ID: 1022199868

View in Genome Browser
Species Human (GRCh38)
Location 7:28106035-28106057
Sequence TCCAATCCAAGCACATGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 712}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022199868 Original CRISPR TCCAATCCAAGCACATGTGG AGG Intronic
901349012 1:8575649-8575671 TCTAATCCCAGCACTTTTGGAGG - Intronic
901408525 1:9066722-9066744 TACAATCCAAGCACTTTGGGAGG + Intronic
901594973 1:10377680-10377702 TGTAATCCAAGCACTTGGGGAGG + Exonic
901962295 1:12837207-12837229 TACAATCCAAGCACTTTGGGAGG + Intergenic
902099617 1:13975195-13975217 TTCGATCCAAATACATGTGGAGG - Intergenic
903206184 1:21784118-21784140 TCCAATCCCAGCACTTTGGGAGG + Intergenic
903905607 1:26683966-26683988 TCCAATCCCAGCACTTTGGGAGG + Intergenic
904155666 1:28480942-28480964 TGTAATCCCAGCACTTGTGGAGG - Intronic
904192752 1:28760066-28760088 TCCAATCGAACAAGATGTGGTGG - Intronic
905568444 1:38984786-38984808 TCCAATCCCAGCACTTTGGGAGG - Intergenic
905813931 1:40933328-40933350 TGCAATCCTAGCACTTGGGGAGG - Intergenic
906189968 1:43892197-43892219 TCCAATCCCAGCACTTTGGGAGG - Intronic
907153461 1:52310223-52310245 TGCAATCCAAGCACTTTGGGAGG - Intronic
907426385 1:54381935-54381957 TGCAATCCAAGCACTTTGGGAGG + Intronic
907432225 1:54419652-54419674 TGTAATCCCAGCACTTGTGGAGG + Intergenic
908064362 1:60386519-60386541 TCCAATCCACGCATATGTTCAGG + Intergenic
908204831 1:61835658-61835680 TGCAATCCCAGCACATTAGGAGG - Intronic
909071316 1:70996916-70996938 TGCAATCCCAGCACTTTTGGAGG - Intronic
909645751 1:77915055-77915077 TGCAATCCTAGCACTTCTGGAGG + Intronic
910776943 1:90886382-90886404 TCCAATCCCAGCACTTTGGGAGG + Intergenic
911960710 1:104298654-104298676 TGCAATCCCAGCACATTGGGAGG + Intergenic
912268296 1:108182574-108182596 TGCAATCCCAGCACTTTTGGAGG + Intronic
915183251 1:154081723-154081745 TACAATCCCAGCACATTGGGAGG + Intronic
915291546 1:154887582-154887604 TCCAATCCCAGCACTTTGGGAGG + Intergenic
915338815 1:155165116-155165138 TGCAATCCCAGCACTTGGGGAGG - Intergenic
916089191 1:161293983-161294005 TCCAATCCTAGCACTTTGGGAGG + Intergenic
916276528 1:163000121-163000143 CCCAAACCAAGCACATTTGCAGG - Intergenic
916476334 1:165172876-165172898 ACCAATACAAGCAAATTTGGAGG - Intergenic
916671903 1:167029502-167029524 TGCAATCCCAGCACCTGGGGAGG - Intergenic
916775094 1:167953853-167953875 TGCAATCCCAGCACTTTTGGAGG - Intronic
916943307 1:169699019-169699041 TCTAATCCCAGCACTTTTGGAGG - Intronic
917097933 1:171418124-171418146 TTTAATCCCAGCACATTTGGAGG - Intergenic
917255427 1:173110754-173110776 TCCCATCCAAGGAGGTGTGGAGG + Intergenic
917747375 1:178023925-178023947 TATAATCCAAGCACCTTTGGAGG + Intergenic
917854100 1:179087751-179087773 TCAAATCCAAGCTCTTGGGGAGG - Intronic
918058407 1:181042455-181042477 TCTAATCCCAGCACTTTTGGAGG - Intronic
918272690 1:182918526-182918548 TCCAATCCATGAACATGGGATGG - Intronic
918721554 1:187858510-187858532 TATAATCCCAGCACATTTGGAGG - Intergenic
918935295 1:190913873-190913895 TCTAATCCCAGCACTTTTGGAGG + Intergenic
919627364 1:199924697-199924719 TGCAATCCCAGCACTTTTGGAGG + Intergenic
919817366 1:201449949-201449971 TGTAATCCCAGCACATTTGGAGG - Intergenic
920545897 1:206818018-206818040 TGCAATCCCAGCACTTTTGGAGG - Intronic
921042255 1:211444525-211444547 TCCAATCCATGAACATGGGGTGG - Intergenic
921100149 1:211921808-211921830 TGCAATCCCAGCACTTTTGGAGG + Intergenic
921241953 1:213193882-213193904 TCCAATCCCAGCACATTTGGAGG - Intronic
921754625 1:218840345-218840367 TGTAATCCTAGCACTTGTGGAGG + Intergenic
922166300 1:223118288-223118310 TGCAATCCCAGCACTTTTGGAGG + Intronic
922519628 1:226237689-226237711 TCTAATCCAAGCACTTTGGGAGG + Intronic
922650604 1:227334821-227334843 TGTAATCCCAGCACTTGTGGGGG + Intergenic
923036299 1:230287343-230287365 TGCAATCCCAGCACTTGAGGAGG + Intergenic
923549658 1:234953279-234953301 TGTAATCCAAGCACTTGGGGAGG - Intergenic
923774011 1:236962074-236962096 TGCAATCCCAGCACTTTTGGAGG + Intergenic
924505295 1:244677656-244677678 TGTAATCCCAGCACTTGTGGAGG + Intronic
924549451 1:245061847-245061869 TGCAATCCCAGCACTTGGGGAGG + Intronic
1063159142 10:3407207-3407229 TCCAACCCAAGCACCTGTGCAGG + Intergenic
1063647698 10:7902165-7902187 TCCAATCCCAGCACTTTGGGAGG + Intronic
1064147734 10:12838920-12838942 TGCAATCCCAGCACTTGGGGAGG - Intergenic
1064322659 10:14320214-14320236 TCCAATCCAAGAACCTGGAGAGG + Intronic
1064416080 10:15151311-15151333 TACAATCCTAGCACTTTTGGGGG - Intronic
1064635014 10:17356642-17356664 TGCAATCCAAGCACTTTGGGAGG - Intronic
1064797825 10:19033512-19033534 TGCAATCCCAGCACATTGGGAGG + Intergenic
1064995170 10:21290413-21290435 TACAAGCCAAGCACATGCAGAGG + Intergenic
1065152550 10:22837103-22837125 TCTAATCCAAGCACTTTGGGAGG + Intergenic
1065644162 10:27817004-27817026 TGTAATCCAAGCACTTTTGGAGG - Intronic
1065650256 10:27881389-27881411 TACAATCCCAGCACATTGGGAGG + Intronic
1065714944 10:28557437-28557459 TATAATCCTAGCACATGGGGAGG + Intronic
1068145594 10:53066364-53066386 TCCAATCCCAGCACTTTGGGAGG - Intergenic
1068349863 10:55829434-55829456 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1069010270 10:63364263-63364285 TCCAATCCCAGCACTTTGGGAGG - Intronic
1069383797 10:67865941-67865963 TGTAATCCCAGCACATTTGGAGG - Intergenic
1069472642 10:68706562-68706584 TGCAATCCCAGCACATTGGGAGG + Intergenic
1070124042 10:73605919-73605941 TGTAATCCCAGCACTTGTGGAGG + Intronic
1070729523 10:78816299-78816321 ACCAATACAACCACACGTGGTGG + Intergenic
1071990811 10:91099257-91099279 TGTAATCCAAGCACATTGGGAGG + Intergenic
1072948021 10:99827977-99827999 TCCATTCCAGGCAGGTGTGGAGG - Intronic
1073707332 10:105999788-105999810 TACAATCCTAGCACTTTTGGAGG - Intergenic
1074779509 10:116790945-116790967 TCTAATCCCAGCACATTGGGAGG - Intergenic
1076547660 10:131256627-131256649 TCTAATCCCAGCACTTGGGGAGG + Intronic
1077095854 11:798711-798733 TGCAATCCCAGCACTTTTGGAGG + Exonic
1077177108 11:1196008-1196030 TCCAATCGATGCAGATGTCGTGG - Intronic
1077235085 11:1478102-1478124 TCCAGTGGAAGCACATGTGTGGG - Intronic
1077525508 11:3061928-3061950 TCCAATCCCAGCACTTTGGGAGG - Intergenic
1078010571 11:7570132-7570154 GCCAAGCCAAGCAGGTGTGGAGG - Intronic
1078957790 11:16221481-16221503 GCCAATAAAAGCACAAGTGGTGG - Intronic
1080447184 11:32348107-32348129 TGTAATCCCAGCACATCTGGAGG - Intergenic
1080467872 11:32514884-32514906 TCTAATCCCAGCACTTGGGGAGG - Intergenic
1080764186 11:35280417-35280439 TGTAATCCCAGCACTTGTGGAGG - Intronic
1080875927 11:36274213-36274235 TCCAATCCCAGAACACATGGAGG - Exonic
1081135415 11:39434271-39434293 TCCAATCCATGCTCAAGGGGAGG - Intergenic
