ID: 1022201547

View in Genome Browser
Species Human (GRCh38)
Location 7:28122325-28122347
Sequence GACATGGTAGGAGCCTGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022201547 Original CRISPR GACATGGTAGGAGCCTGGAT TGG (reversed) Intronic
901485727 1:9559723-9559745 CACATGGTAGCAGCCTGAAAAGG - Intronic
901858229 1:12057707-12057729 GCCATAGCAGGGGCCTGGATAGG + Intergenic
901929099 1:12585633-12585655 GTCAGGGTAGGAGGCTGGAGGGG - Intronic
903134911 1:21302989-21303011 GAAATAGCAGGAGCCTGGCTGGG - Intronic
903397141 1:23010519-23010541 GACATGGTCAGAGCCAGGCTTGG + Intergenic
905369841 1:37477084-37477106 GACTTGGGCTGAGCCTGGATGGG + Intronic
906793917 1:48681662-48681684 GACCTGGCAGGAGCCAGGAGTGG - Intronic
907909147 1:58811833-58811855 GCCATGTCAGGAGGCTGGATGGG + Intergenic
912313876 1:108649213-108649235 GACTTGGTAGAAACCTGGCTGGG - Intronic
912627407 1:111217040-111217062 GACATGGGAGGGGCATGGAGGGG - Intronic
913088599 1:115460782-115460804 GTCATGGAAGGAGTCTGGAGAGG - Intergenic
913147932 1:116010823-116010845 GACAAGCTAGGAGTCTGGGTAGG + Intronic
915970740 1:160353332-160353354 GACAGGGTAAGAGACAGGATTGG + Intronic
916322856 1:163523810-163523832 TACATAGTAGGAGCTGGGATGGG + Intergenic
921982340 1:221272364-221272386 GAGCTGGTAGGAGGCTTGATTGG - Intergenic
922241539 1:223758509-223758531 CACATGGCAGGAACCTGGCTCGG - Intronic
922552443 1:226506034-226506056 GACATGGCAGGAGCCTGTGACGG - Intergenic
1062902031 10:1153858-1153880 GACATCGTAGGGGCCTGGGGTGG + Intergenic
1064032204 10:11890018-11890040 GAAATGGTGGGCGCCTGGAGAGG - Intergenic
1064285162 10:13985343-13985365 GACAGGGAAGGAGGCTGGAATGG + Intronic
1064483083 10:15759027-15759049 GACAAGGTAGGAGACTAGTTTGG - Intergenic
1065175069 10:23067968-23067990 GACAGGGAAGGAGCCCGGTTTGG - Intergenic
1065278240 10:24107961-24107983 GACATTGTAGGTGGCAGGATGGG + Intronic
1069200231 10:65605819-65605841 TACATTGTAAGAGCCGGGATAGG + Intergenic
1070250718 10:74770702-74770724 AACATGGTAGAAGCTAGGATTGG - Intergenic
1073293013 10:102422628-102422650 CACAAGGGAGGCGCCTGGATTGG - Intronic
1075834112 10:125438654-125438676 GACATGGAATCAGCCTAGATGGG + Intergenic
1078935796 11:15948848-15948870 GACATGCTATGGGGCTGGATTGG - Intergenic
1083344602 11:61980551-61980573 GACATGCAAGAAGCCTGGCTCGG - Intergenic
1089638660 11:119832755-119832777 GACAGGGCTGAAGCCTGGATTGG + Intergenic
1089991558 11:122865942-122865964 GAGATGATGAGAGCCTGGATTGG - Intronic
1091306302 11:134538443-134538465 GCCGTGGTAGGATCCTGGAGTGG + Intergenic
1097624419 12:61982533-61982555 TACATGTTAAGAACCTGGATAGG - Intronic
1099474402 12:83090676-83090698 GCAATGGTAGGAGCATGGAAAGG - Intronic
1104838119 12:131805331-131805353 TACAAGGTGGGAACCTGGATGGG - Intergenic
