ID: 1022204130

View in Genome Browser
Species Human (GRCh38)
Location 7:28147139-28147161
Sequence AAAAATCAGAATTCTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1499
Summary {0: 1, 1: 2, 2: 19, 3: 201, 4: 1276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022204130_1022204136 12 Left 1022204130 7:28147139-28147161 CCTGGCCCAGAATTCTGATTTTT 0: 1
1: 2
2: 19
3: 201
4: 1276
Right 1022204136 7:28147174-28147196 GATATTTGCATTATACTTACTGG 0: 4
1: 68
2: 150
3: 162
4: 478
1022204130_1022204135 -10 Left 1022204130 7:28147139-28147161 CCTGGCCCAGAATTCTGATTTTT 0: 1
1: 2
2: 19
3: 201
4: 1276
Right 1022204135 7:28147152-28147174 TCTGATTTTTTTTGGCGTTTGGG 0: 1
1: 0
2: 5
3: 38
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022204130 Original CRISPR AAAAATCAGAATTCTGGGCC AGG (reversed) Intronic
900017667 1:164343-164365 AAAAAACAAAATTCCTGGCCAGG + Intergenic
900047926 1:522939-522961 AAAAAACAAAATTCCTGGCCAGG + Intergenic
900070144 1:764803-764825 AAAAAACAAAATTCCTGGCCAGG + Intergenic
900153817 1:1195638-1195660 AAAAAAAAGAAGTATGGGCCGGG - Intronic
900275403 1:1822945-1822967 AAAATTCTGATTTCTAGGCCGGG + Intronic
900280800 1:1866969-1866991 AAAAACCTCAATTCTAGGCCGGG + Intronic
901369098 1:8781060-8781082 AAAAAAAAAAATTCTCGGCCAGG + Intronic
901424922 1:9176206-9176228 AAAAATAATAATTTTAGGCCGGG - Intergenic
901813634 1:11781613-11781635 GAAAATTAGATTTTTGGGCCGGG + Intronic
901883786 1:12208957-12208979 AAAAGTCAGACTGCTGGGACTGG + Exonic
901918238 1:12516651-12516673 AAAAAAAAGAGTTCTAGGCCAGG - Intergenic
901952115 1:12757679-12757701 AAAAATAAATATTCAGGGCCAGG - Intronic
902234680 1:15049726-15049748 TAAAATCAGAACTATAGGCCAGG + Intronic
902353520 1:15878038-15878060 AAAAATGAGAAAGCTTGGCCAGG - Intronic
902428246 1:16341979-16342001 AAAAAAAAAAGTTCTGGGCCAGG + Intronic
902506429 1:16941436-16941458 AATAATAATAATGCTGGGCCCGG + Intronic
902586861 1:17444836-17444858 AAAAATGCACATTCTGGGCCGGG - Intergenic
902848849 1:19137001-19137023 ATAGTTCAAAATTCTGGGCCAGG + Intronic
902865025 1:19272386-19272408 AAAAATCAGAAATAAGGGCCAGG + Intergenic
902867116 1:19286994-19287016 AAAAATCAGAAATAAGGGCCAGG + Intronic
902960018 1:19956660-19956682 ATAACTCAGACGTCTGGGCCGGG - Intergenic
903300499 1:22375397-22375419 GAAAATCAGATTTGGGGGCCAGG - Intergenic
903393402 1:22981143-22981165 AGAAAAAAGAAGTCTGGGCCAGG + Intergenic
903982915 1:27202878-27202900 AAAAATAAGAATAATGGGCTGGG + Intergenic
903983913 1:27210835-27210857 AAAAATTTGAAGTCTGGGACTGG + Intergenic
903992414 1:27282797-27282819 AAAAAACAGGGTTTTGGGCCGGG - Intronic
904066824 1:27758811-27758833 AAAAACCCTAACTCTGGGCCAGG - Intronic
904127406 1:28250971-28250993 AAAAAAAAGAATTTTGGGTCAGG + Intergenic
904726609 1:32553588-32553610 AAAAAGTAGAATTCTGGGGCCGG + Intronic
904726662 1:32553902-32553924 AAAAGGTAGAATTTTGGGCCGGG + Intronic
905063651 1:35161373-35161395 AAAAAACAGAAATAGGGGCCAGG + Intergenic
905064153 1:35165741-35165763 AAAAAGGGAAATTCTGGGCCAGG + Intergenic
905064197 1:35166057-35166079 AAAAAAGAAAATTCTGGGCCAGG + Intergenic
905082381 1:35335655-35335677 AAAACATAAAATTCTGGGCCAGG + Intronic
905133630 1:35780449-35780471 AAATTACAGAATTATGGGCCGGG + Intergenic
905398651 1:37685368-37685390 AAAAAAAAGAATTTTGGGCCAGG - Intronic
905495186 1:38379401-38379423 AATCATCATAATTCTGGCCCTGG - Intergenic
905620413 1:39440399-39440421 AAAAAAGAGACTCCTGGGCCAGG - Intronic
905675119 1:39819394-39819416 AGGAATCTGACTTCTGGGCCAGG - Intergenic
905687284 1:39917662-39917684 GAAAATAAGAATTGTTGGCCGGG - Intergenic
905780637 1:40706039-40706061 AAAAATTAAAAATCTGGGCCAGG - Intronic
905810637 1:40910442-40910464 AAAAATCACACTACTAGGCCAGG + Intergenic
905981844 1:42235845-42235867 AAAAATCAGAAAACTAGGCCTGG - Intronic
906230203 1:44156126-44156148 AAAATACAGATTTGTGGGCCTGG + Intergenic
906281172 1:44554916-44554938 AGGAATCAGAATTGTGGGCAGGG - Intronic
906487945 1:46246253-46246275 AAAACAAAGAATTCTGGGCCGGG - Intergenic
906709340 1:47917423-47917445 AGAAACCAGAGTTCTTGGCCAGG + Intronic
906758904 1:48352991-48353013 AAAACTCAGAATTCTCATCCAGG + Intronic
906844631 1:49178456-49178478 CAAGATCAGAATTCTGTGCAAGG - Intronic
906928297 1:50142496-50142518 TAAAATCTGAGTTCTAGGCCAGG - Intronic
906966224 1:50459267-50459289 AAAAGACTGAGTTCTGGGCCAGG - Intronic
907024893 1:51107050-51107072 AAAAATTACAGATCTGGGCCAGG - Intronic
907038112 1:51234707-51234729 AAGACTCATAATTTTGGGCCAGG - Intergenic
907200535 1:52722857-52722879 AAAAATTAGAGTTCTGGGCTGGG - Intergenic
908237578 1:62161632-62161654 TAAAATCAGAATACTGGGCTGGG - Exonic
908238852 1:62172268-62172290 GAAAATCTGAATATTGGGCCAGG - Intergenic
908243159 1:62205054-62205076 AAAAATCAATATTCTTGGCTGGG + Intronic
908441607 1:64160818-64160840 AAACACCAGAACTCTGGGCGGGG + Intronic
908519975 1:64932117-64932139 ATAAATAAGAAATCTGGGCCAGG + Intronic
908740730 1:67324644-67324666 AAAAGTTAGAGTCCTGGGCCAGG - Intronic
908744582 1:67363194-67363216 AAAAATAAGAATAATTGGCCAGG - Intronic
909657966 1:78051788-78051810 AAAAATCACAATTCTACGCCAGG - Intronic
909853200 1:80495584-80495606 AAAAAGCAGATTTTTGGGCCGGG - Intergenic
910081341 1:83345959-83345981 GAAAATCAGAATTTTAGTCCTGG - Intergenic
910231273 1:84989999-84990021 AAGAATCAAACTTCTGGGCCGGG + Intronic
910255444 1:85242701-85242723 AAAAAAAAGAATTCTTGGCCGGG - Intergenic
910500926 1:87889240-87889262 AAAAATAAGTATTCTTGGCCGGG - Intergenic