1081901717 11:46634352-46634374 TCCAATCCCAGCACTTTGGGAGG - Intronic
1081940574 11:46937791-46937813 TGTAATCCAAGCACTTTTGGAGG - Intronic
1082012344 11:47458656-47458678 TGTAATCCCAGCACATGGGGAGG - Intergenic
1082978382 11:59097928-59097950 TGTAATCCTAGCACATTTGGAGG - Intergenic
1083587671 11:63872320-63872342 TGCACTCCAAGCACTTGTGAGGG - Intronic
1083693046 11:64423176-64423198 TGTAATCCCAGCACATTTGGAGG + Intergenic
1083790679 11:64983395-64983417 TCAAATCCAAGCACTTTGGGAGG - Intergenic
1084237954 11:67800259-67800281 TCTAATCCCAGCACATTGGGAGG + Intergenic
1084624571 11:70296421-70296443 TGCAATCCCAGCACCTCTGGAGG + Intronic
1085167587 11:74417006-74417028 TGCAATCCCAGCACATTGGGAGG + Intergenic
1085239375 11:75039891-75039913 AACAATCCAAACCCATGTGGTGG - Intergenic
1085596050 11:77811011-77811033 TGCAATCCAAGCACTTTCGGAGG - Intronic
1085602034 11:77863643-77863665 TACAATCCCAGCACATTGGGAGG - Intronic
1086100851 11:83098273-83098295 TCTAATCCCAGCACTTTTGGAGG - Intergenic
1087367075 11:97233494-97233516 TCTAATCCAAGCACTTTGGGAGG - Intergenic
1087406677 11:97739745-97739767 TGCAATCCCAGCACTTGGGGAGG - Intergenic
1087694089 11:101355859-101355881 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1087870695 11:103289502-103289524 TGTAATCCCAGCACATTTGGAGG + Intronic
1087937734 11:104054869-104054891 TACAAACCAAGCACAGGTGGAGG + Intronic
1087974286 11:104525374-104525396 TCCAATCTAGTCACATTTGGAGG - Intergenic
1088272175 11:108045017-108045039 TGTAATCCAAGCACTTGGGGAGG - Intronic
1088472072 11:110197154-110197176 TGTAATCCCAGCACATTTGGAGG - Intronic
1089421865 11:118338129-118338151 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1090009859 11:123036559-123036581 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1090063765 11:123486289-123486311 TGCAATCCCAGCACTTGGGGAGG + Intergenic
1090936011 11:131343132-131343154 TCAAGTCTAAGCACTTGTGGTGG + Intergenic
1091153680 11:133353414-133353436 TGTAATCCAAGCACATTAGGAGG - Intronic
1091514749 12:1167968-1167990 TGCAATCCCAGCACTTGGGGAGG - Intronic
1093333049 12:17866516-17866538 TCCAATCCCAGCACTTTGGGAGG - Intergenic
1093526044 12:20104255-20104277 TGCAATCCAAGCACTTTGGGAGG - Intergenic
1094565203 12:31592195-31592217 TGTAATCCTAGCACATTTGGGGG - Intergenic
1096281759 12:50261306-50261328 TCTAATCCCAGCACTTGGGGAGG - Intronic
1096349472 12:50883745-50883767 TGCAATCCAAGCACTTTAGGAGG + Intronic
1096762837 12:53857096-53857118 TCTAATCCCAGCACTTTTGGAGG - Intergenic
1097091110 12:56506053-56506075 TATAATCCAAGCACTTTTGGAGG + Intergenic
1097992628 12:65852238-65852260 TACAATCCCAGCACCTGGGGAGG + Intronic
1098878007 12:75887117-75887139 TCCAATGCAGGGAAATGTGGTGG + Intergenic
1098978730 12:76931902-76931924 TCCACTCCAGGCACCTGTGTTGG + Intergenic
1100237476 12:92675017-92675039 TCCAATCCAAACTCAAGCGGAGG - Intergenic
1100769937 12:97910560-97910582 TACAATCCCAGCACTTTTGGAGG - Intergenic
1101288498 12:103341400-103341422 TCCAATACATGCACAATTGGAGG + Intronic
1101518032 12:105455114-105455136 TCCAGTCCACACACAAGTGGAGG + Intergenic
1101573110 12:105973383-105973405 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1101857512 12:108456293-108456315 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1102115594 12:110400787-110400809 TGCAATCCAAGCACTTTGGGAGG + Intronic
1102362283 12:112298581-112298603 GCCAATCCAAGCACTTTGGGAGG - Intronic
1102479512 12:113211807-113211829 TGCAATCCAAGCACTTTGGGAGG + Intronic
1102700812 12:114837772-114837794 TGTAATCCCAGCACATTTGGAGG - Intergenic
1102931992 12:116869429-116869451 TCCAAGCCACTCACATGTAGAGG + Intronic
1103531889 12:121608173-121608195 TATAATCCCAGCACATTTGGAGG - Intergenic
1103675873 12:122655377-122655399 TGTAATCCCAGCACTTGTGGAGG + Intergenic
1103816707 12:123663860-123663882 TGTAATCCCAGCACTTGTGGAGG - Intergenic
1104076826 12:125397225-125397247 TCTAATCCCAGCACTTCTGGAGG - Intronic
1104236950 12:126948093-126948115 TGCAATCCCAGCACTTCTGGAGG - Intergenic
1104345571 12:127993632-127993654 TGTAATCCTAGCACATTTGGAGG - Intergenic
1104440285 12:128788446-128788468 TCTAATCCCAGCACTTGGGGAGG + Intergenic
1104835202 12:131785707-131785729 TCCTTTCCAGGCACATGAGGAGG + Intronic
1105029999 12:132875383-132875405 TGCAATCCCAGCACTTGGGGAGG + Intronic
1106233830 13:27844674-27844696 CCCAATCCCAGCACTTGGGGAGG + Intergenic
1107002505 13:35566104-35566126 TCTAATCCCAGCACTTTTGGAGG + Intronic
1107504967 13:41024631-41024653 TGTAATCCAAGCACATTGGGAGG - Intronic
1108088940 13:46825349-46825371 CCCAATCCAATCAGCTGTGGTGG - Intergenic
1109099539 13:58163351-58163373 TGTAATCCCAGCACATTTGGAGG + Intergenic
1109418644 13:62079295-62079317 TGTAATCCAAGCACTTTTGGAGG + Intergenic
1109493410 13:63133396-63133418 TGTAATCCAAGCACATTAGGAGG - Intergenic
1109611324 13:64768342-64768364 TCCAATCCCAGCACTTTGGGAGG - Intergenic
1110746759 13:79062993-79063015 TGTAATCCCAGCACATGGGGAGG - Intergenic
1110766328 13:79283639-79283661 TATAATCCAAGCACATTGGGAGG + Intergenic
1111157059 13:84341349-84341371 TCTAATCCCAGCACATCGGGAGG - Intergenic
1111176671 13:84605061-84605083 TGTAATCCCAGCACATTTGGAGG - Intergenic
1111532545 13:89558024-89558046 TGCAATCCCAGCACTTTTGGGGG + Intergenic
1111575275 13:90145212-90145234 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1112460981 13:99603746-99603768 TATAATCCCAGCACATTTGGAGG - Intergenic
1112871071 13:103971415-103971437 TCTAATCCTAGCACTTTTGGAGG - Intergenic
1113328771 13:109308899-109308921 TCTAATCCAAGCACTTTGGGAGG - Intergenic
1113706489 13:112436711-112436733 GCCCATCCTAGTACATGTGGGGG - Intergenic
1114049531 14:18911888-18911910 TCCAATGGGAGCAGATGTGGAGG + Intergenic
1114113032 14:19490043-19490065 TCCAATGGGAGCAGATGTGGAGG - Intergenic
1114509923 14:23250221-23250243 TCTAATCCCAGCACTTTTGGAGG + Intronic
1115576885 14:34719950-34719972 TGTAATCCAAGCACTTGGGGAGG - Intergenic
1116122248 14:40735911-40735933 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1116834808 14:49759788-49759810 TCCAATCAAAAGACATGTTGTGG - Intergenic
1117259522 14:54016904-54016926 TCCAATCCTAGCACTTTGGGAGG + Intergenic
1118564085 14:67119871-67119893 TCTAATCCAAGCACTTTGGGAGG + Intronic
1118897176 14:69954727-69954749 TCCAATCAAACAACATTTGGGGG + Intronic
1119561981 14:75597824-75597846 TGCAATCCCAGCACATTGGGAGG - Intronic
1119588586 14:75862682-75862704 TGCAATCCAAGCACTTTGGGAGG + Intronic
1119663747 14:76469349-76469371 TGCAATCCCAGCACTTGGGGAGG - Intronic
1120195964 14:81482420-81482442 TGCAATCCCAGCACTTTTGGAGG + Intronic
1120812053 14:88813648-88813670 TACAATCCCAGCACATTAGGAGG + Intergenic