1107603630 13:42038721-42038743 GAAATGATAGGTGCATGGATGGG + Intergenic
1113113524 13:106850069-106850091 GGCCTGGTAGGGGCCTGGTTTGG + Intergenic
1113311400 13:109136773-109136795 GACATGGGAGGAGCTTTGAAGGG - Intronic
1118861129 14:69664529-69664551 ATTATGGTAGGAGGCTGGATGGG + Intronic
1119513070 14:75226969-75226991 GGCATGGGAGGAGCCTGGCAGGG + Intergenic
1121307209 14:92914427-92914449 CACAAGGTAGGAGACTGGTTGGG - Intergenic
1121870802 14:97405017-97405039 GACATGGGAGGAGGCTAGAATGG - Intergenic
1122403867 14:101485879-101485901 TACAATGTAGGATCCTGGATGGG - Intergenic
1122937606 14:104967230-104967252 CAGCTGGCAGGAGCCTGGATGGG + Intronic
1124116384 15:26847148-26847170 GACATGGGAGGACACTTGATGGG + Intronic
1127275248 15:57438103-57438125 GACACCGTAGGAGCCTGCCTTGG - Exonic
1128525192 15:68407582-68407604 GAGATGTTGGGAGCCTGGTTGGG + Intronic
1128741574 15:70087613-70087635 TAAAGGGTAGGAGCATGGATGGG - Intronic
1129304334 15:74648003-74648025 GACAAGGCAGGACCCTGCATGGG + Intronic
1132120331 15:99170145-99170167 GACATTCCAGGAGCCTGAATTGG + Intronic
1134321940 16:13171694-13171716 GACATGGCACGAGGCTGGAGGGG + Intronic
1135938232 16:26798933-26798955 GACTTGGAAGGAGCCTGGGGCGG + Intergenic
1137054152 16:35735427-35735449 GACCTGGTTGGGGCTTGGATGGG + Intergenic
1138453036 16:57105158-57105180 GAGATGATGGGAGCCTGGCTGGG + Intronic
1139821680 16:69726282-69726304 GACCTGGGATGAGCCTTGATCGG - Intronic
1141099094 16:81184116-81184138 CACGTGGGAGGAGACTGGATTGG - Intergenic
1142110853 16:88330408-88330430 CTCAGGGTAGGAGCCTGAATGGG - Intergenic
1143388437 17:6545878-6545900 CACAGGATAGGAGCCTGGAGAGG - Intronic
1144623839 17:16834449-16834471 GGCATGGTGGGAGCCTGGAGAGG - Intergenic
1144882592 17:18438267-18438289 GGCATGGTGGGAGCCTGGAGAGG + Intergenic
1145149642 17:20506119-20506141 GGCATGGTGGGAGCCTGGAGAGG - Intergenic
1145217878 17:21065914-21065936 GACATTGTATGAGCTTGGACAGG - Intergenic
1145999828 17:29124509-29124531 CACAGGGTGGGAGCCTGGAGGGG + Intronic
1147578129 17:41614153-41614175 GGCATGGTGGGAGCCTGGAGAGG - Intronic
1151423693 17:74015876-74015898 GACAACGAAGGAGCCTGGAGAGG + Intergenic
1153498533 18:5723973-5723995 GACATGGTAGGAGGCCCCATGGG + Intergenic
1155099593 18:22596188-22596210 GAAATGACAGTAGCCTGGATTGG - Intergenic
1155935248 18:31746521-31746543 CACTTGGTAGGCTCCTGGATCGG - Intergenic
1161865277 19:6828561-6828583 GATTAGGTAGGAGCCTGGGTCGG + Intronic
1162844843 19:13384353-13384375 GACATGGGAGGAGACTGGTGTGG + Intronic
1163195907 19:15719912-15719934 AACATGGTTAGAGCCTTGATTGG + Intergenic
1165131944 19:33638278-33638300 GCCATGGGAGGAGGCTGGAGGGG - Intronic
1165849878 19:38843595-38843617 GGCAAGGCAGAAGCCTGGATGGG - Intronic
1166077895 19:40424789-40424811 GACATGGTAGGAGACCAGATTGG + Intronic