910631771 1:89362845-89362867 AAAATGTAAAATTCTGGGCCAGG - Intergenic
911000278 1:93157827-93157849 AAAAAACAGATTTGTAGGCCGGG + Intronic
911563444 1:99434235-99434257 AAAAATCAGTAGAGTGGGCCGGG + Intergenic
912352468 1:109027349-109027371 AAGAATTAAAATTCTGGGCCAGG - Intronic
912364903 1:109125365-109125387 AAAAAACAGACTGCTTGGCCAGG - Intronic
912367447 1:109146352-109146374 AAAATTAAGAATTCCAGGCCAGG + Intronic
912654480 1:111473520-111473542 AAAAATCATAATGTTGGGCTGGG + Intergenic
912679761 1:111721596-111721618 AAAGAGCAGAATTCTATGCCTGG - Intronic
912905749 1:113705141-113705163 CAAAATCACATTTCTGGGGCTGG + Intronic
913269858 1:117082506-117082528 AAAAATAATAATTATTGGCCAGG - Intronic
913370823 1:118096937-118096959 AAAAATAAGATTTTGGGGCCAGG + Intronic
914232787 1:145779911-145779933 AAAAATGAGAAATATTGGCCGGG - Intronic
914316380 1:146516065-146516087 AGAAATCAGATTTCTGGTGCAGG - Intergenic
914395634 1:147264999-147265021 CAAAACCAGAATTCTGGGATGGG + Intronic
914497976 1:148217296-148217318 AGAAATCAGATTTCTGGTGCAGG + Intergenic
914674462 1:149897827-149897849 AAAAAAAAGAATTTTGGGCCAGG + Intronic
914687031 1:149989493-149989515 AACAATTAGAAATTTGGGCCAGG + Intronic
915336914 1:155149216-155149238 AAAAAAAAAAAATCTGGGCCGGG - Intergenic
915477820 1:156163424-156163446 AAAAATCAGAGGCCAGGGCCGGG + Intronic
917074914 1:171194460-171194482 ATAAATCACATTTCTTGGCCAGG + Intronic
917358762 1:174154320-174154342 AAAGATAAGAATTCTTGACCAGG - Intergenic
917418948 1:174842393-174842415 GAAAACCTAAATTCTGGGCCTGG + Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917490121 1:175491631-175491653 AAAAAAAAAAAGTCTGGGCCTGG - Intronic
917717420 1:177752464-177752486 AAATATTAGGATTCTGTGCCAGG - Intergenic
917757481 1:178116894-178116916 AAAAATTAGCAATCTAGGCCAGG - Intronic
917835832 1:178940978-178941000 AAAAAACATAATTAGGGGCCAGG - Intergenic
918055278 1:181015952-181015974 AGAAAACAGATTTGTGGGCCAGG - Intronic
918165205 1:181938258-181938280 AAAAATAACAATTCTTGGCCGGG - Intergenic
918167396 1:181963319-181963341 AAAATTAAGAACTATGGGCCAGG + Intergenic
918175571 1:182041229-182041251 AAAAACCAGACTGCTGGTCCGGG - Intergenic
918360562 1:183752518-183752540 AAAATTAAGAAATCTGGGCTGGG - Intronic
918542164 1:185644323-185644345 AAACTTCTGGATTCTGGGCCTGG + Intergenic
919698173 1:200601176-200601198 AAAAATAAGTATTCTGGGCCGGG - Intronic
919787981 1:201272227-201272249 ACAAAGCAGAGTTATGGGCCTGG - Intergenic
919799077 1:201341204-201341226 ATCAATCAGAATTCTGTGTCTGG - Intergenic
920001021 1:202798860-202798882 AAAAATAATAATTCTGGGTGTGG + Intronic
920318962 1:205102696-205102718 AAAAATCAACTTTCTAGGCCAGG + Intronic
920339382 1:205266293-205266315 ATAAAACATAATTTTGGGCCGGG + Intronic
920656231 1:207877344-207877366 AAAAAAGAAAATTCTTGGCCAGG - Intergenic
920656659 1:207881361-207881383 AAGAATCAGCATTCGGGGGCTGG + Intergenic
920827934 1:209439097-209439119 AAAAGTCAAGATTCTGGGCCAGG + Intergenic
921544365 1:216456535-216456557 AAAAATCAGAGTTTTGGCTCTGG + Intergenic
922002633 1:221495310-221495332 AAAAATAAGAATTCCTGGCGTGG + Intergenic
922105514 1:222510249-222510271 AAAAAACAAAATTCCTGGCCAGG + Intergenic
922112995 1:222580855-222580877 AAAAATAGGTATTCTGGGCCAGG + Intronic
922265849 1:223982838-223982860 AAAAAACAAAATTCCTGGCCAGG + Intergenic
922336643 1:224623672-224623694 ATTAATCAGAATTCTGGGGAGGG - Intronic
923098489 1:230793969-230793991 AAACATCAGGATTCTGGCCAAGG + Intronic
923143040 1:231177450-231177472 CAAAGTCAGAAGTCTGGTCCTGG + Intronic
923175057 1:231455581-231455603 AGAAATTGGAAATCTGGGCCAGG + Intergenic
923554721 1:234991623-234991645 AAAAATAAGGACTTTGGGCCTGG + Intergenic
923567504 1:235087480-235087502 AAAAAAAAAAATTCTAGGCCAGG - Intergenic
923659750 1:235947833-235947855 AAAAAAGAAAATTCTTGGCCGGG - Intergenic
923702965 1:236317367-236317389 AGAAATGAGAAAGCTGGGCCGGG - Intergenic
924226707 1:241927994-241928016 AAAAAAAATTATTCTGGGCCGGG - Intergenic
924238273 1:242017254-242017276 AAAAATTTGAATTATAGGCCAGG + Intergenic
924472723 1:244357411-244357433 AAAATTAAGAATACTGGGCTGGG + Intronic
924597502 1:245460259-245460281 AAAAAACAAACCTCTGGGCCAGG - Intronic
1062773621 10:126112-126134 AAAAATAAATTTTCTGGGCCAGG + Intergenic
1062868791 10:880389-880411 AAAAAAAAAAATTCTGGGCCGGG + Intronic
1063472899 10:6302673-6302695 AAAAACCACAAGTATGGGCCGGG - Intergenic
1063698332 10:8359410-8359432 AAAAATAAGAATAATAGGCCAGG + Intergenic
1063809862 10:9692544-9692566 GAAAATTAGAAGTCTGGGCCAGG - Intergenic
1063815669 10:9768494-9768516 AAAAATTAAAAGTTTGGGCCGGG - Intergenic
1064042897 10:11983665-11983687 AAAAATAAGAATCCAAGGCCGGG - Intronic
1064100816 10:12462457-12462479 AAAAAAAAAAATTCTTGGCCAGG - Intronic
1064213533 10:13380948-13380970 AAAGAACAGAATTTTTGGCCAGG + Intergenic
1064543771 10:16431167-16431189 AAAGAATAAAATTCTGGGCCAGG - Intergenic
1064605280 10:17032789-17032811 ATTAATCAGACTTCTGGGCAAGG + Intronic
1064818217 10:19291788-19291810 AAAAATAAAATTTGTGGGCCAGG + Intronic
1064983790 10:21189760-21189782 AAACAACAGAAGGCTGGGCCAGG - Intergenic
1065336710 10:24659608-24659630 AAGAAAGAGGATTCTGGGCCGGG - Intronic
1065692638 10:28351059-28351081 AAAAATAGGAATTCTAGGCTGGG - Intergenic
1065845298 10:29738135-29738157 AAAAATTGGACTTCAGGGCCGGG + Intergenic
1065883062 10:30053765-30053787 AAAAAAAAAAATTCTGGGCCAGG + Intronic
1065911710 10:30312283-30312305 AAAATACAGTATTCTCGGCCAGG + Exonic
1066088784 10:31997201-31997223 AAAAATAAGAAATCTAGGCCAGG - Intergenic