1121065030 14:90954668-90954690 TGCAATCCCAGCACTTGGGGAGG - Intronic
1121090318 14:91176856-91176878 TGCAATCCAAGCACTTTGGGAGG - Intronic
1122160146 14:99777674-99777696 TCTAATCCCAGCACTTTTGGAGG - Intronic
1124506130 15:30275873-30275895 TGTAATCCAAGCACTTGGGGAGG + Intergenic
1124713805 15:32038623-32038645 TCCAATCCTAGCACTTTAGGAGG - Intronic
1124737423 15:32262759-32262781 TGTAATCCAAGCACTTGGGGAGG - Intergenic
1124793412 15:32751668-32751690 TCCAATCCAAGGAGTTTTGGAGG - Intergenic
1125808805 15:42518673-42518695 TGCAATCCCAGCACTTCTGGAGG - Intronic
1125854581 15:42936683-42936705 TCTAATCCAAGCACTTTGGGAGG - Intergenic
1125909876 15:43426754-43426776 TCCAATCCCAGCACTTTGGGAGG + Intronic
1126144878 15:45464944-45464966 TGCAATCCCAGCACATTGGGAGG + Intergenic
1126487110 15:49193980-49194002 TGTAATCCCAGCACATTTGGAGG - Intronic
1126498197 15:49316037-49316059 TCCCATCCAAGCACATTTTAGGG - Intronic
1126870867 15:52985599-52985621 TCCCATCTAACAACATGTGGTGG - Intergenic
1127036595 15:54925090-54925112 TGCAATCCCAGCACATTGGGAGG - Intergenic
1127802271 15:62487574-62487596 TATAATCCAAGCACTTTTGGTGG + Intronic
1127950925 15:63805688-63805710 TACAATCCCAGCACTTTTGGAGG + Intronic
1128015865 15:64346133-64346155 TACAATCCCAGCACTTTTGGAGG + Intronic
1128540331 15:68523967-68523989 TACAATCCAAGCACTTTGGGAGG + Intergenic
1128719472 15:69936768-69936790 TCCAATCCAATGACATGTAATGG + Intergenic
1129809767 15:78500104-78500126 TGTAATCCCAGCACTTGTGGAGG - Exonic
1130000860 15:80045398-80045420 TCTAATCCAAGCACTTTGGGAGG + Intergenic
1130858538 15:87864273-87864295 TCCAATTCTATCAGATGTGGAGG - Intronic
1131805094 15:96113833-96113855 TGCAATCCAAGCACATTGGAAGG - Intergenic
1131953208 15:97704170-97704192 TCCTATCCAAGCCAATGGGGTGG - Intergenic
1133005841 16:2881441-2881463 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1133447504 16:5874686-5874708 TGTAATCCAAGCACTTGGGGAGG + Intergenic
1133747867 16:8701188-8701210 TACAATCCAAGCACTTTGGGAGG - Intronic
1133780257 16:8933287-8933309 TATAATCCCAGCACTTGTGGGGG + Intronic
1134745817 16:16587506-16587528 TCTAATCCCAGCACATTGGGAGG - Intergenic
1134775915 16:16853387-16853409 TGCAATCCTAGCACTTGGGGAGG + Intergenic
1135073088 16:19369555-19369577 TCTAATCCCAGCACATCGGGAGG - Intergenic
1135173185 16:20204584-20204606 TGTAATCCCAGCACTTGTGGAGG + Intergenic
1135294036 16:21263996-21264018 TCCAAACCAAACACATCTGCTGG + Intronic
1135391100 16:22094028-22094050 TGCAATCCCAGCACATTGGGAGG - Intronic
1135394933 16:22123916-22123938 TGCAATCCCAGCACTTGGGGAGG + Intronic
1135571587 16:23553498-23553520 TCTAATCCCAGCACTTTTGGAGG + Intronic
1136079967 16:27845490-27845512 TCTAATCCTAGCACTTGGGGAGG - Intronic
1136083998 16:27871383-27871405 TGTAATCCAAGCACTTGAGGAGG + Intronic
1136108621 16:28050420-28050442 TCCAATCCCAGCCCTTCTGGAGG - Intronic
1136126810 16:28189200-28189222 TCTAATCCCAGCACTTTTGGAGG - Intronic
1136143231 16:28300578-28300600 TGCAATCCAAGCACTTTGGGAGG - Intronic
1136193346 16:28632359-28632381 TGTAATCCCAGCACATTTGGAGG - Intergenic
1136680540 16:31959464-31959486 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1136780881 16:32901010-32901032 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1137567162 16:49540535-49540557 TGGAATCCAAGCACATGGGGAGG - Intronic
1138651026 16:58461693-58461715 TGTAATCCCAGCACATTTGGGGG - Intergenic
1138947226 16:61865959-61865981 TCTAATCCCAGCACTTTTGGAGG + Intronic
1139790091 16:69426981-69427003 TGCAATCCCAGCACTTTTGGAGG + Intronic
1139871413 16:70111641-70111663 TCTAATCCCAGCACATTGGGAGG + Intergenic
1139945227 16:70636515-70636537 TACAATCCCAGCACTTGGGGAGG + Intronic
1139970589 16:70771835-70771857 TCTAATCCCAGCACTTGGGGAGG - Intronic
1140162817 16:72516720-72516742 TATAATCCCAGCACATTTGGAGG + Intergenic
1140235730 16:73156966-73156988 TGCAATCCAAGCACTTTGGGAGG - Intergenic
1140252517 16:73306577-73306599 TCCAATCCCAGCACTTTCGGAGG - Intergenic
1140364520 16:74370848-74370870 TCTAATCCCAGCACATTGGGAGG - Intergenic
1140498116 16:75407849-75407871 TGCAATCCAAGCACTTTGGGAGG + Intronic
1141634270 16:85305404-85305426 TGCAATCCAAGCACTTTGGGAGG - Intergenic
1142324783 16:89407562-89407584 TGCAATCCAAGCACTTTGGGAGG + Intronic
1142407876 16:89901252-89901274 TTCGATCCACGCACATGTGGCGG + Intronic
1203083533 16_KI270728v1_random:1165039-1165061 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1142816085 17:2426876-2426898 TGCAATCCCAGCACTTTTGGAGG + Intronic
1142816192 17:2427855-2427877 TGCAATCCCAGCACTTGGGGAGG + Intronic
1142846097 17:2677998-2678020 TGCAATCCCAGCACTTTTGGAGG + Intronic
1143049347 17:4110967-4110989 TCCAATCCCAGCACTTTGGGAGG - Intronic
1143138719 17:4727904-4727926 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1143528978 17:7490032-7490054 TGCAATCCCAGCACTTGGGGAGG - Intronic
1143549781 17:7623134-7623156 TGCAATCCCAGCACTTTTGGAGG + Intronic
1143710227 17:8729308-8729330 TCTAATCCAAGCACTTTGGGAGG + Intergenic
1144479386 17:15616424-15616446 TGTAATCCCAGCACATTTGGAGG - Intronic
1144650045 17:17001756-17001778 TGCAATCCCAGCACTTGGGGAGG + Intergenic
1144744469 17:17604465-17604487 CCCAAAACAAGCACATATGGGGG + Intergenic
1144801822 17:17934186-17934208 TCCAATCCCAGCACTTTAGGAGG + Intronic
1144918918 17:18747302-18747324 TGTAATCCCAGCACATTTGGAGG + Intronic
1145189585 17:20827333-20827355 TCTAATCCCAGCACTTGGGGAGG - Intergenic
1145811717 17:27768305-27768327 TGCAATCCAAGCACTTTAGGAGG - Intronic
1146042361 17:29468391-29468413 TACAATCCAAGCACTTTGGGAGG - Intronic
1146240016 17:31212250-31212272 TCCAATGGGAGCAGATGTGGAGG - Intronic
1146396953 17:32475847-32475869 TACAATCCCAGCACTTTTGGAGG - Intronic
1146833842 17:36093965-36093987 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1147114973 17:38292335-38292357 TCTAATCCCAGCACTTTTGGAGG - Intergenic
1147281673 17:39367137-39367159 TACAATCCCAGCACTTTTGGAGG - Intronic
1147476641 17:40718148-40718170 TGCAATCCAAGCACTTTGGGAGG + Intergenic
1147589490 17:41672672-41672694 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1148095355 17:45049179-45049201 TCTAATCCCAGCACTTTTGGAGG + Intronic
1148179177 17:45591277-45591299 TGTAATCCAAGCACATTGGGAGG + Intergenic
1148414644 17:47496875-47496897 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1148517089 17:48229889-48229911 TCCTATCCAAGCACAAGATGAGG - Intronic
1148589709 17:48806772-48806794 TGCAATCCAAGCACTTTGGGAGG + Intronic
1148616672 17:49005803-49005825 TGCAATCCTAGCACTTCTGGAGG + Intronic
1148787943 17:50154780-50154802 GGGTATCCAAGCACATGTGGGGG + Intergenic
