 AGACAGTCTTTGAACAAACTGGG + Intergenic
1203190582 17_KI270729v1_random:183047-183069 AGACAGTCTTTGAACAAACTGGG + Intergenic
1154197773 18:12278966-12278988 AGCCAGTTCTTGGAGAAGCTGGG + Intergenic
1155751410 18:29427093-29427115 AGGAATTTGTTGAATAAACTTGG - Intergenic
1158543381 18:58376391-58376413 AGGCAGTAATTCAACAAACTGGG - Intronic
1158860447 18:61586669-61586691 AGGAAGCTATAGAAGAAACTGGG + Intergenic
1161966741 19:7553181-7553203 AGGCTGTTAGTGGAGAAACTGGG + Intronic
1162216608 19:9139848-9139870 AGGCAGTTGGGGAAGAAAATGGG + Intergenic
1164929331 19:32163428-32163450 AGACACTTATTAAATAAACTAGG + Intergenic
1165697403 19:37911348-37911370 AGCCATTAATTGAAAAAACTGGG - Intronic
1166594931 19:44037789-44037811 AGGCAGTAATGGAGGAAATTAGG + Intergenic
925014404 2:510822-510844 ACACAGTTCTTGAAGAAACAAGG - Intergenic
925653095 2:6113354-6113376 CGGCATGTATTGAAGAAACTGGG + Intergenic
925662814 2:6221018-6221040 AGGAAGATGTTTAAGAAACTGGG - Intergenic
926339552 2:11893900-11893922 AGACAATTATTTCAGAAACTTGG + Intergenic
926365462 2:12129199-12129221 CATCAGTTATTGAAGAAACTGGG - Intergenic
927074658 2:19565758-19565780 AGACAGTTTTTGCAGAAACCAGG - Intergenic
928508665 2:31981265-31981287 GGGCAGTCATTGAGGAAACCAGG - Intronic
929279093 2:40058801-40058823 ATGCAGTTATTGCAGAAAATTGG + Intergenic
930470489 2:51806107-51806129 AGGAAATTGTTGAAGAATCTAGG + Intergenic
931336989 2:61355675-61355697 AGGCAGTAATGGAAGAAATGAGG + Intronic
931948959 2:67339860-67339882 AGGCATTTATGGGAGAAAATAGG - Intergenic
933137613 2:78757875-78757897 AGGCAGTAATTGGAGAAGCCAGG - Intergenic
935285122 2:101557624-101557646 ATATACTTATTGAAGAAACTAGG + Intergenic
937480881 2:122257861-122257883 GGTCAGTTAGTTAAGAAACTGGG + Intergenic
939022252 2:136972378-136972400 AGGCAGTAAGTAAAGAAACAAGG + Intronic
941375542 2:164724502-164724524 ACTCATTTATTGAAGAAACTAGG - Intronic
942117484 2:172742349-172742371 ATACATTTCTTGAAGAAACTGGG + Intronic
942555633 2:177169853-177169875 AGGCAGTCATTGAACAGACGTGG + Intergenic
942891555 2:180995590-180995612 ATTTATTTATTGAAGAAACTGGG + Intronic
943024520 2:182611109-182611131 AGGGAGATAGAGAAGAAACTGGG - Intergenic
943035762 2:182744092-182744114 AGGCAGTTAATGAAGAAGTCTGG - Intronic
944631715 2:201633322-201633344 AGGCAGTTATTCAAAAACCTCGG - Exonic
945316134 2:208372603-208372625 AGGGAGTGGTTGAATAAACTAGG + Intronic
947401365 2:229734525-229734547 AGGCATTTATTCAAGAAAACTGG + Intergenic
947504494 2:230696737-230696759 AGTCAGATATTGAAGAAAACTGG + Intergenic
1170368367 20:15621069-15621091 AGGCAGTTCCTGAGGATACTTGG + Intronic
1171113817 20:22507472-22507494 AGTGAGTTGTTGATGAAACTGGG - Intergenic
1171296800 20:24024133-24024155 ATGCAGTGATTGAAGAAATATGG + Intergenic
1177224620 21:18237982-18238004 ATGCAGTCATAGAAAAAACTGGG + Intronic
1178163192 21:29942012-29942034 AGTCAGCTTTTGAACAAACTGGG + Intergenic
1178844110 21:36160257-36160279 AGGCAGTTATTTCAGAAAAAGGG + Intronic
1180061950 21:45390180-45390202 AGGCAGTTCTTGGAGAATCCTGG - Intergenic