1066354152 10:34665543-34665565 AAAAAAAGAAATTCTGGGCCTGG + Intronic
1066366700 10:34783911-34783933 TAAAATCAGTATTCTAGGCCAGG + Intronic
1066455987 10:35572573-35572595 AAAAATTTCAAATCTGGGCCAGG - Intronic
1066728667 10:38417102-38417124 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1067119407 10:43461300-43461322 AAAAAACAAAAGACTGGGCCGGG - Intronic
1067496230 10:46762697-46762719 AAATATAAGAATGCTTGGCCTGG - Intergenic
1067598426 10:47577696-47577718 AAATATAAGAATGCTTGGCCTGG + Intergenic
1068384507 10:56307733-56307755 ATTAATTAGAATTCTGGGCATGG - Intergenic
1068451735 10:57198148-57198170 AAAACTGAGAATTCTGGGGCTGG + Intergenic
1069004282 10:63299485-63299507 TATAATAAGAAATCTGGGCCAGG - Intronic
1069435686 10:68380564-68380586 AAAACTCACAATTATGGGCCAGG + Intronic
1069449871 10:68508416-68508438 AAAAAAAAGAATTCTAGGCCAGG + Intronic
1069522168 10:69131437-69131459 AAAAAAGATCATTCTGGGCCGGG + Intronic
1069704865 10:70452076-70452098 AAAAGTCAGAACTAAGGGCCGGG + Intergenic
1069795322 10:71048181-71048203 AAAATTAAGAAGACTGGGCCAGG + Intergenic
1069932284 10:71890968-71890990 AAAGATCACAAATCTGAGCCCGG - Intergenic
1069957008 10:72058169-72058191 AAAAAATAGAATCATGGGCCGGG + Intergenic
1070169457 10:73921714-73921736 AAAAAAAAAAATTCTGGGCTGGG - Intronic
1070193367 10:74132955-74132977 AATAAACAGATTTATGGGCCAGG + Intronic
1070212977 10:74346185-74346207 AAAAAACAGAAATTTTGGCCAGG - Intronic
1070258740 10:74832827-74832849 AAAAATCACATTTTTTGGCCGGG + Intronic
1070562465 10:77578280-77578302 GAAAACCAGAACTCTGGTCCCGG + Intronic
1070715077 10:78714063-78714085 GAAAATCAGATTTCTGCACCAGG - Intergenic
1070943075 10:80363641-80363663 AAAAATCAGATTTTTTGGCTGGG - Intronic
1071124248 10:82315940-82315962 AAAAATCACATATATGGGCCGGG - Intronic
1071138688 10:82481687-82481709 ATAAATTACAATTCTAGGCCGGG + Intronic
1071612595 10:87045228-87045250 AAATATAAGAGTTCTTGGCCAGG - Intergenic
1071706269 10:88002441-88002463 AAAAAGGAGGATTTTGGGCCGGG - Intergenic
1071986466 10:91055941-91055963 TAAAATCAAGAATCTGGGCCGGG - Intergenic
1072121108 10:92406244-92406266 AAAATTCTTAGTTCTGGGCCAGG - Intergenic
1072128845 10:92472930-92472952 AAAAAAAAAAATTCTGGGCTGGG - Intronic
1072128895 10:92473223-92473245 AATAAAAAGAATTTTGGGCCGGG - Intronic
1072239741 10:93484457-93484479 AAAAATCAGGAGAGTGGGCCAGG - Intergenic
1072419379 10:95276915-95276937 AAAAAAAAAACTTCTGGGCCAGG + Intronic
1073274386 10:102296747-102296769 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1073518986 10:104107535-104107557 AAAATAAAGAATTCTGGGCCAGG - Intergenic
1073963441 10:108960677-108960699 AAAAATCAGAATTTTTGGCCAGG + Intergenic
1074153948 10:110782281-110782303 AAAAAGCAGAATTTTGGATCAGG + Intronic
1074322497 10:112416174-112416196 AAAAATCAGATTCCTGGGCCGGG + Intronic
1074918348 10:117981229-117981251 AAAAATCAGATTTCTGAGTCTGG + Intergenic
1075108089 10:119555928-119555950 AAGAATCAGCATTTGGGGCCAGG + Intergenic
1075238919 10:120759813-120759835 TAAAATGGGGATTCTGGGCCGGG + Intergenic
1075400980 10:122161414-122161436 ATAAATAAGAATCCTGGTCCTGG + Intronic
1075744989 10:124720902-124720924 AAAGTTCAGAAATCTGGGCCGGG + Intronic
1075774433 10:124971118-124971140 AACAAACAGAATTCAAGGCCAGG - Intronic
1076306457 10:129468587-129468609 AAAAAAAAAAAATCTGGGCCAGG + Intronic
1076785509 10:132747751-132747773 AAAAAACAGATTTATAGGCCAGG + Intronic
1076974264 11:159535-159557 AAAAAACAAAATTCCTGGCCAGG + Intergenic
1077982053 11:7310427-7310449 AAAAATCACAGTTATGGGCTAGG - Intronic
1078041784 11:7870976-7870998 AAAAATAAAAAATCTTGGCCGGG - Intergenic
1078176226 11:8973315-8973337 AGAAAGCAGAAGTCTGGGGCAGG - Intergenic
1078194071 11:9120281-9120303 AAAAATAGCAATCCTGGGCCAGG - Intronic
1078228960 11:9421254-9421276 AAAAATTAGAATTCTGGGCCGGG - Intronic
1078287871 11:9976365-9976387 TAATATCAGATATCTGGGCCAGG - Intronic
1078654025 11:13221575-13221597 AAAAAACAGTATTTTAGGCCAGG - Intergenic
1078921515 11:15835242-15835264 AAGAAGGAGAAGTCTGGGCCGGG - Intergenic
1079041777 11:17066022-17066044 ATAAATCAGTATTTTAGGCCAGG + Intergenic
1079546796 11:21643000-21643022 AAAAAACAGTTTTGTGGGCCAGG + Intergenic
1079599918 11:22298679-22298701 AAAAATCACTATTTTGGGCCGGG + Intergenic
1079617548 11:22513646-22513668 AAAAAAAAAAATTCTGGTCCTGG + Intergenic
1079940543 11:26674696-26674718 AAAAATCCACATTTTGGGCCAGG - Intronic
1080475288 11:32584310-32584332 AAAGATCAAAATGCCGGGCCGGG + Intronic
1080962995 11:37181814-37181836 AAAAACCAGACTTCTGGTCCAGG + Intergenic
1081282158 11:41222849-41222871 AAAAAAAAGAATGCTGGTCCAGG + Intronic
1081316596 11:41637800-41637822 AAAAATTGGTATCCTGGGCCAGG - Intergenic
1081470739 11:43368112-43368134 GAAAATGAGAAGTCAGGGCCAGG - Intronic
1081591876 11:44428852-44428874 AAAAATCAGTTTTGCGGGCCGGG - Intergenic
1081615769 11:44590311-44590333 AAAAATATGAAATCTGGGCCGGG + Intronic
1081833737 11:46136492-46136514 AAAAATAAGAATCTGGGGCCAGG + Intergenic
1081879675 11:46437962-46437984 AAAACACAGAATGCTGGGACGGG + Intronic
1081894431 11:46572796-46572818 AAAAATAAGTATTCTGAGCTGGG + Intronic
1081897524 11:46599355-46599377 AAAAAAAAAAATTCAGGGCCGGG + Intergenic
1082017828 11:47505336-47505358 AAAAATCAGTATGTTAGGCCAGG + Intronic
1082018657 11:47512441-47512463 AAAAAAAAAAATTCTGGGCACGG - Intronic
1083033902 11:59618975-59618997 ACAGAACAGAATTCTTGGCCTGG + Intergenic
1083176792 11:60955200-60955222 AAAATTCAGAAGTATTGGCCGGG + Intergenic