1149757955 17:59203600-59203622 TGTAATCCGAGCACTTGTGGAGG + Intronic
1149836452 17:59917370-59917392 TCCAATCCCAGCACTTTGGGTGG - Intronic
1149939635 17:60850012-60850034 TCTAATCCCAGCACTTTTGGAGG - Intronic
1150598499 17:66628769-66628791 TCTAATCCCAGCACTTGGGGAGG + Intronic
1150653383 17:67024270-67024292 ACAAAACCAAGCACATGTGTAGG + Intronic
1150750887 17:67861570-67861592 TGTAATCCCAGCACATTTGGAGG - Intronic
1150767021 17:68010377-68010399 TCTAATCCAAGCACATTGGGAGG + Intergenic
1151024124 17:70657500-70657522 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1151193396 17:72414842-72414864 TGCAATCCCAGCACTTGGGGAGG - Intergenic
1151781257 17:76247405-76247427 TGTAATCCAAGCACATTGGGAGG - Intergenic
1153388640 18:4529820-4529842 TCCAATCAAAAGACATGGGGTGG - Intergenic
1155544364 18:26900312-26900334 TATAATCCCAGCACATTTGGAGG - Intergenic
1156297968 18:35809710-35809732 TCCAATGCAAGCATATGTTATGG - Intergenic
1156339448 18:36198129-36198151 TGCAATCCTAGCACTTGGGGAGG + Intronic
1158139733 18:54242938-54242960 CCTCTTCCAAGCACATGTGGTGG + Intergenic
1158418356 18:57270174-57270196 TCAAGTTCAAGCACATGAGGAGG - Intergenic
1158851883 18:61503016-61503038 TCCAAGCCAAGGACATGGGAGGG + Exonic
1158995796 18:62917946-62917968 TGTAATCCCAGCACATGGGGAGG + Intronic
1159136001 18:64337615-64337637 TGTAATCCAAGCACTTTTGGAGG - Intergenic
1159605339 18:70468961-70468983 TGCAAGCCAAGCTCTTGTGGAGG + Intergenic
1159775132 18:72595978-72596000 TCCAATCAAAAGACATGTAGTGG - Intronic
1159875572 18:73806992-73807014 CCCAATCCCAGCACTTGGGGAGG - Intergenic
1160868139 19:1265195-1265217 GACCAGCCAAGCACATGTGGCGG - Intronic
1161082959 19:2320547-2320569 TGTAATCCCAGCACATGGGGAGG + Intronic
1161132149 19:2597000-2597022 TGCAATCCCAGCACTTTTGGAGG + Intronic
1161286845 19:3472722-3472744 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1161354682 19:3812334-3812356 TCTAATCCCAGCACTTTTGGAGG - Intronic
1161378547 19:3952294-3952316 TGCAATCCAAGAACATTGGGAGG - Intergenic
1161402394 19:4073135-4073157 TACAATCCCAGCACATTGGGAGG - Intergenic
1161667091 19:5583825-5583847 TCGAATCCCAGCACTTCTGGAGG - Intergenic
1161818447 19:6515024-6515046 TGTAATCCAAGCACTTTTGGAGG - Intergenic
1161864419 19:6823379-6823401 TGCAATCCCAGCACTTTTGGAGG - Intronic
1162125303 19:8496466-8496488 TGTAATCCCAGCACTTGTGGAGG + Intronic
1162146456 19:8615111-8615133 TACAATCCCAGCACATTGGGAGG - Intergenic
1162292008 19:9787018-9787040 TATAATCCCAGCACATTTGGAGG + Intronic
1162512949 19:11130845-11130867 TGCAATCCCAGCACGTGGGGAGG - Intronic
1162591452 19:11595018-11595040 TCCAATCCTAGCACTTTGGGAGG - Intronic
1163085257 19:14974957-14974979 TACAATCCCAGCACTTTTGGAGG - Intronic
1163207918 19:15817295-15817317 TGCAATCCAAGCACTTTGGGAGG - Intergenic
1163344109 19:16729007-16729029 TGCAATCCCAGCACATTGGGAGG + Intronic
1163464468 19:17459015-17459037 TGCAATCCCAGCACTTTTGGAGG - Intronic
1163780238 19:19242876-19242898 TGCAATCCCAGCACTTTTGGAGG + Intronic
1164174617 19:22760039-22760061 TGCAATCCCAGCACTTTTGGAGG + Intronic
1164263387 19:23589751-23589773 TGTAATCCCAGCACTTGTGGAGG - Intronic
1164949926 19:32328574-32328596 TGCAATCCCAGCACATTGGGAGG + Intergenic
1165043839 19:33088605-33088627 TGCAATCCCAGCACTTTTGGAGG - Intronic
1165613240 19:37175294-37175316 TCTAATCCCAGCACTTGGGGAGG + Intronic
1166809122 19:45505354-45505376 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1167078596 19:47264270-47264292 TCTAATCCAAGCACTTTGGGAGG - Intronic
1167227079 19:48252752-48252774 TACAATCCTAGCACTTTTGGAGG - Intronic
1167538177 19:50068748-50068770 TGTAATCCCAGCACATGGGGAGG - Intergenic
1167591860 19:50408637-50408659 TGCAATCCCAGCACATTGGGAGG - Intronic
1167728574 19:51235900-51235922 TGCAATCCCAGCACCTTTGGAGG + Intronic
1167830508 19:52017445-52017467 TGCAATCCCAGCACTTGGGGAGG + Intronic
1167848135 19:52181403-52181425 TGTAATCCAAGCACATTGGGAGG - Intergenic
1168032026 19:53687953-53687975 TCTAATCCCAGCACATCAGGAGG - Intergenic
1168033388 19:53699485-53699507 TCTAATCCCAGCACATTAGGAGG - Intergenic
1168035493 19:53716073-53716095 TCTAATCCTAGCACATTAGGGGG - Intergenic
1168043763 19:53779367-53779389 TGTAATCCCAGCACATTTGGAGG - Intergenic
1168229141 19:55017812-55017834 TCCAATCCCAGCACTTTGGGAGG + Intronic
1168468829 19:56624963-56624985 TGCAACCCAAGCTGATGTGGAGG + Exonic
1168560824 19:57381623-57381645 TCTAATCCAAGCACTTTGGGAGG - Intronic
1168584612 19:57582900-57582922 TGTAATCCAAGCACATTGGGAGG - Intronic
1168603686 19:57740897-57740919 TCTAATCCCAGCACTTTTGGAGG - Intronic
925345125 2:3166693-3166715 TGCAATCCAAGCACTTTGGGAGG + Intergenic
925642210 2:5996583-5996605 TATAATCCCAGCACTTGTGGAGG + Intergenic
926227192 2:10975707-10975729 TCCAATCCCAGCACTTTGGGAGG + Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
927563169 2:24088132-24088154 TCTAATCCCAGCACTTTTGGAGG - Intronic
927669067 2:25053646-25053668 TGCAATCCAAGCACTTTGGGAGG + Intronic
927762533 2:25772474-25772496 TCCAATCCCAGCACTTTGGGAGG + Intronic
928157038 2:28886293-28886315 TGCAATCCCAGCACATTGGGAGG + Intergenic
928560818 2:32483171-32483193 TGTAATCCAAGCACTTTTGGAGG - Intronic
928659081 2:33482268-33482290 TCTAATCCAAGCACTTTGGGAGG - Intronic
928659730 2:33489791-33489813 TGTAATCCCAGCACATGGGGAGG - Intronic
929136651 2:38630457-38630479 TACAATCCAAGCACTTTTGGAGG - Intergenic
929270549 2:39966651-39966673 TCTAATCCTAGCACTTGGGGAGG + Intergenic
929480504 2:42302788-42302810 TGTAATCCCAGCACATTTGGAGG - Intronic
929513677 2:42586326-42586348 TGTAATCCAAGCACTTTTGGAGG + Intronic
929908727 2:46070385-46070407 TGTAATCCCAGCACTTGTGGAGG + Intronic
930053287 2:47233641-47233663 TGCAATCCCAGCACATTGGGAGG - Intergenic
930097245 2:47574593-47574615 TCCAATCCCAGCACTTTGGGAGG + Intergenic
930650076 2:53955663-53955685 TGCAATCCAAGCACTTTCGGAGG + Intronic
931315246 2:61124441-61124463 TGCAATCCCAGCACTTTTGGAGG + Intronic
931327989 2:61247928-61247950 TGTAATCCAAGCACTTGAGGAGG + Intronic
932035968 2:68247207-68247229 TACAATCCAAGCACTTTGGGAGG - Intronic
932605317 2:73161751-73161773 TGTAATCCTAGCACTTGTGGAGG + Intergenic
933172952 2:79143701-79143723 TCCAATCCCAGCACTTTGGGAGG - Intergenic
933267583 2:80198924-80198946 TATAATCCCAGCACATTTGGAGG + Intronic
933466077 2:82654107-82654129 TACAATCCAAGCACTTTAGGCGG - Intergenic
934934872 2:98458073-98458095 TGCAATCCAAGCACTTTCGGAGG - Intronic
935336566 2:102022269-102022291 TGCATTCCACGCACCTGTGGGGG + Intronic
936236451 2:110746574-110746596 TCCATTCGACGTACATGTGGAGG - Intronic
