ID: 1022201658

View in Genome Browser
Species Human (GRCh38)
Location 7:28123106-28123128
Sequence CAGTGTGGCTAGAGGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 2, 2: 13, 3: 100, 4: 569}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022201658_1022201665 22 Left 1022201658 7:28123106-28123128 CCCTCTCTCCTCTAGCCACACTG 0: 1
1: 2
2: 13
3: 100
4: 569
Right 1022201665 7:28123151-28123173 GTTAAGTTGCTTTCTGTCTCAGG 0: 1
1: 0
2: 1
3: 29
4: 318
1022201658_1022201666 23 Left 1022201658 7:28123106-28123128 CCCTCTCTCCTCTAGCCACACTG 0: 1
1: 2
2: 13
3: 100
4: 569
Right 1022201666 7:28123152-28123174 TTAAGTTGCTTTCTGTCTCAGGG 0: 1
1: 0
2: 0
3: 33
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022201658 Original CRISPR CAGTGTGGCTAGAGGAGAGA GGG (reversed) Intronic
900636805 1:3669940-3669962 GTGTGTTGCTAGAGGTGAGAGGG + Intronic
900729096 1:4240347-4240369 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902200462 1:14829763-14829785 TAGTGTGGCCAGAGCATAGAAGG + Intronic
902543736 1:17173143-17173165 GAGTGTGGGTAGGAGAGAGATGG - Intergenic
902552984 1:17230285-17230307 CAGTGTCGCTAGAGAAGCCACGG + Intronic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
903590783 1:24454338-24454360 CAGCGTGGCTTAAGGAGGGAGGG - Intronic
904492767 1:30870855-30870877 CAGGGAGGATAGAGGAGAAAAGG - Intronic
904792449 1:33033700-33033722 GAGAATGGCTAGAGGAGCGAAGG + Intronic
905764979 1:40592808-40592830 CAGTGAGGCTAGAAAAGAGCAGG + Intergenic
906284353 1:44576900-44576922 AAGTGAGCCTAGAGTAGAGAAGG - Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
909032569 1:70559748-70559770 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
909203673 1:72725712-72725734 CAATGTGGCTTTAGGGGAGATGG - Intergenic
909237133 1:73166992-73167014 CAGTGCGGCTAGAACAGAGCAGG - Intergenic
909329272 1:74393084-74393106 CAGTGTGCTGAGAGGAGTGAAGG + Intronic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
910368094 1:86487742-86487764 CAGTATGGCTAGAGGCTGGATGG - Intronic
911054506 1:93698567-93698589 CTCCGTGGCCAGAGGAGAGAAGG + Intronic
911125747 1:94339628-94339650 CAGTTTGCAAAGAGGAGAGATGG - Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
911857719 1:102902075-102902097 CAGTGTGAGTTGATGAGAGAGGG + Intronic
912109132 1:106318487-106318509 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
912307912 1:108589698-108589720 GAGAGTGGGTAGAGGAGAAAGGG - Intronic
912480802 1:109980983-109981005 AAGTGTGGCTAGAGGGGTGGAGG - Intergenic
912987320 1:114447001-114447023 CAGTGTAGCTGTAGCAGAGATGG + Intronic
913576765 1:120183098-120183120 CACTATGAGTAGAGGAGAGATGG - Intergenic
914558674 1:148794533-148794555 CACTATGAGTAGAGGAGAGATGG - Intergenic
914614161 1:149335697-149335719 CACTATGAGTAGAGGAGAGATGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915285140 1:154847476-154847498 CAGTGTGGCATCAGGAGAGCGGG - Intronic
915301278 1:154953013-154953035 CTGAGTGGCTAGAGAAGGGATGG - Intronic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
916911663 1:169355534-169355556 CAGTGTAACTGGAGCAGAGAAGG - Intronic
918101732 1:181382256-181382278 CAGTGTGGCTAGAGTTGGTAAGG + Intergenic
918877377 1:190065643-190065665 TAGTGAGGCTCAAGGAGAGAAGG + Intergenic
918953744 1:191176907-191176929 CAGTGTGGCTAAAGTAGTAATGG - Intergenic
919140643 1:193567360-193567382 CAGTCTGGTTACAGTAGAGAAGG - Intergenic
919935669 1:202248944-202248966 CAGTTGGGAAAGAGGAGAGAAGG + Intronic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920295059 1:204950924-204950946 TGGTGAGGCTAGAGCAGAGAGGG - Intronic
920364699 1:205441923-205441945 CAGTCTGGCTGGGGAAGAGAGGG + Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
920727278 1:208447999-208448021 GAGTGAGGGCAGAGGAGAGAGGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
921240067 1:213170642-213170664 CAAGGAGGCTAGAGGAGAGTAGG + Intronic
921583585 1:216923712-216923734 CAGTGTGGTTGTAGGAGTGAGGG - Intronic
922007504 1:221546694-221546716 AAGTGGGGATAGAGGAGATATGG - Intergenic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
922896660 1:229106053-229106075 CAGTGTGGCTCAAGGACAGGAGG + Intergenic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
924306914 1:242698861-242698883 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
924454392 1:244207274-244207296 CATGGTGGATTGAGGAGAGATGG - Intergenic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
924903761 1:248430293-248430315 CAGGATGGCTAGAGCAGTGAGGG - Intergenic
1063523503 10:6761801-6761823 CATTTGGGCTAGAGGAGAGAAGG - Intergenic
1063818738 10:9809371-9809393 CAGTATTGCTAGAGGAGATAAGG - Intergenic
1064367057 10:14717638-14717660 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1065052283 10:21807351-21807373 CAGTGTGGTTAGAGCACAGTGGG - Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1068280704 10:54865212-54865234 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1069201500 10:65623178-65623200 CAGTATGGCAAGAGGAAAAAAGG - Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069878580 10:71578010-71578032 CAGAGGGGTGAGAGGAGAGAGGG - Intronic