1083395299 11:62387196-62387218 AAAAATAATCATTCTTGGCCAGG - Intronic
1083546349 11:63551850-63551872 AAAAGTCAGTTTTCTGGGCCAGG + Intergenic
1083647728 11:64182489-64182511 AAAAAAGAGAATTCTGGGTTGGG + Intergenic
1083735689 11:64679340-64679362 AAGAATCAGGATTGAGGGCCAGG + Intronic
1083905242 11:65664836-65664858 AAAATACAGAATTCTGGGCCAGG - Intergenic
1084366213 11:68701895-68701917 AAAAAACTGATTCCTGGGCCAGG + Intergenic
1084435965 11:69140007-69140029 AAAAATAAACAATCTGGGCCAGG - Intergenic
1084745367 11:71166776-71166798 AAAAAAAAGAAGTGTGGGCCCGG - Intronic
1085089579 11:73699146-73699168 AAAAAACAGCATTATCGGCCTGG - Intronic
1085671420 11:78468050-78468072 AAAAAAAAGAATTCTTGGCTGGG + Intronic
1086154816 11:83654013-83654035 AAAAAAAAAAATTCTTGGCCAGG - Intronic
1086207813 11:84281014-84281036 AAAAATCAGTTATCTAGGCCGGG - Intronic
1086223638 11:84481032-84481054 ATAAATGAGATTACTGGGCCAGG - Intronic
1086232271 11:84584659-84584681 AAAAAAAGGAATGCTGGGCCAGG - Intronic
1086885733 11:92203345-92203367 ATAAATCACAATTTGGGGCCAGG + Intergenic
1087044453 11:93832977-93832999 AAAAAGCAGAAGTCTAGACCTGG + Intronic
1087104113 11:94393663-94393685 GCAAATCAGAAATCTGGGTCAGG + Intronic
1087275963 11:96160721-96160743 AAAAATCAGAAAACTGGGTTGGG - Intronic
1087327651 11:96742769-96742791 AAAAATAACAATTATTGGCCAGG - Intergenic
1087471821 11:98584904-98584926 AAAAATAAGGACCCTGGGCCAGG - Intergenic
1088025786 11:105180763-105180785 AGAAATCAGGATTGTCGGCCGGG + Intergenic
1088219168 11:107549144-107549166 AGAAATCAGAATTTTAGGCTGGG - Intronic
1088254753 11:107892786-107892808 AAAGAATTGAATTCTGGGCCAGG + Intronic
1088270657 11:108031075-108031097 AATAATCATGAGTCTGGGCCTGG + Intronic
1088302322 11:108372486-108372508 AGAAATAAGAATTATTGGCCAGG - Intronic
1088311056 11:108461018-108461040 AAAAAGCAGACTTTTTGGCCGGG - Intronic
1088559393 11:111097408-111097430 AAAAACCGGACTTCTGGTCCCGG - Intergenic
1088724987 11:112626533-112626555 AAAAATATGAACTCTTGGCCAGG + Intergenic
1088863781 11:113826622-113826644 TAAAATTAAAATTCTAGGCCGGG + Intronic
1088874188 11:113920321-113920343 AAAAGAGGGAATTCTGGGCCAGG - Intronic
1088885489 11:114003102-114003124 AGAAATTTGAATTCTTGGCCGGG + Intergenic
1089195524 11:116692178-116692200 AAGAAGCAGGATTCTGGCCCTGG + Intergenic
1089416153 11:118292996-118293018 AAAAATCAGTTTGCTAGGCCGGG + Intergenic
1089673070 11:120070274-120070296 AGAAATAAAAATTCTAGGCCGGG + Intergenic
1089914611 11:122141116-122141138 AAAAAAAAAAATTCTGGGTCAGG - Intergenic
1089956713 11:122578002-122578024 TAAAATAAGAATTCATGGCCAGG - Intergenic
1090014216 11:123071437-123071459 AAAAAAAAGTATTCTGAGCCAGG + Exonic
1090675156 11:128985311-128985333 AAAAATCAGCACTATAGGCCAGG - Intronic
1090680120 11:129046827-129046849 AAAAAAAAAAATTCTTGGCCGGG + Intronic
1090968263 11:131617067-131617089 CAAAGTCAGAATTGTGGGGCTGG + Intronic
1091420990 12:340171-340193 AAAAGTCAGACTTTTTGGCCAGG - Intronic
1091492083 12:941611-941633 AAAAATAAAAATTTTGGGCCAGG - Intronic
1092296451 12:7202859-7202881 AAAATGCAGATTTCTGGGCCAGG + Intronic
1092387343 12:8045952-8045974 AAAAATAAGAAATATGGGTCAGG - Intronic
1092477252 12:8829666-8829688 AAAAAAAAAAATTCTGAGCCAGG + Intronic
1092926055 12:13273464-13273486 AAACATAAGTATTCTGGGCAAGG - Intergenic
1092975706 12:13742724-13742746 AAAAATCAAAGTTCTAAGCCGGG - Intronic
1093775447 12:23068439-23068461 AAAAATTACAATCTTGGGCCAGG - Intergenic
1093928411 12:24931199-24931221 AAAAAATAGCATCCTGGGCCAGG - Intronic
1094055747 12:26267936-26267958 AAAAAAGAAAATTCTGGGCTGGG - Intronic
1094177761 12:27559161-27559183 AAAAATCACTATTAAGGGCCTGG - Intronic
1094177810 12:27559460-27559482 AAAAATCACTATTATGGGTCGGG - Intronic
1095196166 12:39320637-39320659 AAAAAAAAAAAGTCTGGGCCAGG + Intronic
1095278877 12:40326167-40326189 AAAAATTAGAAATCTCTGCCGGG + Intronic
1095485269 12:42678238-42678260 ACAAATCAACATTTTGGGCCAGG - Intergenic
1095892200 12:47245305-47245327 AAAAATAATAAAACTGGGCCAGG + Intergenic
1095936228 12:47685081-47685103 AAAAATCAGATATTTTGGCCGGG + Intronic
1096066654 12:48746299-48746321 AAAAATTAGATTTGGGGGCCGGG + Intergenic
1096133684 12:49181767-49181789 AGAAGAAAGAATTCTGGGCCGGG + Intergenic
1096166169 12:49426350-49426372 ATAAATCAGAATACTGGTCAGGG - Intronic
1096187763 12:49593676-49593698 AAAAGTCCAAATTTTGGGCCAGG + Intronic
1096273425 12:50185123-50185145 AAAATACAGAATTCCGGGCCAGG - Intronic
1096297266 12:50394216-50394238 AAAAAACAGAGTGCTTGGCCAGG - Intronic
1096299168 12:50410697-50410719 AAAATAAAGAATTCTAGGCCGGG - Intronic
1096320905 12:50612019-50612041 AAAAAGCAGATATCTTGGCCAGG + Intronic
1096363644 12:51009884-51009906 AAAAATCTGTTTTCAGGGCCGGG + Intronic
1096576656 12:52557035-52557057 AAAAATAAAAATTGTAGGCCGGG + Intergenic
1096754135 12:53784642-53784664 AGAAATGCAAATTCTGGGCCAGG - Intergenic
1097009977 12:55946081-55946103 TAAATTGAGGATTCTGGGCCAGG - Intronic
1097114001 12:56683662-56683684 AAAAACCAAAACTATGGGCCGGG + Intronic
1097240894 12:57574565-57574587 AAAAAATCCAATTCTGGGCCGGG - Intronic
1097501348 12:60408326-60408348 AAATATCAGAAGTAAGGGCCAGG - Intergenic
1097643699 12:62211282-62211304 AAAAAGCAGAAAAATGGGCCAGG + Intronic
1097877354 12:64655729-64655751 AAATATCATAAATTTGGGCCGGG + Intronic
1097894985 12:64816330-64816352 TAAAAAGAGTATTCTGGGCCTGG - Intronic
1098120568 12:67232798-67232820 GAAATTCAGAACTATGGGCCTGG + Intergenic