936446432 2:112599174-112599196 TGCAATCCCAGCACATTGGGAGG - Intergenic
936544426 2:113378573-113378595 TGCAATCCCAGCACATTGGGAGG - Intergenic
936731934 2:115393054-115393076 TCTAATCCCAGCACATTGGGAGG + Intronic
937406586 2:121635083-121635105 TCCAATCCCAGCACTTTAGGAGG + Intronic
937417597 2:121729103-121729125 TACAATCCCAGCACTTGGGGAGG + Intronic
937635765 2:124153867-124153889 TCTAATCCCAGCACTTTTGGAGG - Intronic
937799515 2:126065264-126065286 TGCAATCCCAGCACTTTTGGAGG - Intergenic
937960698 2:127455692-127455714 TGTAATCCCAGCACTTGTGGAGG - Intronic
938426883 2:131200221-131200243 TCCAATGGGAGCAGATGTGGAGG + Intronic
938670458 2:133581573-133581595 TCCAATCCAAACACATGATTGGG - Intergenic
938769022 2:134483885-134483907 TCCAATCCCAGCACTTTGGGAGG + Intronic
938876716 2:135538868-135538890 TGTAATCCAAGCACATTGGGAGG - Intronic
939305463 2:140404426-140404448 TGCAATCCCAGCACATTGGGAGG - Intronic
939531146 2:143363282-143363304 TCTAATCCCAGCACTTTTGGAGG + Intronic
940127108 2:150338879-150338901 TCCAATCCCAGCACTTTGGGAGG - Intergenic
940146812 2:150553691-150553713 TCCAATCCCAGCACTTTGGGAGG - Intergenic
941573481 2:167200867-167200889 TGCAACCCCAGCACATGGGGAGG + Intronic
941632100 2:167895717-167895739 TCTAATCCAAGCACTTTGGGAGG - Intergenic
941675645 2:168340982-168341004 TCTAATCCAAGCACTTTGGGAGG - Intergenic
941741659 2:169042062-169042084 TGCAATCCCAGCACTTGGGGAGG + Intergenic
943059772 2:183029563-183029585 TGCAATCCCAGCACTTGCGGAGG + Intronic
943365524 2:186963923-186963945 TCTAATCCCAGCACATTGGGAGG - Intergenic
943392318 2:187285162-187285184 TCCAATCCCAGCACTTTGGGAGG + Intergenic
943451310 2:188045465-188045487 TCTAATCCAAGCACTTTGGGAGG + Intergenic
944346028 2:198666736-198666758 TCCAATCCCAGCACTTTGGGAGG + Intergenic
944925318 2:204458255-204458277 TGCAATCCAAGCACTTTGGGAGG - Intergenic
945967880 2:216208172-216208194 TGTAATCCAAGCACTTGGGGAGG - Intergenic
946274435 2:218620134-218620156 TCTAATCCCAGCACTTTTGGAGG - Intronic
946970682 2:225087600-225087622 TGTAATCCAAGCACATTGGGAGG + Intergenic
947128226 2:226894525-226894547 TGCAATCCAAGCACTTTGGGAGG - Intronic
947363077 2:229365690-229365712 TGCAATCCCAGCACATTGGGAGG - Intronic
947769106 2:232656691-232656713 TCCAATCCCAGCACTTTGGGAGG - Intronic
947771958 2:232677114-232677136 TGCAATCCCAGCACATTGGGAGG + Intronic
947813327 2:233019247-233019269 TGCAATCCTAGCACTTTTGGAGG + Intergenic
948509468 2:238453950-238453972 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1169123031 20:3108687-3108709 TGCAATCCAAGCACTTTGGGAGG + Exonic
1169610692 20:7376902-7376924 TCAAATTCCAGGACATGTGGAGG + Intergenic
1170211219 20:13847944-13847966 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1170989174 20:21286485-21286507 TCTAATCCCAGCACTTGGGGAGG + Intergenic
1171463549 20:25312435-25312457 TGCAATCCCGGCACCTGTGGAGG - Intronic
1171480025 20:25447728-25447750 TGTAATCCCAGCACATGGGGAGG - Exonic
1172134388 20:32677196-32677218 TCTAATCCAAGCACTTTGGGAGG - Intergenic
1172249930 20:33471993-33472015 TAAAATCCAGGCAGATGTGGTGG - Intergenic
1172469082 20:35177686-35177708 TCTAATCCCAGCACTTGGGGAGG - Intergenic
1173244939 20:41330302-41330324 TCTAATCCCAGCTCATGGGGAGG - Intergenic
1173817558 20:45999426-45999448 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1174214299 20:48904279-48904301 TGTAATCCCAGCACATGGGGAGG + Intergenic
1174221121 20:48956401-48956423 TCCAATCCCAGCACTTTGGGAGG + Intronic
1174706157 20:52658238-52658260 TGCAATCCCAGCACATTGGGAGG - Intergenic
1175020354 20:55840880-55840902 TCCAATCCATGAACATGAGATGG - Intergenic
1175548888 20:59802772-59802794 TCCAACTCCAGCAAATGTGGTGG - Intronic
1176267135 20:64215849-64215871 TATAATCCAAGCACTTTTGGAGG - Intronic
1176744597 21:10640252-10640274 TCCAGACACAGCACATGTGGAGG + Intergenic
1176922410 21:14704068-14704090 TGCAATCCCAGCACATTGGGAGG - Intergenic
1177383727 21:20380878-20380900 TCTAATCCCAGCACATTGGGAGG + Intergenic
1177447583 21:21217828-21217850 TTCAATGCTAGCAGATGTGGTGG - Intronic
1177523203 21:22257548-22257570 TGCAATCCCAGCACATTGGGAGG - Intergenic
1177604865 21:23364993-23365015 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1177837941 21:26206001-26206023 TACAATCCCAGCACTTTTGGAGG + Intergenic
1177858545 21:26426266-26426288 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1178776686 21:35558348-35558370 TGTAATCCCAGCACTTGTGGAGG + Intronic
1179125724 21:38588985-38589007 TCTAATCCAAGCACTTTGGGAGG - Intronic
1179138742 21:38703436-38703458 TGTAATCCAAGCACTTTTGGAGG + Intergenic
1179238753 21:39569864-39569886 TGCAATCCAAGCACTTGGGGAGG + Intronic
1179238842 21:39570705-39570727 TGCAATCCAAGCACTTGGGGAGG - Intronic
1179304669 21:40143533-40143555 TCTAATCCCAGCACTTTTGGAGG + Intronic
1179651991 21:42817201-42817223 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1180468012 22:15634263-15634285 TCCAATGGGAGCAGATGTGGAGG + Intergenic
1181183028 22:21080523-21080545 TCCAATCCAAGCACTTTGGGAGG - Intergenic
1181384704 22:22535722-22535744 TGCAATCCAAGCACTTTGGGAGG + Intergenic
1181613195 22:24033418-24033440 TGTAATCCCAGCACTTGTGGAGG - Intronic
1181730691 22:24844277-24844299 TGTAATCCAAGCACTTTTGGAGG + Intronic
1181749530 22:24979270-24979292 TCTAATCCCAGCACATTGGGAGG - Intronic
1182178760 22:28322084-28322106 TGTAATCCCAGCACCTGTGGAGG - Intronic
1182527751 22:30932104-30932126 TCAACTCCTAGCACCTGTGGTGG + Intronic
1182535147 22:30995674-30995696 TCCTAATCAAGCAAATGTGGAGG + Intergenic
1183119720 22:35721000-35721022 TCTAATCCCAGCACATTGGGAGG - Intronic
1183202886 22:36398077-36398099 TCTAATCCAAGCACTTTTGGAGG - Intergenic
1184244121 22:43227319-43227341 TCCCATCCAAGCCCAGGTGCAGG + Intronic
1184456615 22:44614450-44614472 TTCAAACCAAGCACATTGGGAGG + Intergenic
1184613173 22:45618960-45618982 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1184938516 22:47742351-47742373 TCTAATCCCAGCACTTTTGGAGG + Intergenic
949725731 3:7042165-7042187 TCCAATCCAAGGAGTTGTAGGGG + Intronic
949729628 3:7093421-7093443 TGCAATCCAAGCACTTTGGGAGG + Intronic
949850783 3:8418168-8418190 TATAATCCAAGCACATTGGGAGG - Intergenic
950343627 3:12271793-12271815 TACAATCCAAGCACTTTGGGAGG - Intergenic
952205779 3:31180805-31180827 TACAATCCCAGCACTTGGGGAGG + Intergenic
952306298 3:32149689-32149711 TGTAATCCCAGCACTTGTGGAGG + Intronic
953615165 3:44483346-44483368 TGTAATCCCAGCACTTGTGGAGG - Intergenic
953990666 3:47480764-47480786 TATAATCCTAGCACTTGTGGAGG - Intergenic
954015216 3:47683300-47683322 TGCAATCCCAGCACTTTTGGAGG - Intronic
954787888 3:53108306-53108328 TGCAATCCAAGCACTTTGGGAGG - Intronic