1168430407 19:56274728-56274750 TACAAGGTGGGATCCTGGATTGG - Intronic
925124997 2:1448096-1448118 GGCCTGGGAGGAGCCGGGATTGG + Intronic
927933104 2:27058339-27058361 CCCAAGGTAGCAGCCTGGATGGG + Intronic
930087252 2:47506562-47506584 TATATGGGAGAAGCCTGGATTGG - Intronic
931071954 2:58661458-58661480 GACATATTAAGAGCCTAGATAGG - Intergenic
933665706 2:84963213-84963235 GAGATGATAGCAGCCTGGAATGG + Intergenic
935818105 2:106866648-106866670 GACATGATAGGGGCCTTGGTCGG - Intronic
935843386 2:107138708-107138730 CACATGATAGCAGCCAGGATGGG - Intergenic
936259603 2:110947644-110947666 GACATGGGAGCTGCCTGGTTGGG + Intronic
937250701 2:120522073-120522095 GGCATGGTAGGTACCTGCATAGG - Intergenic
944348924 2:198703828-198703850 GAGAGGGAAGGAGCCTGGTTAGG + Intergenic
945908534 2:215620773-215620795 GACAAGGTGGGAGACAGGATTGG - Intergenic
946432018 2:219631161-219631183 TACAAGGTGGGAGCCTGGACGGG - Intronic
947500401 2:230667076-230667098 GGCATGGTAGGAGCGTGTACTGG + Intergenic
947913796 2:233819207-233819229 GAGAGGATAGGAGCCTGGAGTGG + Intronic
948495448 2:238345779-238345801 GTGATGGCAGGAGCCTGGGTGGG + Intronic
948791839 2:240383296-240383318 GGCTTGGTAGGAGGCTGGAGAGG - Intergenic
948943404 2:241207493-241207515 GACAAGGGAGGCGCCTGGCTGGG + Intronic
1169664032 20:8014767-8014789 GAGATGGTAAAAGCTTGGATGGG + Intronic
1172431126 20:34892747-34892769 GATCTGGTTGGAGCATGGATGGG + Intronic
1174137130 20:48387293-48387315 GAAATGGAAGGAACCTGGGTGGG - Intergenic
1178877222 21:36422591-36422613 GGCATGGTCGGACTCTGGATGGG - Intergenic
1183633210 22:39045807-39045829 GAGATGGAAGGAGCCAGGTTGGG - Intronic
1183641014 22:39092361-39092383 GAGATGGAAGGAGCCAGGCTAGG - Intergenic
951173898 3:19576603-19576625 AGCTAGGTAGGAGCCTGGATAGG - Intergenic
951621512 3:24606746-24606768 GGCATGGTGGGACCTTGGATGGG + Intergenic
954034580 3:47844401-47844423 GGCATGGTAGGGGCCTGTCTGGG + Intronic
954274230 3:49532021-49532043 GACAGGGTAGATGCCTGGGTTGG + Exonic
954294976 3:49669336-49669358 GCAATGGTAGGAGCCTGCACAGG + Exonic
962902373 3:139772558-139772580 GACATGGAAGGAACTAGGATTGG + Intergenic
962925805 3:139992389-139992411 GACATGGTAGGAGGAGGGAGTGG + Intronic
963826271 3:149957617-149957639 CACATGGTAGAAGACTGGCTAGG - Intronic
965761544 3:172082806-172082828 GAAAGGGTAGAAGACTGGATTGG + Intronic
966772230 3:183514416-183514438 GAGATGGCAGGAGCGTGGAAAGG - Intronic
966786471 3:183627432-183627454 TAGAGGGTAGGATCCTGGATGGG + Intergenic
969503860 4:7571388-7571410 CACATGGCAGGACCCTGGATGGG + Intronic
971824322 4:31601405-31601427 TAAAAGGTAGGAGCCTGCATGGG + Intergenic
972427452 4:38947242-38947264 TACAAGGTAGGGGCCTGAATAGG + Intergenic
973604845 4:52576344-52576366 TACAGGGTAGTAACCTGGATTGG + Intergenic