1098355145 12:69605567-69605589 AAAAATCACAATTACTGGCCGGG + Intergenic
1098452917 12:70640464-70640486 AAAAATCATAATTATAGGACTGG - Intronic
1098557251 12:71833340-71833362 AAAAATCAAAATTCAAGGCCGGG - Intergenic
1098948605 12:76615837-76615859 AAAAATGTGAACTCTAGGCCAGG + Intergenic
1099707828 12:86180019-86180041 AAAAAACAGTTTTGTGGGCCAGG + Intronic
1099962103 12:89406848-89406870 AGAAACCAGAAATCTAGGCCGGG + Intergenic
1100326880 12:93548375-93548397 AAGAATAAGAATTCTAGCCCTGG - Intergenic
1100337472 12:93645198-93645220 AAAATTCAGCTTTCTGGGCCAGG + Intergenic
1100345422 12:93725153-93725175 AAAAATAATAAGTCTGGGCCGGG - Intronic
1100467668 12:94861638-94861660 AAAAATCAGAACTGCGGGCCGGG + Intergenic
1100854799 12:98749400-98749422 AAAAATCTAAGTTTTGGGCCGGG - Intronic
1101048853 12:100839779-100839801 AAAAATAAGAATTCTGTGTCTGG + Intronic
1101330575 12:103754652-103754674 AAGAATTAGAGTTCTAGGCCAGG + Intronic
1101420175 12:104544419-104544441 AGAAATCAGAAATTTGGGCCGGG + Intronic
1101504417 12:105332432-105332454 GAAAATCAGAATGATGGACCAGG + Intronic
1101656711 12:106727912-106727934 TAAAAACTGAATTCAGGGCCGGG - Intronic
1102012651 12:109628149-109628171 AAAAATAAGAAGTTTGGGACAGG + Intergenic
1102117285 12:110412389-110412411 AAAAATTGGAATACTTGGCCAGG - Intergenic
1102275047 12:111575467-111575489 CAAAATCAGAAGAATGGGCCTGG - Intronic
1102280301 12:111613525-111613547 GAGAATGAAAATTCTGGGCCAGG - Intergenic
1102290076 12:111692261-111692283 AAAAATTGTAAATCTGGGCCAGG - Intronic
1102311595 12:111849226-111849248 AAAAAAAAGAACTCTTGGCCAGG - Intronic
1102314380 12:111875070-111875092 AAAAATCACTAGTATGGGCCGGG - Intronic
1102367907 12:112355298-112355320 AAAAAAAAAAATTGTGGGCCAGG + Intronic
1102380379 12:112460551-112460573 AAAAATCTTAAGTCTGGGCGTGG + Intronic
1102539116 12:113605687-113605709 AAAAATGAGAACCTTGGGCCAGG + Intergenic
1102540874 12:113618195-113618217 AAAATTCATAATACTGGGCCAGG + Intergenic
1103044974 12:117728590-117728612 AAAACTCAGAACTCTGTGTCTGG + Intronic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103313292 12:120029940-120029962 AAAAAACAAAATTCTGGGCCGGG - Intronic
1103399793 12:120636004-120636026 CAAAAACACAGTTCTGGGCCGGG + Intergenic
1103460129 12:121097047-121097069 AAATGTCATAGTTCTGGGCCGGG - Intergenic
1103470485 12:121176455-121176477 AAAAACCACAAGGCTGGGCCGGG + Intronic
1103530825 12:121600343-121600365 AAAAAAAAAAATTCTGGGCACGG + Intergenic
1103586545 12:121960511-121960533 AAGAATCATCATTATGGGCCAGG - Intronic
1103766614 12:123284675-123284697 AAAAACAAGAATAATGGGCCGGG - Intergenic
1103869833 12:124083472-124083494 AAAGAACAGGGTTCTGGGCCGGG - Intronic
1104387636 12:128364832-128364854 AACACTCAGAATGCTGGGCATGG - Intronic
1104703635 12:130926188-130926210 ATAAAACAGAATTTTTGGCCGGG + Intergenic
1104994691 12:132646534-132646556 AAAAAAAAAAATTCTGGGGCCGG + Intronic
1105030610 12:132880669-132880691 AAAAAAGTCAATTCTGGGCCAGG + Intronic
1105052767 12:133069582-133069604 AAAAATTACAGATCTGGGCCGGG + Intergenic
1105493781 13:20912359-20912381 AAAAAAAAGAAGGCTGGGCCTGG + Intergenic
1105517686 13:21104938-21104960 AAAAATGTACATTCTGGGCCGGG - Intergenic
1105787262 13:23761827-23761849 AAAAAACAGAAGCTTGGGCCGGG + Intronic
1105901986 13:24763510-24763532 AAGAATTAGCCTTCTGGGCCCGG - Intergenic
1106025282 13:25950093-25950115 AAAAATAAGCAGTCTGGGCTGGG - Intronic
1106043965 13:26120495-26120517 AAAAATGAGAATTTCTGGCCAGG + Intergenic
1106060906 13:26290819-26290841 AAAAAAACAAATTCTGGGCCAGG + Intronic
1106159854 13:27191320-27191342 CAAAAACAGAAGCCTGGGCCAGG - Intergenic
1106195734 13:27492418-27492440 AAAAAACAGAAATTTAGGCCAGG - Intergenic
1106272697 13:28169751-28169773 AAAAATAATAATTTTAGGCCGGG + Intronic
1106461856 13:29977465-29977487 TAACATCAAAATTCTGGGTCAGG + Intergenic
1106649305 13:31672230-31672252 AAAAATTATTATTCTGGGCCGGG - Intergenic
1106740550 13:32636062-32636084 AAGAATCAGAATACTAGGCCGGG - Intronic
1106746300 13:32711651-32711673 AAAAATTAGAAGTCAAGGCCAGG - Intronic
1106904480 13:34390806-34390828 AAAATGCAAATTTCTGGGCCGGG - Intergenic
1107571302 13:41661157-41661179 AGAAAACTGAATTCTTGGCCAGG - Intronic
1107725822 13:43298320-43298342 AAAAAAAAAAAATCTGGGCCAGG + Intronic
1107727826 13:43317708-43317730 AAAAAAAAAAATTCCGGGCCAGG + Intronic
1107740781 13:43447613-43447635 CAAAAGCAGAAATCTGGGTCTGG + Intronic
1107862533 13:44674542-44674564 AAAAATCAGATTTCAGAGCCAGG - Intergenic
1107881795 13:44838902-44838924 AAAAATCACAACACAGGGCCAGG + Intergenic
1108060495 13:46528479-46528501 TAAAATCATAATTTTAGGCCAGG + Intergenic
1108240898 13:48462413-48462435 AAAAATGAGCAGTCTGGGCATGG - Intronic
1108276505 13:48815768-48815790 AAAAAGTAAAATTCTGGGCCAGG + Intergenic
1108962212 13:56247945-56247967 ACAACTCAGAATGCTGGGCTGGG - Intergenic
1109295421 13:60524801-60524823 AAAAAACACAATTTTCGGCCAGG + Intronic
1109295524 13:60525467-60525489 AAAAATAAGAATTCCTGGCCAGG - Intronic
1109315693 13:60746537-60746559 GAAAAACAGAATTCTGAGCTAGG + Intergenic
1109450010 13:62500552-62500574 AAAAATCAGGAATCTAGGTCTGG + Intergenic
1109622297 13:64925791-64925813 AAATATCAGAGTTCTGCGCCTGG + Intergenic
1109772727 13:66997904-66997926 AAAAATAAAAATTCTGGGCCAGG + Intronic
1109971460 13:69775855-69775877 AAAAATTATTATTCTAGGCCAGG + Intronic
1109972293 13:69785185-69785207 AAAAATGTATATTCTGGGCCGGG - Intronic