1182517507 22:30867373-30867395 AGGCAGGGTTTGAAGAAAGTTGG - Intronic
1182797440 22:33001006-33001028 AGGAAGTTCGTGAAGAATCTAGG + Intronic
1184056662 22:42056098-42056120 AGGCAGTAATGGAAGAAATGTGG - Intronic
1184094113 22:42307308-42307330 AGGCAGGGAATGAAGGAACTTGG - Intronic
1184571492 22:45327860-45327882 AGGCAGTCCTGGAAGAAGCTGGG - Exonic
1203325818 22_KI270738v1_random:15897-15919 AGACAGTCTTTGAACAAACTAGG - Intergenic
950956632 3:17060321-17060343 AGGCATATATTTAAGAAACCTGG + Intronic
951295958 3:20934824-20934846 ATGCTGGTATTGAAGAAACGTGG + Intergenic
952571009 3:34716434-34716456 AGGCAGTTGTTAAAGACATTTGG - Intergenic
952792968 3:37214916-37214938 AGGCATTGATGGAAGACACTTGG - Intergenic
953796326 3:45988877-45988899 GGGCAGGTATAGAAAAAACTTGG - Intronic
954822560 3:53343451-53343473 AGGCACTGATTGTAGAAAGTAGG - Intronic
955484295 3:59420092-59420114 AGGCAGTTCTGGAACCAACTGGG - Intergenic
956449623 3:69360606-69360628 ATTCATTTGTTGAAGAAACTAGG + Intronic
956490016 3:69760775-69760797 AGGCAGTTTTTGAGGTAACCAGG + Intronic
956538968 3:70312867-70312889 TGGCAGGGATGGAAGAAACTTGG - Intergenic
956956980 3:74352489-74352511 TGGAAGTTATTCAACAAACTGGG - Intronic
958020014 3:87983255-87983277 AGGCAGTGATTTAAAAAAATAGG + Intergenic
958158355 3:89785201-89785223 TGGCTATTACTGAAGAAACTGGG - Intergenic
958468738 3:94491849-94491871 AGGCAATTATCAAAGAAATTTGG - Intergenic
962063618 3:131955837-131955859 AAGCAGTGATTGAGGAAAATAGG - Intronic
963211985 3:142703052-142703074 AAGCCTTTATTGAAGAAAGTGGG + Intronic
964091036 3:152875680-152875702 AAGCAGTTATGGAAAAAAGTTGG + Intergenic
964727785 3:159832660-159832682 CTGCAGTATTTGAAGAAACTAGG + Intronic
965669498 3:171132079-171132101 AGGCAGTTGGAGCAGAAACTTGG - Intronic
966570044 3:181431028-181431050 GGGCAGTTGTAGAAAAAACTTGG + Intergenic
966871301 3:184291931-184291953 GGGCAGTTTTGGAAGGAACTTGG + Intronic
967415709 3:189215913-189215935 AGGCAGTTATTGAAGCAATAAGG - Intronic
967777576 3:193400201-193400223 AAGCAGTAATTGAAGGAACAGGG - Intergenic
968679522 4:1907290-1907312 AAGCAGCTATAGAAGAAACCAGG - Intronic
972159508 4:36206048-36206070 AGGCAGGTGTTGCAGAAAGTTGG - Intronic
972758008 4:42070393-42070415 AGGAAGTAATTAAAGAAATTAGG + Intronic
975372198 4:73602214-73602236 GGGCAGCTATTGAAGATTCTAGG + Intronic
975487199 4:74947332-74947354 ATTCATTTATTGAAGAAACCTGG - Intronic
976403403 4:84634751-84634773 GGGCAGTTACTGAAGTAAGTAGG + Intronic
978328125 4:107581541-107581563 AGGCTGTTTTTTCAGAAACTAGG - Intergenic
979671544 4:123364992-123365014 AGGTAGTTGCTGAAGAAATTAGG + Intergenic
982068132 4:151672631-151672653 AGGGAATTATTGATGAAACTGGG + Intronic
983250400 4:165338681-165338703 GTGCAGTCATTGAAGATACTTGG + Exonic
984567654 4:181349854-181349876 AGGAAGTTTTTGAAGAAAGAAGG - Intergenic
984918817 4:184746210-184746232 AGGAAGTTATATAAGAAAGTGGG - Intergenic
986618607 5:9646073-9646095 AGTCATTTAGTGAAGTAACTAGG + Intronic
986949764 5:13069143-13069165 TGGCAGATATTTAAGAAAATCGG + Intergenic