1070516737 10:77214890-77214912 GAGTGTAGGGAGAGGAGAGAAGG - Intronic
1071281348 10:84106859-84106881 GAGGGTGGCAAGAGGAAAGAGGG + Intergenic
1071959264 10:90793952-90793974 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1072199155 10:93143249-93143271 CAGCAGGGCTAGAGCAGAGAGGG - Intergenic
1072987584 10:100155171-100155193 GAGAGTGGGTGGAGGAGAGAAGG - Intronic
1073476475 10:103756983-103757005 CAGGGTTGATAGAGGTGAGAGGG - Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1075122828 10:119676718-119676740 GAGTGTGGCTACAGAAGAGAGGG + Exonic
1075394410 10:122116291-122116313 CACTGTGGATAGCGGACAGAGGG - Intronic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078259529 11:9691840-9691862 CAGGGTGGGTATGGGAGAGATGG + Intronic
1078858555 11:15226494-15226516 AAGTGTGGCCAGAGGTGAAATGG - Intronic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1080206606 11:29736665-29736687 CTGTGTGGCTAGGTCAGAGAGGG - Intergenic
1080250460 11:30227694-30227716 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1081390874 11:42527181-42527203 CAGTATGGACAGAGCAGAGAAGG + Intergenic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1082576854 11:54817266-54817288 CACTGTGGCAAGAGGAGAAAGGG - Intergenic
1082615409 11:55354233-55354255 CATTCTGACTACAGGAGAGATGG + Intergenic
1082759262 11:57110943-57110965 CTGTGTGGCTGGAGAAGGGAAGG - Intergenic
1083237599 11:61361724-61361746 CACTGTGGTTAGGGGTGAGAAGG - Exonic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083953534 11:65970243-65970265 CAGTGTGGCTATGCGGGAGAAGG - Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085419506 11:76343437-76343459 CAGAGTGGCTAGAGGATTGGAGG - Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087596763 11:100263841-100263863 TAGTGTGGCAAGAGCAGACAGGG - Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088250751 11:107858999-107859021 CAGGGTGGCAGGAGGAGAAAGGG + Exonic
1088388113 11:109282012-109282034 GAGGGTGGCCAGAGGAGCGAGGG - Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1090361090 11:126173195-126173217 CCGTGTGGCTTGAGGGGAAAGGG + Intergenic
1090437202 11:126696707-126696729 CGGTGTGGCTTTGGGAGAGAGGG - Intronic
1090609650 11:128459310-128459332 CAGCATGACTAGAAGAGAGATGG + Exonic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091748924 12:3010661-3010683 AAGTGTGGGGAGAGGAGAGGAGG + Intronic
1091798306 12:3309595-3309617 CTGTGTGGGTACAGGTGAGAGGG + Intergenic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092996878 12:13959196-13959218 GAGTTTGGCAAAAGGAGAGAAGG + Intronic
1093647885 12:21609870-21609892 CAGTGTGTCTAGACTAGAGAAGG + Intergenic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094206768 12:27848661-27848683 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1094472071 12:30812147-30812169 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1095590310 12:43895960-43895982 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1095951061 12:47782203-47782225 CACTGAGCCTAGAAGAGAGAAGG - Exonic
1096411862 12:51382798-51382820 CAGTGTGGATGGAAGAGGGAGGG + Intronic
1096698362 12:53365609-53365631 CTGTGTGGCTAGTCCAGAGAAGG - Intergenic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1098158090 12:67621109-67621131 CCCTGTGGCTACAGGAGATAAGG - Intergenic
1098885249 12:75954274-75954296 AAGTCTGGCTAGAGGTCAGAGGG - Intergenic
1099614355 12:84915425-84915447 CTCTTTGACTAGAGGAGAGAAGG + Intergenic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1100442425 12:94629205-94629227 CATTGTTGGTAGAGGACAGATGG - Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1100992936 12:100269230-100269252 CAGGGTGACTAGGGGAGAAAGGG - Intronic
1101607024 12:106255002-106255024 TAGTGTGGCTAGATGAAAGCGGG - Intronic
1102022771 12:109695624-109695646 CAGTGGGGGCAGCGGAGAGATGG - Intergenic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102815515 12:115862267-115862289 AAGTGAGGGTGGAGGAGAGAGGG + Intergenic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1104261052 12:127182385-127182407 CAGTGTGGCTAGAATACAGCAGG - Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106090755 13:26591173-26591195 CAGAGTGGTTAGGGGAGGGAAGG + Intronic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106827946 13:33544593-33544615 CATTCAGGCTAGAGCAGAGAGGG - Intergenic
1107181924 13:37471424-37471446 GTGTGTGGCTAGAGTAGGGAAGG + Intergenic
1107851116 13:44574607-44574629 GAGTGTGGGAAGTGGAGAGATGG - Exonic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1112209484 13:97361625-97361647 CAGTGTGGCTACAGGAGCTGTGG + Intronic
1112494240 13:99893225-99893247 CAGTGTGGCTAGAGGCCATTCGG - Exonic
1115451890 14:33557376-33557398 CATTGTGGGTAGAAGACAGAGGG - Intronic
1117085895 14:52200549-52200571 CATTTTGGCTAGAGGATAGGTGG + Intergenic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1117934778 14:60890770-60890792 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1118360740 14:65054441-65054463 CCATGTGGCTAGAGGAGGCATGG - Intronic
1118503500 14:66386327-66386349 GAGTTTGGCTAGAGAAGAGCTGG - Intergenic