1110398321 13:75059268-75059290 AAAAATCAAAATACCAGGCCAGG + Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1111936915 13:94567125-94567147 AAAAAACAAAATTATGGGCCAGG - Intergenic
1111980477 13:95010601-95010623 AAAAATCTTCAGTCTGGGCCAGG + Intergenic
1112386866 13:98947799-98947821 ATAAATTATATTTCTGGGCCGGG - Intronic
1112781877 13:102909547-102909569 AAAAATAAGAATCTTAGGCCAGG - Intergenic
1112800356 13:103103320-103103342 AAAAAAAGGAAATCTGGGCCGGG + Intergenic
1113860022 13:113475886-113475908 GACAATCAGACTTCTGGGCCAGG + Intronic
1113902418 13:113804399-113804421 AAAAAGCAGACTTTGGGGCCCGG + Intronic
1113914228 13:113861348-113861370 ACACATCAGGATCCTGGGCCTGG + Intronic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1113984900 13:114306292-114306314 AAAAAAAAAAATTCAGGGCCAGG + Intergenic
1114290203 14:21281802-21281824 AAAAAAAAGAAGTCTGGGCAGGG + Intergenic
1114302057 14:21387188-21387210 TATATTAAGAATTCTGGGCCAGG + Intronic
1114422471 14:22596381-22596403 GAAATTCAGATTTCTGGGCTGGG - Intergenic
1114439334 14:22733467-22733489 AATAATAATAATTCTAGGCCAGG - Intergenic
1115127022 14:30007949-30007971 AGAAATAAAAAATCTGGGCCGGG + Intronic
1115555724 14:34543730-34543752 AAAAAAAAAAATTCTGGGCCGGG - Intergenic
1115558184 14:34559363-34559385 AAAAAAAAAAATTCTGGGCCGGG + Intergenic
1115620897 14:35139084-35139106 AAAAATCAGTATCTTTGGCCGGG - Intronic
1115812792 14:37128881-37128903 AGAAATCATAATGCAGGGCCAGG - Intronic
1116160564 14:41262641-41262663 AAAAATGATAATTATGGGCCAGG - Intergenic
1116180464 14:41526038-41526060 AATAATCACCAGTCTGGGCCAGG + Intergenic
1116182691 14:41555002-41555024 AAAAAATATATTTCTGGGCCGGG - Intergenic
1116810835 14:49538566-49538588 TAAATGCAGAATGCTGGGCCAGG + Intergenic
1116852182 14:49919456-49919478 AAAAAACACAAATATGGGCCGGG + Intergenic
1116932965 14:50708276-50708298 AAAAATTAGAATTTTGAGGCCGG - Intergenic
1116975020 14:51106189-51106211 AAAAATAATAATTTTAGGCCGGG - Intergenic
1117691938 14:58316873-58316895 AAAAATCATACTACTTGGCCGGG - Intronic
1118290600 14:64518130-64518152 AAAAATTGTATTTCTGGGCCAGG - Intronic
1118510211 14:66463880-66463902 TAGAATAAGAATTCAGGGCCCGG - Intergenic
1118549636 14:66936081-66936103 AAAAATGAGAATTGGGGTCCAGG + Intronic
1118805282 14:69231061-69231083 AAAAATCAGGACTCTTGGCCAGG - Intronic
1119020358 14:71105834-71105856 AAAAATTATATTTCTGGGCTGGG - Intronic
1119106325 14:71927951-71927973 AAAAAAAAGGATTCTTGGCCGGG - Intergenic
1119396623 14:74330902-74330924 ATAAAACACAAGTCTGGGCCGGG + Intronic
1119632376 14:76244227-76244249 AAGAACCAGAGTTCTTGGCCAGG + Intronic
1119819022 14:77597826-77597848 AAAAAAAAGAATTTTAGGCCAGG + Intronic
1120190124 14:81433049-81433071 AAAATGCAGATTGCTGGGCCTGG - Intronic
1121206179 14:92169976-92169998 AAAAATCAGAAAAATTGGCCAGG + Exonic
1121538029 14:94704512-94704534 TAAAACAAGAACTCTGGGCCAGG + Intergenic
1121766937 14:96495764-96495786 GAAAATCAGTAATCTGGGCCAGG + Intergenic
1122107029 14:99465762-99465784 AAAACTCAGAAATCTGGCACTGG - Exonic
1123223246 14:106875806-106875828 ATAAAGCAGAATTCTGAGCCAGG - Intergenic
1123587694 15:21773794-21773816 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1123624332 15:22216359-22216381 AAGAAACAGAATCCAGGGCCAGG + Intergenic
1123800532 15:23815212-23815234 AGAAATGAGAACTCTGGTCCAGG + Intergenic
1123813852 15:23956178-23956200 AAAAATAAAAAGTTTGGGCCGGG - Intergenic
1124575869 15:30907855-30907877 CAAAATAAGAATTCTGGGTAGGG + Intronic
1124699823 15:31903201-31903223 AAAAAACAGAAATCCAGGCCAGG - Intergenic
1125438879 15:39679439-39679461 AAAAATAAGAGTTCTGGGCCAGG + Intronic
1125517943 15:40333270-40333292 AGAAATACGAATTCTCGGCCAGG + Intronic
1125556355 15:40588599-40588621 AAAAATCAGAATTCTAGACCAGG + Intergenic
1125638557 15:41210208-41210230 AAAGATTATAATTCAGGGCCAGG - Intronic
1125646287 15:41275448-41275470 GAAAATCAGAAGTTTTGGCCGGG - Intronic
1125677333 15:41509563-41509585 AAAAATAAAAATTCAGGGCCAGG + Intronic
1125823469 15:42654984-42655006 AAAAAGAACAAATCTGGGCCAGG + Intronic
1126005343 15:44251525-44251547 AAAAATATATATTCTGGGCCAGG + Intergenic
1126040634 15:44587035-44587057 AACACTAAGAATTCTTGGCCAGG + Intronic
1126152693 15:45537491-45537513 AAAAATAATAATTTTAGGCCAGG + Intergenic
1126244959 15:46494123-46494145 AAAAATAACAAATCTGGGCCAGG + Intergenic
1126391288 15:48156071-48156093 AAAAATTACCATTATGGGCCGGG - Intronic
1126569963 15:50140324-50140346 AAGAGTCAGGAGTCTGGGCCTGG - Intronic
1126634728 15:50769235-50769257 AAAAATGCAAATTCTTGGCCGGG + Intergenic
1126658199 15:51003876-51003898 TAAAATCAGAATTCCTGACCTGG - Exonic
1126762412 15:51981176-51981198 AAAATTCAGACTTATCGGCCGGG + Intronic
1126774044 15:52084500-52084522 AAAAAAAAGAATCTTGGGCCAGG + Intergenic
1126813708 15:52434291-52434313 AAAAATCCAAATTGTGGGCCGGG - Intronic
1127069901 15:55278775-55278797 AATAATTAGAAGACTGGGCCAGG - Intronic
1128069275 15:64784055-64784077 AAAAGACAGATTTCAGGGCCAGG + Intergenic
1128125283 15:65187705-65187727 AAAAATCTCACTTCTCGGCCAGG + Intergenic
1128205187 15:65845068-65845090 AAATATAATAATTGTGGGCCAGG - Intronic
1128245288 15:66128587-66128609 AAAAGTCCAAATTCTAGGCCAGG + Intronic
1128272091 15:66319232-66319254 AAAAAACAGAATCTTGGGGCTGG - Intronic
1128840716 15:70849061-70849083 AAAAAACATATTTCTTGGCCGGG + Intronic
1128962473 15:72022224-72022246 AAAAATCAAATTTTTTGGCCAGG + Intronic
1129224766 15:74162615-74162637 AAAAATAAGCTTTCTGGGTCAGG - Intergenic
1129501346 15:76040620-76040642 AAAAATAATAACTATGGGCCTGG + Intronic