955832886 3:63023594-63023616 TGTAATCCAAGCACTTTTGGAGG + Intergenic
956383613 3:68692799-68692821 TGCAATCCAAGCACCTTGGGAGG + Intergenic
956570549 3:70689714-70689736 TGTAATCCAAGCACATTGGGAGG + Intergenic
957744711 3:84324764-84324786 TCTAATCCAAGCACTTTGGGAGG + Intergenic
957788870 3:84915286-84915308 TGTAATCCCAGCACATTTGGAGG + Intergenic
959313340 3:104769782-104769804 TACAATCCCAGCACTTTTGGAGG - Intergenic
959769392 3:110073891-110073913 TGCAATCCCAGCACTTTTGGAGG - Intergenic
960113468 3:113868955-113868977 ACCAATCCAAGCAAGTGTGAGGG - Intronic
960430999 3:117568546-117568568 TGTAATCCCAGCACATTTGGGGG + Intergenic
961211646 3:125130326-125130348 TCTAATCCCAGCACTTTTGGAGG + Intronic
961269555 3:125679031-125679053 ACCAATTGAAGCAGATGTGGTGG - Intergenic
961498885 3:127316337-127316359 TGCAATCCAAGCACTTTGGGAGG - Intergenic
962114177 3:132484810-132484832 TCCAATCCCAGCACTTTGGGAGG + Intronic
962278418 3:134032438-134032460 TCTAATCCCAGCACTTGAGGAGG + Intronic
962644920 3:137428706-137428728 TGCAATCCCAGCACTTTTGGGGG - Intergenic
964741478 3:159970758-159970780 TCCCATCCAAGAACATGTTATGG + Intergenic
964757198 3:160098828-160098850 TCCACTCCCTGCATATGTGGGGG + Intergenic
964863319 3:161226195-161226217 TGTAATCCAAGCACTTGAGGAGG + Intronic
965469698 3:169075662-169075684 GCCAATCTGAGCACATTTGGAGG + Intergenic
966146568 3:176818723-176818745 TGTAATCCCAGCACATGGGGAGG - Intergenic
966215978 3:177502797-177502819 TCTAATCCCAGCACATTAGGAGG - Intergenic
966469624 3:180274575-180274597 TGTAATCCCAGCACATTTGGAGG - Intergenic
966845572 3:184126956-184126978 TGCAATCCCAGCACTTTTGGAGG + Intergenic
966845618 3:184127394-184127416 TGCAATCCCAGCACTTTTGGAGG - Intergenic
967481452 3:189977864-189977886 TCGAATCCAAGCACTTTGGGAGG - Intronic
968416955 4:446633-446655 TGCAATCCCAGCACTTTTGGAGG - Intronic
968680752 4:1917691-1917713 TGTAATCCCAGCACCTGTGGAGG - Intronic
969118202 4:4887682-4887704 GCTAATCCCAGAACATGTGGAGG - Intergenic
969919421 4:10523766-10523788 TGTAATCCCAGCACATTTGGGGG + Intronic
970112276 4:12651576-12651598 TCCCATCCCAGCACATTGGGAGG - Intergenic
970610707 4:17722423-17722445 TCCATTCCAAGCTCATTTGCTGG - Intronic
970957383 4:21830416-21830438 TGCAATCCAAGCACTTTGGGAGG + Intronic
971172306 4:24246365-24246387 TACAATCCCAGCACTTTTGGAGG + Intergenic
972251432 4:37306764-37306786 TGTAATCCCAGCACATTTGGAGG + Intronic
972570950 4:40310027-40310049 TGCAATCCCAGCACATTGGGAGG + Intergenic
972597496 4:40542791-40542813 TGCAATCCCAGCACATAGGGAGG - Intronic
973754347 4:54059268-54059290 TACAATCCCAGCATTTGTGGGGG + Intronic
974081858 4:57222076-57222098 TGCAATCCCAGCACATTGGGAGG - Intergenic
974324356 4:60394598-60394620 TACAATCCCAGCACATTGGGAGG - Intergenic
974816597 4:67012902-67012924 TGTAATCCAAGCACTTTTGGAGG + Intergenic
974873248 4:67670198-67670220 TACAATCCCAGCACTTTTGGAGG - Intronic
974965188 4:68751660-68751682 TGCAATCCAAGCACCTTGGGAGG + Intergenic
975113340 4:70651038-70651060 TGTAATCCCAGCACATGGGGAGG - Intronic
976422398 4:84860952-84860974 TGCAATCCCAGCACTTTTGGAGG + Intronic
977078653 4:92492870-92492892 TCTAATCCCAGCACTTTTGGAGG + Intronic
977287820 4:95130984-95131006 TGTAATCCAAGCACATCGGGAGG - Intronic
978157045 4:105500950-105500972 TGCAATCCCAGCACCTGGGGAGG + Intergenic
979265308 4:118695290-118695312 TCTAATCCCAGCACATTGGGAGG + Intronic
979664214 4:123293180-123293202 CCCAAGCCAAGCTCCTGTGGAGG + Intronic
980113012 4:128652669-128652691 TCTAATCCAAGCACTTTGGGAGG - Intergenic
980917998 4:139052129-139052151 TCCCATCCAAAAACAAGTGGGGG - Intronic
981054758 4:140349409-140349431 TCCAAACAAAGCACATCTGCAGG + Intronic
981421728 4:144558025-144558047 TGCAATCCCAGCACTTTTGGAGG + Intergenic
981556195 4:145997662-145997684 TCCAATCCATGAACATGAGATGG + Intergenic
981828314 4:148970751-148970773 TGCAATCCTAGCACTTTTGGAGG - Intergenic
982008763 4:151087065-151087087 TGCAATCCCAGCACTTTTGGAGG + Intergenic
982414877 4:155118431-155118453 TACAATCCCAGCACTTTTGGAGG - Intergenic
982896271 4:160931828-160931850 TCTAATCCCAGCACTTGGGGAGG + Intergenic
983508629 4:168583874-168583896 TCCAATCCAAACTGAGGTGGTGG + Intronic
983933949 4:173485711-173485733 TGCAATCCCAGCACTTTTGGAGG + Intergenic
984475531 4:180229957-180229979 TGCAATCCCAGCACATTGGGAGG - Intergenic
985136971 4:186795816-186795838 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1202770202 4_GL000008v2_random:197487-197509 TGCAATCCCAGCACTTTTGGAGG - Intergenic
985681202 5:1256861-1256883 TCCACCCCAAGCCCGTGTGGAGG + Intronic
986694878 5:10342767-10342789 TCTAATCCTAGCACTTTTGGAGG - Intergenic
986716500 5:10527866-10527888 TGCAATCCCAGCACTTCTGGAGG - Intergenic
987121441 5:14771662-14771684 TGTAATCCCAGCACTTGTGGAGG + Intronic
987630025 5:20458359-20458381 TCTAATCCAAGCACTTTGGGAGG + Intronic
987806808 5:22780127-22780149 TGCAATCCCAGCACTTTTGGAGG + Intronic
987886000 5:23813464-23813486 TGTAATCCAAGCACTTTTGGAGG - Intergenic
988532452 5:32039361-32039383 TGCAATCCCAGCACCTGGGGAGG - Intronic
988571582 5:32372574-32372596 TACAATCCAAGCACTTTGGGAGG + Intronic
988951727 5:36268964-36268986 TGCAATCCCAGCACTTTTGGAGG - Intronic
989228334 5:39056375-39056397 TACAATCCCAGCACTTTTGGGGG + Intronic
989798404 5:45504039-45504061 TGCAATCCTAGCACTTTTGGAGG - Intronic
990585046 5:57202543-57202565 TGCAATCCTAGCACTTTTGGAGG - Intronic
990760276 5:59121885-59121907 TGCAATCCCAGCACTTTTGGAGG + Intronic
990807098 5:59676420-59676442 TCTTATCCAAGCACATGTTTGGG + Intronic
991053388 5:62296410-62296432 TGTAATCCCAGCACATTTGGAGG + Intergenic
991057647 5:62337233-62337255 TGCAATCCCAGCACATTGGGAGG + Intronic
991343342 5:65636396-65636418 TGCAATCCAAGCACTTTGGGAGG - Intronic
992287103 5:75247196-75247218 TGTAATCCAAGCACATTGGGAGG - Intergenic
992394143 5:76356445-76356467 TGTAATCCCAGCACTTGTGGAGG + Intergenic
992697825 5:79307991-79308013 TGTAATCCCAGCACATTTGGAGG - Intronic
992704555 5:79377220-79377242 TGTAATCCTAGCACATTTGGAGG - Intronic
992799874 5:80286448-80286470 TATAATCCCAGCACATTTGGAGG + Intergenic
995513627 5:112932416-112932438 TCCAATCCCAGCACTTTGGGAGG - Intergenic
996278997 5:121704775-121704797 TCTAATCCCAGCACATTGGGAGG + Intergenic
996581791 5:125039271-125039293 TCCAATGCAATCACATGGAGGGG + Intergenic
996739482 5:126785755-126785777 TGCAATCCCAGCACTTTTGGAGG + Intronic
997316558 5:132941590-132941612 TGTAATCCCAGCACATTTGGAGG - Intronic
997985302 5:138496584-138496606 TGTAATCCAAGCACTTGGGGAGG - Intergenic
998251349 5:140555487-140555509 TGTAATCCCAGCACATGGGGAGG - Intronic