1118712515 14:68533908-68533930 GAGTTTGGCACGAGGAGAGAGGG + Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119947802 14:78713304-78713326 ATGTGTGGCTAGAATAGAGAAGG - Intronic
1120100952 14:80445207-80445229 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1120563047 14:86019858-86019880 CCTTGTGGCTACAGGAGAGGAGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1121580208 14:95024479-95024501 CAGTGTGGCTGGCGGAGGTAAGG - Intergenic
1122201138 14:100123493-100123515 CAGTGTGGTTAGAGGAAGAAAGG - Intronic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1123662218 15:22574412-22574434 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1124262000 15:28201095-28201117 CGGTGTAGCCAGAGGACAGAGGG - Intronic
1124316020 15:28668694-28668716 CGGTGTAGCCAGAGGACAGAGGG + Intergenic
1124685898 15:31781698-31781720 TTGTGTGGCTCGAGCAGAGATGG - Intronic
1125146150 15:36471318-36471340 CAGTTTCGCTGCAGGAGAGAAGG + Intergenic
1125195742 15:37043985-37044007 CAGTGTGGATAAAGAAGAGACGG - Intronic
1126575727 15:50194412-50194434 CAATGTGGTTAGAGGAAAGAGGG + Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127907678 15:63388600-63388622 CCCTGAGGCTAGAGGAGAGTGGG - Intergenic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128565711 15:68699458-68699480 GGGTGTGGCTGGAGGAGTGAAGG + Intronic
1128675935 15:69608409-69608431 CTGTGTGGGTAGAGGAGTGAAGG + Intergenic
1128679546 15:69638039-69638061 CAGCATGACAAGAGGAGAGAGGG - Intergenic
1128706404 15:69840311-69840333 GAGTGTGGGAAGAGTAGAGAGGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1128920482 15:71605820-71605842 AAGTGTAGACAGAGGAGAGATGG + Intronic
1129832783 15:78681615-78681637 CAGTGAGGCCACAGGAGAGAGGG + Intronic
1130159722 15:81386506-81386528 CAGTGTGGCCAGAGCAGGGTAGG - Intergenic
1130232925 15:82110150-82110172 GAGTGTGACAGGAGGAGAGAAGG - Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131371537 15:91885954-91885976 CAGTGTGTCTCTAGCAGAGAGGG + Intronic
1131508425 15:93035681-93035703 CAGGGCGGCCTGAGGAGAGATGG + Intronic
1131721823 15:95177597-95177619 CAGTGTGGCTAAAGGGTATATGG - Intergenic
1132570990 16:643911-643933 CAGTGGGGCTAGAGGAGCCCTGG + Intronic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1135350400 16:21724429-21724451 CAGAGTAGATAGGGGAGAGAAGG + Intronic
1135780223 16:25293532-25293554 GAGTGTGGCTGAAGCAGAGATGG + Intergenic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136220733 16:28826423-28826445 CTGTGTGCATAGAGGACAGAGGG + Intronic
1136515012 16:30762722-30762744 CAGTTTGGCCAGAGAACAGAGGG - Intronic
1136543433 16:30942005-30942027 CTGTGTGGCCAGAAGAGAGCTGG + Intronic
1136851998 16:33619528-33619550 AAGGGTGCCTGGAGGAGAGAGGG + Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1138615717 16:58164262-58164284 CAGGGGGGCAACAGGAGAGACGG + Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1138923993 16:61568202-61568224 CCCTGTGGCTAGAGGAAACATGG - Intergenic
1140257035 16:73346324-73346346 CATGGTGGCGAGAGGACAGACGG - Intergenic
1140455945 16:75105607-75105629 CAGTGTGGCTGGTGCAGAGGAGG + Intronic
1141999979 16:87658751-87658773 AGGGGTGGCTGGAGGAGAGAGGG - Intronic
1203113597 16_KI270728v1_random:1467996-1468018 AAGGGTGCCTGGAGGAGAGAGGG + Intergenic
1142837196 17:2595210-2595232 CTGTGTGCTTAAAGGAGAGATGG - Intronic
1143171321 17:4932283-4932305 CCATGGGGCTAGAAGAGAGAAGG + Exonic
1143221106 17:5262843-5262865 GAATGTAGATAGAGGAGAGAAGG - Intergenic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143619451 17:8072737-8072759 CAGAATGGGGAGAGGAGAGACGG + Exonic
1143693576 17:8591799-8591821 GAGTCTGGCTAGAAGAGAGTTGG - Intronic
1144308935 17:13994590-13994612 CAGTGTTCCAAGAGGAAAGAAGG + Intergenic
1144344729 17:14339573-14339595 CACTGAGTCTAAAGGAGAGAGGG - Intronic
1144441983 17:15291985-15292007 CAGGGTAGCTAGTGGAGAGAGGG - Intergenic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1146121431 17:30198947-30198969 CAGTGTGTCTGCAGGAGACAAGG - Intronic
1146504419 17:33392609-33392631 CAGTGTGGTGACAGGAGAGAGGG - Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1151290694 17:73147872-73147894 CTGCTTGGCAAGAGGAGAGAGGG - Intergenic
1151625759 17:75274545-75274567 CAGTTTGGCCAGAGGTGGGAAGG - Intronic
1151855899 17:76721649-76721671 CCCTCTGGGTAGAGGAGAGAGGG - Intronic
1152080604 17:78185161-78185183 CTGTGCTGCAAGAGGAGAGAGGG + Exonic
1152210496 17:79000670-79000692 CAGTGTGGTCAGGGGACAGAAGG - Intronic
1152916455 17:83039296-83039318 CAGTGTGTCTAGAAGAGGGGCGG - Intronic
1152916485 17:83039408-83039430 CAGTGTGTCTAGAAGAGGGGCGG - Intronic
1152916495 17:83039446-83039468 CAGTGTGTCTAGAAGAGGGGCGG - Intronic
1153101161 18:1471244-1471266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153118468 18:1690376-1690398 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1155116546 18:22773898-22773920 CACTGTGGTTAAAGCAGAGAGGG + Intergenic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155337363 18:24778239-24778261 CCCTGTGGCTACAGGAGATAAGG + Intergenic
1155392428 18:25350838-25350860 CACTGTGGGTAGCGGAGCGAGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156008187 18:32468765-32468787 CAGTGTGCAGAGATGAGAGAAGG + Intronic