1129553651 15:76481024-76481046 AAAAAGTAGAATAGTGGGCCGGG - Intronic
1129795545 15:78373433-78373455 CAAAATTTGAATTCTGGGCCGGG - Intergenic
1129804902 15:78447743-78447765 GAAAAGCAGAATAATGGGCCGGG - Intronic
1129832082 15:78677292-78677314 AAAAAAGTGAATTCAGGGCCTGG + Intronic
1129861961 15:78870116-78870138 AAAAATGAAAATAGTGGGCCGGG - Intronic
1130405577 15:83597901-83597923 AAAAAGCATAATTAAGGGCCAGG - Intronic
1130521267 15:84662530-84662552 ATAATTAAGAATGCTGGGCCTGG - Intergenic
1130719729 15:86374856-86374878 ACAAATCAGAATACTGAGGCTGG - Intronic
1130963859 15:88682726-88682748 AAAAATTAGCATACTAGGCCTGG + Intergenic
1131155666 15:90073691-90073713 AAAGAACAGGATTCTGGGCCAGG + Intronic
1131207871 15:90466794-90466816 AAAAATTAAAAAACTGGGCCGGG + Intronic
1131237205 15:90706882-90706904 AAAACTCCAAATTTTGGGCCAGG + Intergenic
1131501406 15:92970495-92970517 AATAATAATAATTATGGGCCAGG - Intronic
1131589531 15:93732979-93733001 ATAATTAAGAATTATGGGCCAGG - Intergenic
1132112160 15:99109539-99109561 CAGAGTCAGAATTCAGGGCCAGG - Intronic
1132888512 16:2193310-2193332 AAAAATAAGAATTTCAGGCCGGG - Intronic
1132906966 16:2287571-2287593 AAAACTCACAGTTCTTGGCCAGG - Intronic
1133250665 16:4478453-4478475 GAAAATTAGAATTGTGGGCCCGG + Intronic
1133480173 16:6162408-6162430 AAAATACAGAAATCTGGGCCAGG - Intronic
1133529267 16:6639579-6639601 AAAGATTACAATTGTGGGCCGGG + Intronic
1133587583 16:7211094-7211116 AAAAAAAAGGACTCTGGGCCGGG + Intronic
1134015124 16:10882912-10882934 AAAATACAGATTCCTGGGCCCGG + Intronic
1134178999 16:12032499-12032521 AAAGAAGAAAATTCTGGGCCAGG - Intronic
1134317838 16:13135966-13135988 GAAACTGAGAGTTCTGGGCCAGG + Intronic
1134389867 16:13809451-13809473 AAAAATCAGATTTCTGTCCATGG - Intergenic
1135326517 16:21529385-21529407 GAAAATAAAAATACTGGGCCAGG + Intergenic
1135512637 16:23100475-23100497 ACAAAGCAGAATAGTGGGCCGGG + Intronic
1135526430 16:23216760-23216782 AAAAATAAAAATTCTTGGCTGGG - Exonic
1135717917 16:24788941-24788963 AAATAAAAGAATTTTGGGCCGGG - Intronic
1136018392 16:27423017-27423039 AAGAATTAGAGTTCAGGGCCTGG - Intronic
1136076612 16:27821603-27821625 AAATTTAAGAATTTTGGGCCGGG + Intronic
1136236392 16:28916374-28916396 AAAAAACAAATTTCTGGGCTGGG + Intronic
1136302487 16:29345391-29345413 AAAGAAGAAAATTCTGGGCCAGG - Intergenic
1136404657 16:30037245-30037267 AAAAATTAGAATAATAGGCCGGG + Intronic
1136424527 16:30160667-30160689 AAAAAACATATTTTTGGGCCGGG + Intergenic
1136629670 16:31482605-31482627 AAAAAGCAAAAATCTGGGCTGGG + Intergenic
1137251619 16:46745401-46745423 AAAAATTAGAAATCGGGGCCAGG + Intronic
1138075375 16:54037141-54037163 AACAATCAGAATTCTCTCCCTGG - Intronic
1138166384 16:54805607-54805629 AAAAATAAGAATCCTGGGTTGGG + Intergenic
1138365666 16:56474613-56474635 AAAAAGTTGAATTTTGGGCCGGG - Intronic
1138429094 16:56956734-56956756 AAAAATCAAAATTATGGACTCGG - Intergenic
1138621471 16:58214637-58214659 AAAAATAAGAATAATGGGGCTGG + Intergenic
1138649826 16:58453489-58453511 AAAAATCACATTTGTGGGCCGGG + Intergenic
1138969978 16:62132368-62132390 AAAAATAACAATTCCAGGCCGGG - Intergenic
1139080930 16:63520075-63520097 AAAAATGAGAATTCCCGGCTGGG + Intergenic
1139222534 16:65198743-65198765 CAAAATCTGAATTCTGCTCCTGG + Intergenic
1139583950 16:67889264-67889286 AAAAATGAGGCTTATGGGCCGGG + Intergenic
1139762686 16:69199188-69199210 AAAAATCATTATTATAGGCCAGG - Intronic
1139861834 16:70028331-70028353 AAAAAACTGTATTGTGGGCCGGG + Intergenic
1139909197 16:70386630-70386652 AAAAATAAAAATTTTTGGCCGGG - Intronic
1140073494 16:71674371-71674393 AAAAAAAAAAAGTCTGGGCCTGG - Intronic
1140155454 16:72420448-72420470 AAAAATAATAATAATGGGCCGGG - Intergenic
1140225350 16:73072153-73072175 GAAAATCAGAAATGTAGGCCAGG + Intergenic
1140346118 16:74214668-74214690 AAAAAACAGATTACTTGGCCAGG - Intergenic
1140358732 16:74327397-74327419 AAAAAATAGAATTATCGGCCGGG + Intergenic
1140518663 16:75563626-75563648 AAAAATGAAAATACTTGGCCGGG - Intergenic
1140715353 16:77721467-77721489 AAAAATGTGGACTCTGGGCCAGG - Intergenic
1140977399 16:80073128-80073150 AATAATCAGGATTCGGGGGCTGG - Intergenic
1140995634 16:80256750-80256772 AAAAGTCAGAATTCAGACCCAGG + Intergenic
1141360141 16:83388156-83388178 AAGAATCACATTTCTGGGCTAGG + Intronic
1141740735 16:85890714-85890736 AAAAATATAAATTCTGGGCCAGG - Intergenic
1141825143 16:86473397-86473419 TAAAGTCAGAAGTCTAGGCCAGG - Intergenic
1141956835 16:87377860-87377882 AAAAAACAGAAATCTAGGCCAGG + Intronic
1142039572 16:87884118-87884140 GAAAATAAAAATACTGGGCCAGG + Exonic
1142139249 16:88465392-88465414 AAAAGCCAGAAGTCTGGGCCTGG + Intronic
1142374269 16:89698780-89698802 AAAAAAAAAAATTCTAGGCCGGG - Intronic
1142445996 16:90138114-90138136 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1142461512 17:97349-97371 AAAAAACAAAATTCCTGGCCAGG + Intergenic
1142513017 17:409796-409818 AAAAATCAAAACTCTTAGCCAGG + Intergenic
1142819999 17:2458413-2458435 AAAAAAAAAAATTCAGGGCCAGG + Intronic
1142835407 17:2582215-2582237 TAAAAAAAAAATTCTGGGCCCGG + Intergenic
1142877196 17:2858610-2858632 AAAGATAAGAATTCTTGGCCAGG + Intronic
1143195592 17:5074030-5074052 AAAACACACATTTCTGGGCCGGG + Intergenic
1143656750 17:8299055-8299077 AAATATCAGGAGTCTGGGCGTGG + Intergenic
1143680637 17:8473479-8473501 AAAAGTAAGAACTCTGGGCTGGG - Intronic
1143817089 17:9525639-9525661 AAAATGGAGAAATCTGGGCCGGG - Intronic
1143821921 17:9571612-9571634 AAAAAAAAGTAATCTGGGCCGGG + Intronic