999184664 5:149698018-149698040 TGCAATCCCAGCACTTTTGGAGG + Intergenic
999454015 5:151699718-151699740 TGTAATCCTAGCACATGGGGAGG + Intergenic
999541340 5:152575725-152575747 TGCAATCCCAGCACTTTTGGAGG - Intergenic
999549468 5:152670505-152670527 TGTAATCCCAGCACTTGTGGAGG + Intergenic
999934562 5:156472672-156472694 TCCCATCCAAGCACTTTGGGAGG - Intronic
1001126752 5:169026317-169026339 TGCAATCCAAGCAAATGTGGTGG + Intronic
1001729405 5:173939029-173939051 TACAATCCTAGCACTTGGGGAGG + Intronic
1001860882 5:175054014-175054036 TTCCATCAAAGCAGATGTGGTGG - Intergenic
1002384127 5:178853131-178853153 TGTAATCCCAGCACATTTGGAGG - Intergenic
1002385705 5:178865205-178865227 TCCAATCCAGGCAGATGTCCTGG - Intronic
1002624321 5:180514082-180514104 TGTAATCCCAGCACATTTGGAGG - Intronic
1002757680 6:177699-177721 TGCAATCCCAGCACTTGGGGAGG - Intergenic
1002822130 6:735680-735702 TCCAATCCCAGCACTTTGGGAGG - Intergenic
1002960675 6:1912107-1912129 TCCAATCCCAGCACTTTGGGAGG + Intronic
1003258916 6:4498275-4498297 TTCAACCCCAGCACATGGGGAGG + Intergenic
1003838719 6:10098461-10098483 TGCAATCCCAGCACATTGGGAGG + Intronic
1004358310 6:14949138-14949160 TCTAATCCCAGCACTTGGGGAGG + Intergenic
1004441107 6:15655379-15655401 TCTAATCCCAGCACTTGGGGAGG - Intronic
1004633587 6:17445361-17445383 TACAATCCAAGCACTTTCGGAGG - Intronic
1005579854 6:27223296-27223318 TGTAATCCCAGCACATTTGGAGG - Intergenic
1005588900 6:27304308-27304330 TGTAATCCCAGCACATTTGGAGG - Intronic
1005606294 6:27481264-27481286 TCTAATCCAAGCACTTTGGGAGG + Intergenic
1006353261 6:33537045-33537067 TGTAATCCCAGCACATGGGGAGG - Intergenic
1006477291 6:34264847-34264869 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1007349790 6:41261876-41261898 TCCCATCCAAGCAAATGCTGAGG + Intergenic
1007649388 6:43408756-43408778 TGCAATCCCAGCACTTGGGGAGG + Intergenic
1008331275 6:50247460-50247482 TCTAATCCAAGCACTTTGGGAGG + Intergenic
1008625576 6:53312813-53312835 CCCAACCCAATCACATGTGGTGG + Intronic
1009638718 6:66302346-66302368 TATAATCCCAGCACATTTGGAGG + Intergenic
1009947991 6:70362425-70362447 TGCAATCCCAGCACATTGGGAGG + Intergenic
1011328196 6:86173906-86173928 TCCCATCCAAGCATAGATGGAGG - Intergenic
1011408591 6:87042157-87042179 TACAATCCCAGCACTTTTGGAGG + Intergenic
1011606765 6:89113897-89113919 TGTAATCCCAGCACATTTGGAGG - Intronic
1013878755 6:114867373-114867395 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1014011471 6:116480838-116480860 TGCAATCCCAGCACATTAGGAGG - Intergenic
1014434614 6:121407870-121407892 TGCAATCCCAGCACATTGGGAGG - Intergenic
1014443172 6:121496958-121496980 TCCAATCCTAGCACTTTGGGAGG - Intergenic
1015285339 6:131479825-131479847 TGCAATCCCAGCACATTGGGAGG - Intergenic
1015389544 6:132665586-132665608 TCCAATACAATCACATTTTGAGG + Intergenic
1015890463 6:137965185-137965207 TGCAATCCAAGCACTTTGGGAGG + Intergenic
1016457646 6:144247677-144247699 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1016481508 6:144486774-144486796 TCTAATCCTAGCACATTGGGAGG - Intronic
1016879144 6:148893894-148893916 TCTAATCCGAGCACTTTTGGAGG + Intronic
1017162524 6:151379382-151379404 TCTAATCCTAGCACTTGGGGAGG + Intronic
1017385124 6:153874300-153874322 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1017835030 6:158168839-158168861 TGCAATCCCAGCACATTGGGAGG + Intronic
1018833731 6:167467446-167467468 CCCGATCCAAGCACACGGGGAGG - Intergenic
1019163523 6:170084541-170084563 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1020223892 7:6264353-6264375 TGCAATCCAAGCACTTTGGGAGG + Intronic
1020679654 7:11220862-11220884 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1021557595 7:21937164-21937186 TCCAATCCATGAACATGGGATGG - Intronic
1021943631 7:25704208-25704230 GCCAATCCCAGCACTTTTGGAGG + Intergenic
1021991466 7:26145555-26145577 TCTAATCCCAGCACTTCTGGAGG + Intergenic
1022199868 7:28106035-28106057 TCCAATCCAAGCACATGTGGAGG + Intronic
1022304658 7:29135586-29135608 TCTAATCCAAGCACTTTGGGAGG - Intronic
1022481463 7:30745870-30745892 TGCAATCCCAGCACTTTTGGAGG + Intronic
1022734106 7:33060207-33060229 TGCAATCCCAGCACTTTTGGAGG - Intronic
1022776270 7:33530986-33531008 TGCAATCCTAGCACTTTTGGAGG + Intronic
1024299938 7:47879369-47879391 TGCAATCTCAGCACTTGTGGAGG + Intronic
1025010328 7:55392034-55392056 TGTAATCCCAGCACATTTGGAGG + Intronic
1025296690 7:57780949-57780971 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1026235179 7:68520962-68520984 TGCAATCCCAGCACATTGGGAGG - Intergenic
1026246694 7:68626619-68626641 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1026376835 7:69760289-69760311 TGCAATCCTAGCACATTGGGAGG - Intronic
1026411325 7:70126160-70126182 TGCAATCCCAGCACTTTTGGAGG + Intronic
1026811677 7:73472512-73472534 TACAATCCCAGCACTTGGGGAGG - Intronic
1026966727 7:74444842-74444864 TCCAATCCCAGCACTTTGGGAGG - Intergenic
1027131446 7:75594023-75594045 TCCAATCCCAGCACTTTGGGAGG + Intronic
1027662288 7:81001126-81001148 TCAAATCCAAGAACATTTGTCGG - Intergenic
1028208946 7:88050125-88050147 TGTAATCCAAGCACATTGGGAGG + Intronic
1028548474 7:92029523-92029545 TGTAATCCCAGCACATTTGGAGG + Intronic
1029169645 7:98621570-98621592 TCCAATCATAGTACATGTGGAGG - Intronic
1029455216 7:100666743-100666765 TCTAATCCAAGCACTTTGGGAGG + Intergenic
1031127188 7:117788229-117788251 TGTAATCCAAGCACATTGGGAGG - Intronic
1031816529 7:126444887-126444909 TGCAATCCTAGCACTTTTGGAGG + Intronic
1031826884 7:126576537-126576559 TCTAATCCAAGCACTTTGGGAGG - Intronic
1032134923 7:129267559-129267581 TCTAATCCCAGCACCTTTGGAGG - Intronic
1032713249 7:134481408-134481430 TGTAATCCCAGCACATTTGGAGG + Intergenic
1032758601 7:134916128-134916150 TCCAATGCTAGCACATGGAGTGG + Intronic
1033081140 7:138298557-138298579 TCCAATCCCAGCACTTGGGGAGG + Intergenic
1033096655 7:138438106-138438128 TCCAATCCCAGCACTTTGGGAGG - Intergenic
1033733170 7:144197678-144197700 TGCAATCCCAGCACATTGGGAGG + Intergenic
1034410681 7:150940332-150940354 TCTAATCCCAGCACTTTTGGGGG - Intergenic
1034824125 7:154245376-154245398 TGCAATCCCAGCACTTTTGGAGG + Intronic
1035374184 7:158396481-158396503 TCACATGCATGCACATGTGGAGG + Intronic
1035787678 8:2275135-2275157 TCAAACGCAAGCACATGTGTAGG - Intergenic
1035805132 8:2446581-2446603 TCAAACGCAAGCACATGTGTAGG + Intergenic
1036206315 8:6807883-6807905 TGCAATCCCAGCACATTGGGAGG + Intergenic
1036210656 8:6837890-6837912 TTCAATCCTAGCACTTGGGGAGG - Intergenic
1036987550 8:13553607-13553629 TGCAATCCAAGCACTTTGGGAGG - Intergenic
1037117369 8:15242886-15242908 TGCAATCCAAGCACTTTGGGAGG - Intergenic