1156169861 18:34469613-34469635 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1156405836 18:36781774-36781796 AAGTGGGGTTAGAGCAGAGAGGG - Intronic
1158579520 18:58669701-58669723 CAGTTTGGGTAGAGGATGGAGGG + Intergenic
1159312378 18:66725942-66725964 CTGGGTGGGTAGAGGAGAGTTGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160175621 18:76591879-76591901 CAGAGTGGTTAGAAGAGAAACGG - Intergenic
1160210449 18:76873959-76873981 CTGTGTGGCGACAGGAGAGGAGG - Intronic
1160409843 18:78667958-78667980 AAGGGTGGCTAGGGGAGAGGTGG - Intergenic
1161606811 19:5219645-5219667 GAGAGTGGCTGGAGCAGAGAAGG - Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1161960301 19:7519605-7519627 CAGTGAGGCCAGAGGAGATGGGG - Exonic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162550965 19:11357913-11357935 CAGTGTGGATGGGGCAGAGAGGG - Intronic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1163134330 19:15298676-15298698 CAGGGTGGGGTGAGGAGAGAAGG - Intronic
1163597790 19:18230552-18230574 CAGTGTGGCTTGAGGATGGAAGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1164759124 19:30715063-30715085 CAGAGTGGCGAGAGGAGAGTTGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164870573 19:31640113-31640135 AGCTGTGGCTAGAGGAAAGAAGG + Intergenic
1165028885 19:32983018-32983040 AAGGGTGCCTGGAGGAGAGAGGG - Intronic
1165053938 19:33161674-33161696 CACTGTGCCTAGATGACAGAGGG - Intronic
1165054065 19:33162552-33162574 CACTGTGGCTTAAGCAGAGAAGG - Intronic
1165112786 19:33512030-33512052 CATCCTGGCAAGAGGAGAGATGG - Intronic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165912353 19:39237104-39237126 AGGTGTGGGGAGAGGAGAGAGGG + Intergenic
1165913536 19:39244305-39244327 AGGTGTGGGGAGAGGAGAGAGGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166351493 19:42200648-42200670 CACTGTGCCAAGAGGAGAGAAGG + Intronic
1166929637 19:46294334-46294356 CAGTGAGGCAAGCAGAGAGAGGG - Intergenic
1167015969 19:46841450-46841472 GAATGTAGCTGGAGGAGAGATGG - Intronic
1167211777 19:48138022-48138044 GAGTGTGGACAGAGCAGAGAAGG + Intronic
1167487708 19:49772862-49772884 CTGTGTGGCTGGTGCAGAGAGGG + Intronic
1167882119 19:52468729-52468751 CAGTGTGGCTAGAACAAAGCAGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
925847562 2:8047516-8047538 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
926075003 2:9935424-9935446 CACTGTGGATAAAGGGGAGAGGG + Intergenic
926321340 2:11750132-11750154 GTGTGTGGCTAGGGGACAGAGGG - Intronic
926843540 2:17108219-17108241 CAGTGAGGGAAGAGAAGAGATGG + Intergenic
926913707 2:17874230-17874252 CAGTGAGCATAGAGGAGAGATGG + Intergenic
927028578 2:19096386-19096408 CAGTGCGGCTAGAGTAAAGCAGG + Intergenic
927355660 2:22170184-22170206 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
927495393 2:23548586-23548608 CACTGTGGCAAAAGGAGAGATGG - Intronic
928081937 2:28319610-28319632 CAGTGTTGCTGAAGGAGACAGGG - Intronic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
928353478 2:30585432-30585454 GAATGTGGCTAGACTAGAGAGGG - Intronic
928931741 2:36632019-36632041 GAGTGTGGCAAGAGGAAGGAGGG + Intronic
929349265 2:40928990-40929012 CAGTGTGGTCAGAGCAGAAATGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930403889 2:50929540-50929562 CAGTTTTGATGGAGGAGAGAGGG - Intronic
930480857 2:51946737-51946759 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
931110122 2:59101269-59101291 CAGTGTGGCTAGAGTAAAACAGG - Intergenic
931975291 2:67637578-67637600 GAAAGTGGCTAGAGGAGAGTAGG - Intergenic
932904992 2:75739448-75739470 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
933008767 2:77029541-77029563 CAGTGTGGCTAGAATAAAGCAGG - Intronic
933024543 2:77238517-77238539 TAGTGTGGTTTGAGGAAAGAGGG - Intronic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933293491 2:80463798-80463820 CAGTTTGGCTAAAGGATAAATGG + Intronic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
936432292 2:112475014-112475036 GAATGTGGCTAGAGCAGAGCTGG - Intergenic
937321912 2:120966177-120966199 CAGAGTGGCTACAGTTGAGATGG - Intronic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937399727 2:121571762-121571784 CAGTGTGGCTACAGTATGGAGGG + Intronic
937472586 2:122186824-122186846 CGGTGTGGGTGGAAGAGAGATGG - Intergenic
938769425 2:134488343-134488365 CAGTGTGGCTAGAATAAAGCAGG + Intronic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
938997198 2:136692700-136692722 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
939466474 2:142562760-142562782 CAGTGTGGCAAGCAGAGAAAGGG - Intergenic
939833413 2:147099723-147099745 CAGTGTGGCTAAAGAGGAAAAGG - Intergenic
940165335 2:150764515-150764537 CAGTGTGGCTGGAAGAGGGGAGG - Intergenic
940425277 2:153524912-153524934 CAGAGTAGCTAGAGGAGTGCTGG + Intergenic
940711424 2:157167049-157167071 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
941039139 2:160600665-160600687 CAGAGTGGCTAGAAGAAAGCAGG + Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941347467 2:164388208-164388230 GAGTGAGGCTGGTGGAGAGAAGG - Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