996513094 5:124339492-124339514 AGAGAGTTATGGAAGAAACCAGG + Intergenic
996522970 5:124447971-124447993 AGGCATTCATTCAAGAAACCAGG + Intergenic
997904001 5:137796190-137796212 AGTCAATTATTGCAGAAACTTGG - Intergenic
998391731 5:141791280-141791302 AGGGAGGTAGTGAAGAAAGTGGG - Intergenic
999085220 5:148882326-148882348 ATGCAATTATGGCAGAAACTAGG + Intergenic
999923801 5:156352829-156352851 AGTCAGTGAATGATGAAACTGGG + Intronic
1001112864 5:168912712-168912734 ATGCATTTTATGAAGAAACTAGG + Intronic
1003519214 6:6843285-6843307 AGGCAGTTTTTGAAGAGATCCGG - Intergenic
1003533993 6:6960098-6960120 TGGCTGTTTTTGAAGAAACTAGG - Intergenic
1004678386 6:17866754-17866776 AGGGAGGTATTGAAGAAAATGGG + Intronic
1005533484 6:26732000-26732022 AGTTAGTTGTTGAAGGAACTGGG - Intergenic
1005535166 6:26747673-26747695 AGTTAGTTGTTGAAGGAACTGGG + Intergenic
1005537310 6:26769652-26769674 AGTTAGTTGTTGAAGGAACTGGG + Intergenic
1006955520 6:37867157-37867179 AAGCATTATTTGAAGAAACTTGG + Intronic
1010998925 6:82564912-82564934 AGACAGTCTTTGAACAAACTGGG + Intergenic
1011484542 6:87828539-87828561 AGGCAGTTAGTGAGGAAACAGGG - Intergenic
1013524693 6:110963356-110963378 GAGGAGTTTTTGAAGAAACTTGG + Intronic
1014973243 6:127845388-127845410 AAGCATTTATTGAAGAAAAATGG + Intronic
1015386819 6:132634113-132634135 TGTCAGTTATTTGAGAAACTGGG - Intergenic
1021407320 7:20287089-20287111 AGGCAGTTCTTGAAAGACCTCGG - Intergenic
1021905711 7:25331093-25331115 AGCCAGTTTTTGAAGAAAGTTGG + Intergenic
1022198215 7:28090378-28090400 AGGCAGTTATTGAAGAAACTGGG - Intronic
1023271524 7:38468768-38468790 AGCCAGTGAATGAAGAAACTTGG + Intronic
1023915370 7:44584574-44584596 ATTTACTTATTGAAGAAACTGGG + Intergenic
1024315798 7:48015510-48015532 AGGCAGTTACTGGAGGAACTAGG + Intronic
1024787324 7:52923107-52923129 AGGCAGTGATGGAAGGAATTAGG + Intergenic
1024883924 7:54120243-54120265 AACCAGATATTGAAGAACCTTGG - Intergenic
1025306019 7:57856670-57856692 AGACAGTCTTTGAACAAACTGGG - Intergenic
1025477752 7:60947467-60947489 AGACAGTCTTTGAACAAACTGGG + Intergenic
1025483171 7:61011736-61011758 AGACAGTTTTTGGACAAACTAGG + Intergenic
1025489340 7:61093055-61093077 AGACAGTCTTTGAATAAACTGGG - Intergenic
1025554363 7:62286191-62286213 AGACAGTCTTTGAACAAACTGGG - Intergenic
1025560418 7:62367083-62367105 AGACAGTCTTTGAACAAACTGGG + Intergenic
1025564481 7:62416099-62416121 AGACAGTCTTTGAACAAACTGGG + Intergenic
1026331758 7:69358252-69358274 GGGCAGTTTATGCAGAAACTAGG + Intergenic
1026615600 7:71900559-71900581 AGGCAGTTAGTGAAGGAATGGGG + Intronic
1027537037 7:79416140-79416162 AACCAGTTATTGAACAAATTAGG - Intronic
1027982035 7:85236982-85237004 AAAAAGTTATTGAAGAAACTGGG - Intergenic
1030365580 7:108642056-108642078 AGGCAGTTATTAAATGAAATGGG - Intergenic
1030651281 7:112118855-112118877 GGGTGGTTATTGAAGAAACTGGG - Intronic
1031284810 7:119854073-119854095 ACACAGTTGTTGAAAAAACTGGG + Intergenic
1031940655 7:127785317-127785339 AAGCAGTTATTAAAAAATCTTGG - Intronic
1032468817 7:132163624-132163646 AGGCAGTTGTTGAAGGAACGTGG - Intronic