975640289 4:76493573-76493595 TACATATTAGGAGCCTGGCTAGG + Intronic
977330184 4:95628162-95628184 GAAATTGGAGGAGCCTGGACTGG + Intergenic
978622469 4:110647295-110647317 GACATGGTAGGGTTCAGGATTGG + Intergenic
984065366 4:175041540-175041562 AAAATGGTAGTTGCCTGGATTGG + Intergenic
985878481 5:2619160-2619182 GACAGGTTAGGAGTGTGGATGGG - Intergenic
985882840 5:2653563-2653585 GACACAGAAGGAGCATGGATGGG - Intergenic
991080139 5:62589589-62589611 GAGATGGTAGCAGCCTGAAATGG - Intronic
995087304 5:108127591-108127613 GACATGGAAGGAGCTAGGAAGGG + Intronic
996338970 5:122415242-122415264 GCCATGGTAGGAGCCTGCATGGG + Intronic
997418912 5:133750669-133750691 GCCATGTTAGGAGCCGGGACAGG - Intergenic
998731563 5:145082929-145082951 GAAATGATAGTAGCTTGGATTGG - Intergenic
1001674535 5:173500962-173500984 CACATGGTTGGACCCAGGATTGG + Intergenic
1006439121 6:34042433-34042455 GACATGGCAGGAGGATGGCTGGG + Intronic
1006697502 6:35943667-35943689 GAAATGAGGGGAGCCTGGATAGG + Exonic
1006753023 6:36391247-36391269 GAGAGGGTTGGAGCCAGGATTGG + Exonic
1007718918 6:43873873-43873895 GAGATGGTGGGGGCTTGGATAGG + Intergenic
1011713008 6:90073808-90073830 GACATGGGTGGAGCATGGAGAGG - Intronic
1011900488 6:92288950-92288972 GACATGTTAGGAGCCCATATTGG + Intergenic
1017212801 6:151875786-151875808 GACATGATCAGAGCTTGGATGGG + Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1019887127 7:3915157-3915179 GACGTGGTAGGAGCAGGGGTAGG + Intronic
1022201547 7:28122325-28122347 GACATGGTAGGAGCCTGGATTGG - Intronic
1022281776 7:28918185-28918207 GACTTGGTAGAAAACTGGATTGG - Intergenic
1027229682 7:76265009-76265031 GGCTTGGGAGGACCCTGGATTGG - Intronic
1028680406 7:93522488-93522510 GACATGGTAGGTAGATGGATAGG - Intronic
1030170156 7:106593120-106593142 GTCATGGCAGGAGCCAGAATTGG - Intergenic
1032446217 7:131985978-131986000 GAAATGATGGGAGCTTGGATTGG - Intergenic
1036392433 8:8335470-8335492 GTGATGGTAGGAGCTGGGATGGG + Intronic
1039822283 8:41144893-41144915 GACAGGGGAGGAGCAAGGATGGG - Intergenic
1042200588 8:66276574-66276596 GACATGGGAGGAGACAGGCTGGG - Intergenic
1045304780 8:100950495-100950517 GACTTGGGCGGAGCCTGGAGGGG - Intronic
1045843872 8:106610561-106610583 GGCATGGTACGAGACAGGATAGG - Intronic
1050400848 9:5252614-5252636 GAAAGGGTAGGAGGCTGGAGGGG - Intergenic
1050648957 9:7754666-7754688 TATATTGAAGGAGCCTGGATTGG + Intergenic
1054916581 9:70500143-70500165 GACATGATAGTGGCGTGGATGGG + Intergenic
1056838697 9:89980074-89980096 GGCAAGGTGGGAGTCTGGATTGG - Intergenic
1057942230 9:99295365-99295387 GGGGTGGTAGGAGCCTGGAAAGG + Intergenic
1198603971 X:138315987-138316009 CACAACGTAGGATCCTGGATTGG - Intergenic
1198837892 X:140823750-140823772 AACACGGTGGGAGGCTGGATTGG + Intergenic