942483864 2:176419160-176419182 CTGGGTGGGTAGAGGAGAGTAGG - Intergenic
943041127 2:182806878-182806900 CAGTGTGTCTAGAAGGGATAAGG - Intergenic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
946643454 2:221808472-221808494 CGGAGTGGGTAGAGTAGAGAAGG + Intergenic
946663810 2:222028804-222028826 CTGTGAGGCTAGAAGCGAGATGG - Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948078393 2:235185130-235185152 CAGTTTTGCCAGAGGGGAGAAGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948246971 2:236494887-236494909 GGGTGTGGCCTGAGGAGAGAGGG + Intronic
948309427 2:236973990-236974012 CAGTGAGGCTAGAGGCAAGATGG - Intergenic
948458403 2:238117888-238117910 GAGGGTGGACAGAGGAGAGATGG + Intronic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
1168737101 20:149875-149897 CAGTGAGGATAGAGGATAGGAGG + Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169745947 20:8942989-8943011 CATTGTGGTCAGAGGAGAGAAGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170751740 20:19154368-19154390 CAGGGTGGAGAGAGGAGAAAGGG - Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1172698050 20:36835723-36835745 CAGCGTGGGGAGAGGAGGGAGGG + Intronic
1173225069 20:41157774-41157796 TAGTGTGGATGGAGCAGAGAGGG + Intronic
1173252138 20:41369507-41369529 GAGTGTGGTCAGGGGAGAGAGGG + Intergenic
1173696216 20:45016109-45016131 CATTGTGCCGAGAAGAGAGAGGG + Intronic
1173783268 20:45774048-45774070 GGGTGTGGCTAGGGAAGAGATGG - Intronic
1174126308 20:48309445-48309467 CAGTGTGGCCACAGCAGAGTGGG - Intergenic
1174157272 20:48523805-48523827 CAGTGGGGGCAGAAGAGAGAAGG - Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174514839 20:51083705-51083727 CAGTGTGGCTGGCAGAGAGTGGG + Intergenic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1174903433 20:54524534-54524556 CAGTATGGTTCCAGGAGAGAAGG - Intronic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176111557 20:63413241-63413263 CGGTGTGGATGGGGGAGAGATGG + Intronic
1177378232 21:20302107-20302129 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1177428814 21:20962004-20962026 CAGTGTGGATAGAGGTGACAAGG - Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1179046763 21:37851543-37851565 CTGTTTGGATAGAGGAGGGAAGG + Intronic
1179667237 21:42921330-42921352 CAGTTTGGCTAGTAGAGCGAAGG + Intergenic
1179947924 21:44691093-44691115 AAGTGTGGAGAGAGGAGAGAAGG - Intronic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1180796265 22:18607235-18607257 CAGAGAGGCGAGAGGAGAGGAGG - Exonic
1181225457 22:21388036-21388058 CAGAGAGGCGAGAGGAGAGGAGG + Exonic
1181253176 22:21546777-21546799 CAGAGAGGCGAGAGGAGAGGAGG - Exonic
1181866139 22:25857004-25857026 CTGGGTGTCTAGAGGAGACAGGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1181990587 22:26833820-26833842 CAGGGTGGCAAGAGGTGGGAAGG + Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182320540 22:29476042-29476064 GAGAGGGGCAAGAGGAGAGACGG + Intergenic
1182753168 22:32657856-32657878 TAGGGTGGCAAGGGGAGAGAGGG - Intronic
1182953934 22:34403191-34403213 CAGTATGGCTAGAGCATAGCGGG - Intergenic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184329688 22:43819452-43819474 CAGTGTGGCTGGGCCAGAGAGGG + Intergenic
1184450759 22:44581204-44581226 CCGTGTGAATAGAGGAGAGATGG + Intergenic
1185084841 22:48735231-48735253 CGGGGTGGCTAGAGGAGATCAGG - Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
949898084 3:8785168-8785190 CAGTGTGTCTAGAGAAGGGATGG + Intronic
949994484 3:9605551-9605573 CTGTGAGGCTAGACGTGAGATGG + Intergenic
950076474 3:10190912-10190934 CACTGTGGCTGGGGAAGAGAGGG + Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
950988273 3:17400722-17400744 CAGTGTGGCTAGAATAAAGCAGG + Intronic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
951670156 3:25172298-25172320 CAGAGGGGCAAGAGCAGAGAAGG + Intergenic
951931225 3:27969178-27969200 CTGTGTGGTTGGAGCAGAGAGGG - Intergenic
951993518 3:28702012-28702034 CAGTGTGGCTAGAATATAGCAGG - Intergenic
952684633 3:36133853-36133875 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953544872 3:43856999-43857021 CAATGTGGTGCGAGGAGAGATGG - Intergenic
954814481 3:53270029-53270051 CACTGTGCCTCCAGGAGAGAGGG + Intergenic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
957073850 3:75585966-75585988 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
957215080 3:77309708-77309730 CAGTGTCTCTAAAGAAGAGAAGG - Intronic
957888151 3:86317643-86317665 CAGTGTGGCTAGAACAGATTAGG - Intergenic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
960346402 3:116538741-116538763 CAGAGAGGCCAGAAGAGAGACGG - Intronic
960498318 3:118403949-118403971 CTGTGTGGTTAGAACAGAGACGG + Intergenic
960964842 3:123097599-123097621 GAATGTGGCTAGAGGATACAAGG - Intronic
961150171 3:124631266-124631288 CAGAGTTGTCAGAGGAGAGATGG - Intronic
961204299 3:125068618-125068640 CAGTGGGGCAAGAGGGGTGAAGG + Intergenic
961262683 3:125615312-125615334 CAGTGTGGCTAGAACAAAGCAGG + Intergenic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
961954499 3:130787561-130787583 GAGGGTGGCTAGGGGAGAGATGG + Intergenic