1037281112 8:17243529-17243551 AACCAGTTCTTCAAGAAACTTGG - Intronic
1037283387 8:17269772-17269794 AGGCAGTAAACCAAGAAACTAGG - Intronic
1038348662 8:26756357-26756379 ATTTACTTATTGAAGAAACTGGG + Intronic
1038620551 8:29138747-29138769 ATTCATTTATTGTAGAAACTGGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041507013 8:58610371-58610393 AGGCAATTACTGAAATAACTGGG + Intronic
1041707272 8:60859848-60859870 ATGCAATTATTGAAAAAAATAGG + Intronic
1042390836 8:68231795-68231817 AGGCCATTATTGAAGAAACCTGG + Exonic
1042565635 8:70106952-70106974 AGCCTGATATGGAAGAAACTGGG - Intergenic
1043981027 8:86639624-86639646 AGGTAATTATTGCAAAAACTTGG + Intronic
1044175034 8:89109372-89109394 AGGCAGTTATAGAAGAAATATGG + Intergenic
1045482486 8:102603204-102603226 AGGCAGTTCTAGAGGAGACTTGG + Intergenic
1045549335 8:103156307-103156329 AGGCAGTTTTTAAAGTATCTTGG + Intronic
1047827840 8:128596924-128596946 AGACAGTTATTTAAGATATTGGG + Intergenic
1048482977 8:134818522-134818544 TGGCAGTTTAAGAAGAAACTAGG + Intergenic
1048682989 8:136867164-136867186 AGGCAATATTTGAGGAAACTGGG - Intergenic
1048961102 8:139578615-139578637 AGGCTGATATTGAAAATACTAGG - Intergenic
1050176066 9:2870539-2870561 AGGCAGTTATTGATGACTATGGG - Intergenic
1050585479 9:7106932-7106954 AGGCAGTGCTTGAAAAAAATAGG + Intergenic
1052398897 9:27975914-27975936 AGGCAGTTCTTAATCAAACTTGG + Intronic
1056905408 9:90643037-90643059 AGGCAGAGATTGAAGAGAGTAGG - Exonic
1057442665 9:95093158-95093180 AGGAAGTGACTGCAGAAACTTGG + Intergenic
1057858101 9:98617816-98617838 AGGCAGTGATGGAAGAATCATGG + Intronic
1058412127 9:104745736-104745758 ATGCAGTTAATGATGAGACTAGG + Intergenic
1058514733 9:105758872-105758894 AGGAAGATGTTGAAGAAATTTGG + Intronic
1059219452 9:112599684-112599706 AGGCAGTTGTAGAAGACACATGG - Intronic
1059340951 9:113597268-113597290 AGCCAGTTCTTTAAGGAACTTGG - Exonic
1061803371 9:133125014-133125036 ATGTATTTGTTGAAGAAACTGGG - Intronic
1186332389 X:8548460-8548482 AGGAAGTTCTTGAAAACACTTGG - Intronic
1186472256 X:9830885-9830907 GGACAGTTATCTAAGAAACTAGG - Intronic
1186662644 X:11684651-11684673 CTTCAGTTATTGAGGAAACTGGG + Intergenic
1188285911 X:28325190-28325212 AGGGAGTTATTGAAGAAAGGTGG - Intergenic
1189216547 X:39330058-39330080 AGGCAGTGACTGAAGACACCAGG + Intergenic
1193392284 X:80942880-80942902 ATGTATTTATTGAAGAAACTAGG + Intergenic
1194045577 X:88997651-88997673 AGACAATTATTAAAGAAAGTAGG - Intergenic
1195478552 X:105316470-105316492 AAACAGTTATTGATGAAACCAGG + Intronic
1195776086 X:108407595-108407617 AGGCAATCTTTGCAGAAACTTGG + Intronic
1196959995 X:120990993-120991015 AGGCAGTCATTGGACAACCTGGG - Intergenic
1197293872 X:124693218-124693240 AGTCAGTTTTTGAAGGTACTTGG + Intronic
1198528038 X:137521890-137521912 AGTTAGTTACTGATGAAACTAGG - Intergenic
1199373950 X:147084990-147085012 AGGCAGTCATTTAAAACACTAGG - Intergenic
1201603779 Y:15762654-15762676 AGGCAGTTGTTGGTGACACTAGG + Intergenic
1202046404 Y:20740568-20740590 AACCAGTTATTTAAAAAACTGGG - Intergenic