1037337264 8:17803565-17803587 TGCAATCCCAGCACTTGGGGAGG + Intergenic
1037427880 8:18776630-18776652 TGCAATCCTAGCACTTGAGGAGG - Intronic
1038393209 8:27224383-27224405 TCCAATCCTAGCACTTTGGGAGG - Intergenic
1038436150 8:27538095-27538117 TCAAATCCAAGCACTTGGGAAGG + Intronic
1038786362 8:30620666-30620688 TGCAATCCCAGCACTTGGGGAGG + Intronic
1039063578 8:33591475-33591497 TCCACTCCAAGCACAGGAGGAGG - Exonic
1039246388 8:35613329-35613351 TCTAATCCCAGCACTTGGGGAGG - Intronic
1039549585 8:38433079-38433101 TGCAATCCCAGCACTTGGGGAGG + Intronic
1039615898 8:38954774-38954796 TCCAATCCCAGCACTTTGGGAGG + Intronic
1040624008 8:49124729-49124751 TCAAATGCAAGCACATGTCTGGG + Intergenic
1040917155 8:52574291-52574313 TGCAATCCCAGCACCTGGGGAGG + Intergenic
1042641066 8:70934983-70935005 TAAAATCCAAACACATATGGAGG - Intergenic
1043155992 8:76779928-76779950 TCTTATCCAAGCACAGTTGGAGG - Intronic
1043460174 8:80451845-80451867 TCTAATCCTAGCACATTGGGAGG - Intergenic
1043558327 8:81460254-81460276 TCCAATCCCAGCACTTTGGGAGG - Intronic
1044651223 8:94497752-94497774 TCTAATCCCAGCACTTTTGGGGG + Intronic
1045406927 8:101875825-101875847 TTCAATTCCAGGACATGTGGAGG - Intronic
1046196943 8:110877751-110877773 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1047045349 8:121046886-121046908 TGCAATCCCAGCACTTGGGGAGG + Intergenic
1048646943 8:136431699-136431721 TCCAATCAAAGGACATAAGGTGG + Intergenic
1048888106 8:138924726-138924748 TTCATTCTAAGCACATGGGGTGG - Intergenic
1048892568 8:138960989-138961011 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1049628600 8:143638477-143638499 TCCAATCCCAGCACTTTGGGAGG + Intronic
1049817599 8:144614607-144614629 TGTAATCCCAGCACTTGTGGAGG - Intergenic
1050046214 9:1548738-1548760 TACAATCCAAGCACAATTGAAGG + Intergenic
1050348942 9:4721144-4721166 TGCAATCCCAGCACTTTTGGAGG + Intronic
1051406854 9:16746704-16746726 TGCAATCCCAGCACTTTTGGAGG + Intronic
1051746289 9:20297990-20298012 CCCACTCCAAGCACTGGTGGAGG + Intergenic
1053261613 9:36671019-36671041 TCTCAACCAAGCACATATGGAGG + Exonic
1053472728 9:38358396-38358418 TTCAATCCAAGCACTTTGGGAGG + Intergenic
1054711365 9:68514343-68514365 TCCAATCCCAGCACTTTGGGAGG + Intronic
1054975381 9:71137858-71137880 TACAATCCCAGCACTTCTGGAGG + Intronic
1055023089 9:71691174-71691196 TCCAATCCCAGCACTTTGGGAGG + Intronic
1055830564 9:80373271-80373293 TGTAATCCCAGCACTTGTGGAGG - Intergenic
1056162394 9:83909804-83909826 TGTAATCCCAGCACATGGGGAGG + Intronic
1056357949 9:85821701-85821723 TGTAATCCCAGCACATGGGGAGG - Intergenic
1057339581 9:94187971-94187993 TGCAATCCCAGCACATTGGGAGG + Intergenic
1057613767 9:96569842-96569864 TACAATCCCAGCACATTGGGAGG - Intronic
1057625717 9:96674620-96674642 TGCAATCCAAGCACTTTGGGAGG + Intergenic
1057647404 9:96889655-96889677 TCTAATCCAAGCACTTTGGGAGG - Intergenic
1058273685 9:103009458-103009480 TGTAATCCAAGCACTTGGGGAGG - Intronic
1058278812 9:103084969-103084991 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1058855884 9:109061823-109061845 TGTAATCCCAGCACTTGTGGAGG - Intronic
1059146434 9:111903850-111903872 TATAATCCCAGCACCTGTGGAGG - Intronic
1059478856 9:114572214-114572236 TCTAATCCCAGCACTTTTGGAGG - Intergenic
1059737153 9:117113397-117113419 TGCAATCCCAGCACATTGGGAGG + Intronic
1060355967 9:122907320-122907342 TGCAATCCCAGCACTTTTGGAGG - Intergenic
1060703273 9:125778216-125778238 TGTAATCCAAGCACTTGGGGAGG - Intronic
1061765893 9:132881167-132881189 TCTAATCCCAGCACATTGGGAGG + Intronic
1061778956 9:132984670-132984692 CCCAATCCAACCACATGGGATGG - Intronic
1185640014 X:1584819-1584841 TGCAATCCCAGCACTTGGGGAGG + Intergenic
1186158466 X:6750881-6750903 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1186262318 X:7792386-7792408 TTCAATCCCAGCACGTTTGGAGG - Intergenic
1186664027 X:11700265-11700287 TGCAATCCAAGCACTTTGGGAGG - Intergenic
1186707859 X:12161413-12161435 TGTAATCCCAGCACATTTGGAGG - Intronic
1186809614 X:13175337-13175359 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1188460516 X:30421606-30421628 TCTAATCCTAGCACATTGGGAGG - Intergenic
1188511175 X:30938026-30938048 TGCAATCCCAGCACGTGGGGAGG - Intronic
1188590265 X:31824505-31824527 TGCAATCCCAGCACATTGGGAGG - Intronic
1189518772 X:41743849-41743871 TACAATCCAAGCACTTTGGGAGG + Intronic
1189664051 X:43334017-43334039 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1190158378 X:48012044-48012066 TCTAATCCAAGCACTTTGGGAGG + Intronic
1190174149 X:48134926-48134948 TCTAATCCAAGCACTTTGGGAGG + Intergenic
1190186444 X:48238655-48238677 TACAATCCCAGCACATTGGGAGG + Intronic
1190594081 X:52035552-52035574 TCCATTCCAGGCCCATGTGAAGG - Intergenic
1190632715 X:52403602-52403624 TGTAATCCAAGCACTTTTGGAGG + Intergenic
1190689166 X:52899271-52899293 TCTAATCCAAGCACTTTGGGAGG - Intronic
1190696817 X:52956521-52956543 TCTAATCCAAGCACTTTGGGAGG + Exonic
1190999653 X:55646543-55646565 TCTAATCCCAGCACATTGGGAGG - Intergenic
1191972770 X:66835497-66835519 TCCAATACAATAACAAGTGGAGG + Intergenic
1193348855 X:80433876-80433898 TCTAATCCCAGCACTTTTGGAGG + Intronic
1193605083 X:83557126-83557148 TATAATCCAAGCACTTTTGGAGG - Intergenic
1193716175 X:84936991-84937013 TCTAATCCCAGCACATTGGGAGG + Intergenic
1194089680 X:89569013-89569035 TTCAATCCCAGCACTTGGGGAGG - Intergenic
1194711909 X:97245667-97245689 TGTAATCCGAGCACTTGTGGAGG - Intronic
1194795418 X:98205818-98205840 TCAAATACAATCACATTTGGAGG + Intergenic
1195715169 X:107811422-107811444 TCTAATCCCAGCACTTTTGGTGG - Intergenic
1196338102 X:114563118-114563140 TGCAATCCCAGCACTTTTGGAGG + Intergenic
1196804294 X:119570985-119571007 TGCAATCCCAGCACTTGGGGAGG - Intergenic
1197288175 X:124621216-124621238 TGTAATCCAAGCACTTGTGCAGG + Intronic
1197452352 X:126635562-126635584 TCCAATCCAAATACATAGGGTGG - Intergenic
1197705714 X:129633135-129633157 TACAATCCCAGCACATTGGGAGG + Intergenic
1198477845 X:137012594-137012616 TCCAATCCAAGCACTTTGGGAGG - Intergenic
1199098566 X:143770486-143770508 TACAATCCCAGCACATTGGGAGG + Intergenic
1199441157 X:147868921-147868943 TCCAATCCCAGCACTTTGGGAGG + Intergenic
1199782849 X:151079041-151079063 TCAAATACAAGCAAATGAGGAGG + Intergenic
1200143657 X:153914437-153914459 TCTAATCCAAGCACTTTGGGAGG + Intronic
1201159026 Y:11154769-11154791 TCCCATCTCAGCACCTGTGGGGG + Intergenic
1201676987 Y:16596970-16596992 TGTAATCCCAGCACTTGTGGAGG + Intergenic
1201773572 Y:17641763-17641785 TCTAATCCCAGCACTTTTGGAGG - Intergenic
1201827983 Y:18264223-18264245 TCTAATCCCAGCACTTTTGGAGG + Intergenic
1202045531 Y:20734222-20734244 TACAATCCAAGCACTTTGGGAGG + Intergenic