962202850 3:133414975-133414997 AAGGGTGAGTAGAGGAGAGATGG - Intronic
962203398 3:133417173-133417195 AGGGGTGGATAGAGGAGAGATGG - Intronic
962232252 3:133675960-133675982 AAATGGGGTTAGAGGAGAGAAGG + Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
963051134 3:141144965-141144987 GGGTGTTGCTGGAGGAGAGATGG + Intronic
963618931 3:147579866-147579888 CAGTGTAGCCACAGAAGAGAAGG + Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964009037 3:151867296-151867318 CAGAGTGGTTAGAGGGGATACGG - Intergenic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
964482136 3:157150759-157150781 TATTGTGGATAAAGGAGAGATGG - Intronic
965707379 3:171522631-171522653 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
966116378 3:176468265-176468287 CAATGTGGCTAGAACAAAGAAGG + Intergenic
966783218 3:183602766-183602788 CACTGTCGATAGACGAGAGATGG + Intergenic
966828690 3:183987569-183987591 CAGTGTTGCCAGAGAAGAAATGG - Intronic
967264011 3:187674186-187674208 CAGAGTGGTTAAAGTAGAGAGGG + Intergenic
967745215 3:193047479-193047501 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
967756772 3:193178892-193178914 CATTATGGCTAAAGTAGAGAAGG - Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
969017434 4:4113276-4113298 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
969124702 4:4938109-4938131 GAGTGTGGAAAGAGGTGAGATGG - Intergenic
969144691 4:5112195-5112217 CAGTAAGGATAGAGGGGAGATGG + Intronic
969691260 4:8705400-8705422 CAGGGTGGCCTGGGGAGAGAGGG + Intergenic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969795703 4:9526592-9526614 AAGTCTGGCTGGAGGAGAGTGGG - Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970213091 4:13731244-13731266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
970948442 4:21723518-21723540 CAGTATGGCTAGTGGAGACGTGG + Intronic
971126759 4:23762883-23762905 CAGTGTGGCTAGAATAAAGCAGG + Intronic
971664117 4:29459750-29459772 CAGTGTGGCTAGAAGAAAGCAGG + Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
974578540 4:63762422-63762444 CAGTGTGGATAAAGGAAAAAGGG + Intergenic
976322192 4:83728376-83728398 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
977449055 4:97171218-97171240 CAGTGTGGCTAGAATAAAGTAGG - Intergenic
977514558 4:98005193-98005215 CAGTGTGGCTAGAAAAAAGGAGG - Intronic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
978297057 4:107217720-107217742 TAGTGTGGATAGAGAAAAGAAGG - Intronic
978902733 4:113972198-113972220 CAGTGTGGCTATAGCTGACAAGG + Intronic
979458525 4:120953322-120953344 CTGTGAGGCTAGAGGCAAGATGG - Intergenic
980077139 4:128306027-128306049 CAGGGTGGCTAGCAGAGAGTAGG - Intergenic
980484469 4:133437835-133437857 CAGTGGGGCAAGATGAGAAATGG + Intergenic
980582931 4:134775848-134775870 CCTTGTGGCTACAGGAGATAAGG + Intergenic
980691953 4:136306564-136306586 CCCTGTGGCTACAGGAGATAAGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981247935 4:142562385-142562407 CAGTCTGGCTCATGGAGAGATGG - Intronic
981619137 4:146673885-146673907 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
982087126 4:151846982-151847004 CAGTGGGGATAAAGGAGTGAGGG - Intergenic
982404849 4:155008172-155008194 CAGTGTGCCTAGAGAAAAGGAGG - Intergenic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
983500399 4:168493297-168493319 CAATGTGGCTATAGGACTGATGG + Intronic
983523439 4:168735250-168735272 CAGTGGGGCGAGAGCAGTGAGGG - Intronic
984193070 4:176627326-176627348 GAGAGTGGCAACAGGAGAGATGG + Intergenic
984212903 4:176872684-176872706 TAGTGTGGCTAGGGGAGGGGAGG + Intergenic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985937605 5:3108719-3108741 CAGTGTGGGTAGGGCAGAGACGG - Intergenic
986223283 5:5789548-5789570 CAGTGTGACTATATTAGAGATGG - Intergenic
988378411 5:30469866-30469888 AAATTTGGTTAGAGGAGAGACGG - Intergenic
988478549 5:31609998-31610020 CATTTTGGCTAGACAAGAGAGGG + Intergenic
988581377 5:32471836-32471858 AAGTGTAGCAAGAGAAGAGAAGG - Intergenic
988714046 5:33807067-33807089 CAGAGAGGCCAGAGGAGAAAGGG - Intronic
989597163 5:43167044-43167066 TAGAGAGACTAGAGGAGAGAGGG + Intronic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
990944307 5:61233712-61233734 CACAGTGGCTAAAGGAGAGCTGG + Intergenic
991170306 5:63616731-63616753 AAGTGTGGTTAGAGGTGAGTGGG - Intergenic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992167294 5:74067275-74067297 CACTGGGGCTAGAGGAGTGCTGG + Intergenic
992427686 5:76674842-76674864 CACTGGGGAAAGAGGAGAGAGGG + Intronic
992502702 5:77357803-77357825 GAGTGTGGATAAAAGAGAGAAGG - Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
993002822 5:82399403-82399425 CAGTGTTGCTAGAGGAGTGATGG + Intergenic
993030714 5:82702636-82702658 CATAGTGTCTAGAGGAGTGAGGG - Intergenic
993830392 5:92749910-92749932 GAGAGTGGCTATAGTAGAGAAGG - Intergenic
994204065 5:97013073-97013095 CATTATGGCTAGAGGAAAGAGGG - Intronic
994516242 5:100775759-100775781 CATTGTGGGTAGAGGCCAGAGGG + Intergenic
994973151 5:106769266-106769288 TGGTCTGTCTAGAGGAGAGATGG - Intergenic
995484679 5:112628334-112628356 CAGTGTTGGGAGGGGAGAGAAGG + Intergenic
995569364 5:113463174-113463196 CAGAGAGCCTAGAGGAGAGAGGG + Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996191660 5:120550791-120550813 CAGTGTGCCTAAAGCAGGGAAGG + Intronic
996273465 5:121636853-121636875 CAGTGTGGCTAGAACACAGTAGG - Intergenic
996909168 5:128635706-128635728 CAGTGCGGCTAGAAGAAAGCAGG - Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999561403 5:152807532-152807554 AAGTGCTGCTGGAGGAGAGAAGG - Intergenic
999664520 5:153898708-153898730 CACTGTAGCTTGAGGAGACAGGG - Intergenic
1000037001 5:157456504-157456526 CATTGTGGCTAGAGGAGAAAAGG + Intronic
1000326662 5:160177527-160177549 CAGTGTGGCTGGATCAGAGGAGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002378165 5:178803754-178803776 CAGCCAGGCTAAAGGAGAGAGGG + Intergenic
1002508783 5:179699089-179699111 CCGGGAGGCTAGAGGTGAGAGGG + Exonic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1002936858 6:1681495-1681517 CAGTGTGGCTCCAGGTGAGGAGG + Intronic
1002940873 6:1714652-1714674 CAGAGTGGGTAAAGGAAAGATGG + Intronic
1003302090 6:4893054-4893076 CAGTGTGGCAAGTGAGGAGAAGG - Intronic
1003366002 6:5475651-5475673 CAGTGTGACTACAGGAGTGAGGG - Intronic
1004176826 6:13347357-13347379 CGGTGGGGCTATAGGAGGGAGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005294582 6:24412941-24412963 CAGAGTGGGAGGAGGAGAGAGGG + Intronic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006582933 6:35087083-35087105 CAGTGAGACTAGTGGAGACAGGG - Intronic
1007106777 6:39288795-39288817 CCTTGTGGCTATGGGAGAGAGGG + Intergenic
1007346289 6:41231548-41231570 CAGTCTGGCTAAAGGGGTGAGGG + Intronic
1007849773 6:44791947-44791969 CAGAGTGGGTAGAGCAGGGAGGG - Intergenic
1009814246 6:68710578-68710600 CATTGTGTCAGGAGGAGAGAAGG - Intronic
1010128338 6:72461610-72461632 CAGCCTGGCTAGAGAAGTGAAGG - Intergenic
1010189165 6:73176754-73176776 CAGGCTGGCTTGAGGGGAGATGG + Intronic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1010598729 6:77797745-77797767 CAGTGTGGCTAGAACAAAGCAGG - Intronic
1011126235 6:84010988-84011010 CAGTGTGGTTATAGGATAGCTGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011401850 6:86971329-86971351 CAGTGAGGCTACAGGAGAAAAGG - Intronic
1012132840 6:95518910-95518932 CAGTGTGGCGAGAGGCGGGTGGG + Intergenic
1012458842 6:99437326-99437348 CATAGTGGCTCGATGAGAGAAGG - Exonic
1012809777 6:103942421-103942443 CAGTGTCTTTAGAAGAGAGATGG + Intergenic
1013033218 6:106356411-106356433 CAGTGATGCTGGAGAAGAGAGGG - Intergenic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013898961 6:115129339-115129361 CAGTGTTGGTATAGGAGAAAGGG + Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014857530 6:126420237-126420259 CAGAGTGGCTGGATGTGAGATGG + Intergenic
1016151169 6:140744938-140744960 CAGTGTGGCTAGAATAAAGCTGG - Intergenic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017405617 6:154115583-154115605 CAATGGAGGTAGAGGAGAGAAGG - Intronic
1017726186 6:157277459-157277481 GAGTGGGACCAGAGGAGAGAAGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1018984667 6:168627193-168627215 CAGTCTTACTAGAGGAGAAATGG - Intronic
1019755244 7:2763944-2763966 TAGTGTTGCTATAGGAAAGAAGG - Intronic
1020270006 7:6589423-6589445 GAATGTGGCTAGAGGAGGGCAGG - Intergenic
1020282198 7:6655349-6655371 AAGTGTGGGTAGAGAAGAGGAGG - Exonic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022408482 7:30116962-30116984 CAGTTTGGCTTCAGGAGAGTGGG + Intronic
1022468890 7:30669656-30669678 CAGGGAGGCAAGAGGAGAGGAGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023942541 7:44779142-44779164 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1024558001 7:50620314-50620336 CAGTCTGGCTGCAGGAGAGGAGG - Intronic
1025109629 7:56203205-56203227 CAGTGTGGCTATAGGTGGGATGG + Intergenic
1026375513 7:69746650-69746672 CAGCCTGACTAGAGCAGAGAGGG + Intronic
1026735174 7:72944762-72944784 CAGTGTGGCTGCAGGAGTGGTGG + Intronic
1026785515 7:73299691-73299713 CAGTGTGGCTGCAGGAGTGGTGG + Intergenic
1026807163 7:73435769-73435791 CTGTGTGGCTAGAGGTGTGTGGG - Exonic
1027108557 7:75420245-75420267 CAGTGTGGCTGCAGGAGTGGTGG - Intronic
1027807859 7:82852392-82852414 CAGTGTGGCTAGAATAAAGCAGG + Intronic
1028315201 7:89393030-89393052 CAGTGTGGTGTGAGAAGAGATGG + Intergenic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1029015490 7:97311625-97311647 CAGAGTGGCTAGAGAAGGGTAGG + Intergenic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029423104 7:100481639-100481661 GAATGTTGCTAGAGGAGAAAAGG - Intergenic
1029434722 7:100556567-100556589 CAGTGAGGGTGGAGAAGAGAAGG - Intronic
1029448622 7:100628215-100628237 CGGAGTGGCTAGAGGTGATACGG - Exonic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030799232 7:113828835-113828857 CAGTGTGACTACAGCAGCGAGGG + Intergenic
1031185487 7:118474630-118474652 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1032453135 7:132051888-132051910 CAGGGAGGCAAGAGGACAGACGG + Intergenic
1032508076 7:132450994-132451016 AGGTGTGGCTACAGAAGAGAGGG - Intronic
1032626310 7:133595078-133595100 CAGTGTGGATGGAGGAGTGTAGG + Intronic
1032772622 7:135074596-135074618 GAGAGTGGAGAGAGGAGAGAGGG - Intronic
1033259134 7:139827093-139827115 ATGCTTGGCTAGAGGAGAGAGGG - Intronic
1033985365 7:147219538-147219560 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1034083051 7:148298471-148298493 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1036241594 8:7086233-7086255 CAGTCTGGCTGAAGGAGAGTGGG - Intergenic
1036260244 8:7233884-7233906 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036312281 8:7692440-7692462 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036831141 8:12020844-12020866 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037709324 8:21342985-21343007 CAGTGTGGCCACAGGAGGAAAGG - Intergenic
1039089335 8:33811979-33812001 AAGTGGGGGTAGAGGAGAGGAGG - Intergenic
1039350549 8:36759248-36759270 CAGTGTGGGGAAATGAGAGAGGG - Intergenic
1039709384 8:40040695-40040717 GAGTTTGGCTAGTGGAGAAAGGG + Intergenic
1041467620 8:58172815-58172837 CCGTGTAGCTGGAGGAGATATGG - Intronic
1041593178 8:59615675-59615697 CAAAGGGGCTATAGGAGAGATGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1043614023 8:82103355-82103377 CAGTGTGGCTAGAATAAAGTGGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045065720 8:98442176-98442198 CAGTGGTGTTAGAGAAGAGAGGG - Intronic
1046247007 8:111577291-111577313 CAGAGAGGAGAGAGGAGAGAAGG - Intergenic
1046774973 8:118154261-118154283 CAGTGTGATGAGAGGACAGATGG - Intergenic
1046872077 8:119214970-119214992 CAGCATGGTTAGAGGACAGATGG + Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1047734760 8:127755454-127755476 CTCTGTGGCTAGAAGAGGGAAGG - Intergenic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050448886 9:5758610-5758632 CAGAGAGGTTTGAGGAGAGAAGG - Intronic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1052560403 9:30077450-30077472 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1052827484 9:33187549-33187571 CAGTGTGGCTGGCGCAGAGGAGG - Intergenic
1055882959 9:81023902-81023924 CAGCGTGGCTAGAACAGAGCAGG + Intergenic
1056232633 9:84562487-84562509 AAGTGTGGCATGAGGAAAGAAGG + Intergenic
1056897495 9:90564500-90564522 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1057495106 9:95554272-95554294 CAGTCTGGATAGAGAAGAGAAGG - Intergenic
1058906638 9:109487319-109487341 CACTGTGGCAAGAGCAGGGAGGG + Intronic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059889245 9:118783016-118783038 CAGAGTGGATAGCAGAGAGAGGG + Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1059996341 9:119913803-119913825 CAGTGTGCTGAGGGGAGAGAGGG - Intergenic
1060292159 9:122313997-122314019 CAGAGTGGCTAGATAATAGAAGG + Intronic
1061327663 9:129874060-129874082 CAGAGTGGCGGGAGGAGAGCTGG + Intronic
1061373823 9:130212642-130212664 CAGCGTGTCTGAAGGAGAGAGGG + Intronic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061923895 9:133796730-133796752 CAGTGTGGCCAGTGCAGACACGG - Intronic
1185979807 X:4765383-4765405 CAGTGTGGTTCGAGGGGAGGAGG + Intergenic
1186027441 X:5328220-5328242 CTGTGAGGCTAGAGGCAAGATGG + Intergenic
1186688063 X:11946340-11946362 CAATGTGTCTAGAGGACGGAGGG - Intergenic
1187659817 X:21531004-21531026 CAATGTTTCTTGAGGAGAGAAGG - Intronic
1187927617 X:24264327-24264349 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1188012589 X:25073592-25073614 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1188726287 X:33587311-33587333 CAATATGGCAAGAGAAGAGAGGG - Intergenic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189258735 X:39661558-39661580 CAGTGTGGGTAGAAACGAGAAGG - Intergenic
1189372166 X:40437508-40437530 CCCTGTGGCTACAGGAGATAAGG - Intergenic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1191895730 X:65990758-65990780 CAGTGGGGGCTGAGGAGAGAGGG + Intergenic
1193226978 X:78995215-78995237 CCCTGTGGCTATAGGAGATAAGG + Intergenic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194023317 X:88721200-88721222 CAGTGTGGCTAGAACAAAGCAGG - Intergenic
1194126930 X:90029776-90029798 CTCTGTGGCTACAGGAGATAAGG + Intergenic
1194198511 X:90926508-90926530 CAGTATGGCTAGAATAGAGCAGG - Intergenic
1194809467 X:98373043-98373065 CTGGATGGTTAGAGGAGAGAGGG + Intergenic
1195010299 X:100727045-100727067 CAGTGCAGCAGGAGGAGAGAAGG - Intronic
1195056263 X:101148405-101148427 CAGTGTGGCAAAATGAGAAAAGG + Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1196553307 X:117056694-117056716 CAGGGTAGCTTGAGGAGAAAGGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197878969 X:131144407-131144429 CAGTGAGGATAGAGAACAGATGG - Intergenic
1198073535 X:133172717-133172739 CAGTATGGCTAGAACAGGGATGG + Intergenic
1198270989 X:135055872-135055894 CAGAGTGGTTAGAGAAGAGTTGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1198922087 X:141740450-141740472 CAGTGTCACTAGAGGAGTCAGGG + Intergenic
1199082660 X:143593906-143593928 CAGTGTGGCTAGAATATAAATGG - Intergenic
1199243638 X:145576905-145576927 CTATGTGGCTAGAGGAGAGAAGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199828797 X:151528253-151528275 CAGTGTGTCTGGGGCAGAGAGGG + Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200543229 Y:4486320-4486342 CAGTATGGCTAGAATAGAGCAGG + Intergenic