1143929633 17:10408232-10408254 AAAAATCTGCCTTCTTGGCCGGG - Intronic
1144115812 17:12089205-12089227 AAGAATCTGTATTCTGAGCCAGG - Intronic
1144249681 17:13403115-13403137 AAAAAAAAAAATTCAGGGCCGGG - Intergenic
1144251929 17:13426219-13426241 TAATAAAAGAATTCTGGGCCGGG + Intergenic
1144252809 17:13436959-13436981 AAAAAACAAGATTCTTGGCCAGG + Intergenic
1144478682 17:15611315-15611337 AGAAAACACATTTCTGGGCCAGG - Intronic
1144492328 17:15723872-15723894 AAAAATTATAGTCCTGGGCCGGG - Intergenic
1144908142 17:18655324-18655346 AAAAATTACAGTCCTGGGCCGGG + Intronic
1144919617 17:18752417-18752439 AGAAAACACATTTCTGGGCCAGG + Intronic
1144983543 17:19185083-19185105 AAAAACCAGAAATGTAGGCCGGG + Intergenic
1144984682 17:19193156-19193178 AAAAACCAGAAATGTAGGCCGGG - Intergenic
1145068547 17:19782618-19782640 AAAAATGGGCATTCTAGGCCGGG + Intronic
1145127990 17:20317552-20317574 AAAAAACAAAATTTTGGGCCAGG - Intronic
1145292233 17:21557221-21557243 AAAAAAAAGAATTGTAGGCCAGG + Intronic
1145951779 17:28824170-28824192 AAAAAAAAAAATTCTCGGCCGGG - Intronic
1146084660 17:29816142-29816164 AAAAATCAGGGCTCTAGGCCAGG - Intronic
1146219010 17:31002279-31002301 AAAAGTGAGAAAACTGGGCCTGG - Intergenic
1146376974 17:32301270-32301292 AAAAACCAGTATCTTGGGCCGGG + Intronic
1146801446 17:35827094-35827116 AAAAATAGCAATTCTTGGCCGGG + Intronic
1146814695 17:35933226-35933248 AAAAATTAGAAACCTCGGCCGGG + Intergenic
1146827644 17:36037300-36037322 TAAAATAAGAATTATAGGCCGGG + Intergenic
1147001573 17:37366790-37366812 AAAAATCTCACCTCTGGGCCAGG + Intronic
1147407223 17:40220761-40220783 AAAAAAACGAATTCTGGGCCAGG - Intronic
1147444973 17:40469578-40469600 AAAAATAAAAAGTCAGGGCCAGG - Intergenic
1147847307 17:43413609-43413631 AGAAATCAGAATGATGGGGCCGG + Intergenic
1147848229 17:43420477-43420499 GAAAATGAGAAAACTGGGCCAGG - Intergenic
1147964061 17:44184062-44184084 AAAAATCAGGATACAAGGCCAGG + Intergenic
1148003738 17:44407950-44407972 AAAAATCTTAATTGTGGGCTGGG - Intronic
1148020650 17:44551164-44551186 AAAAATAAAAATTCTGGGCCAGG + Intergenic
1148254704 17:46119600-46119622 AAAATTCAGGACTCTGGGCCGGG - Intronic
1148290262 17:46440748-46440770 AACATTAAAAATTCTGGGCCAGG - Intergenic
1148312430 17:46658321-46658343 AACATTAAAAATTCTGGGCCAGG - Intronic
1148554515 17:48570345-48570367 TAGAATCAGAGTTCTCGGCCGGG + Intronic
1148603846 17:48913646-48913668 AAAAAACAGATTTCTGGGCCGGG - Intronic
1148634293 17:49135551-49135573 AAAAATAAGAAGGATGGGCCGGG - Intronic
1148657975 17:49302581-49302603 AATAATTACATTTCTGGGCCAGG - Intronic
1149278009 17:55066517-55066539 AAAAATTACAATTTTTGGCCAGG - Intronic
1149442267 17:56684644-56684666 ATAAATCAGGAATCTTGGCCAGG + Intergenic
1149587029 17:57797440-57797462 AAACAATAGAATTTTGGGCCAGG + Intergenic
1149677315 17:58477413-58477435 AAAAATTATAAATCTGGGCCTGG - Intronic
1149749559 17:59132366-59132388 AAAAATAAGTATTTGGGGCCAGG + Intronic
1149786073 17:59436175-59436197 AAAAAATAGAATGGTGGGCCAGG - Intergenic
1149898791 17:60453829-60453851 AAAAATCAGGACCGTGGGCCAGG - Intronic
1150086799 17:62277696-62277718 AAAAAAGAGAATTCAGGGCAGGG - Intronic
1150153880 17:62834319-62834341 AAAAATAAAAATTATAGGCCAGG - Intergenic
1150202935 17:63376136-63376158 ATAAATAAGAGTTCAGGGCCGGG + Intronic
1150283793 17:63944447-63944469 TAAAATGAGACTGCTGGGCCAGG - Intronic
1150311553 17:64132979-64133001 AAAAAACAGATTTCCAGGCCAGG + Intergenic
1150382364 17:64730855-64730877 AAAAATAAAAATTATGGGGCAGG + Intergenic
1150765250 17:67996994-67997016 AATAATTAGACCTCTGGGCCCGG - Intergenic
1151249296 17:72821205-72821227 AAAAAGGGGAAATCTGGGCCAGG + Intronic
1151303221 17:73244264-73244286 AAAAACCAGTATTTTGGGGCCGG + Intronic
1151851441 17:76692546-76692568 AAAAATCAGACTTCCAGGCCGGG - Intronic
1152054213 17:78009845-78009867 AAAAATCATAATTCAGGCCAGGG - Intronic
1152059635 17:78061519-78061541 GAAAATGAAAATACTGGGCCAGG + Intronic
1152171714 17:78754641-78754663 AAAAATCACAATTTTGGGCTGGG - Intronic
1152789494 17:82271363-82271385 AAAAAGGAGTATTTTGGGCCGGG - Intronic
1152990612 18:360484-360506 AGAAATCCAAATTCTTGGCCAGG - Intronic
1153097855 18:1429275-1429297 AAAAATGAGAATACTGGGTCTGG + Intergenic
1153592472 18:6688167-6688189 AAAATTAAGAATTCTGGGCCTGG + Intergenic
1153871421 18:9324113-9324135 AAAAATAAGAATTGTTGGCAAGG + Intergenic
1154005908 18:10526892-10526914 GAAAGTCAGCATTGTGGGCCGGG + Intronic
1154273350 18:12938807-12938829 AAAAAGTAAATTTCTGGGCCTGG + Intergenic
1154507489 18:15057070-15057092 CAAGATAAGAATTATGGGCCAGG - Intergenic
1155153355 18:23139101-23139123 AAAAATTAGAATGTCGGGCCGGG + Intronic
1155194911 18:23465074-23465096 AAAAAATAGCATTCTAGGCCGGG + Intronic
1155211390 18:23605214-23605236 ATAAAACAGAATTCTGGGCCGGG - Intronic
1155217214 18:23653864-23653886 AAAAATAAGAATAATAGGCCAGG - Intronic
1155802357 18:30123608-30123630 AAAAATCAGAAATCAGGGTTAGG - Intergenic
1155948766 18:31885561-31885583 GAAAATAAGAAATATGGGCCGGG + Intronic
1156377345 18:36526696-36526718 AGAAAGCTGAATTATGGGCCAGG - Intronic
1156390113 18:36642322-36642344 AAAAATCCTAATTGTAGGCCAGG + Intronic
1156434032 18:37106946-37106968 TAAAAACTGAATTCTTGGCCAGG + Intronic
1156941195 18:42768731-42768753 GAAAAACAGAAATCTGGGCATGG - Intronic
1157249889 18:46085634-46085656 AAAAAACAGAATACAGGGCCGGG + Intronic
1157537090 18:48467857-48467879 AAAAAGGGGAAATCTGGGCCAGG + Intergenic
1157610939 18:48954912-48954934 AAAAATCCCATTTCTGGGCCGGG - Intergenic
1157874696 18:51261325-51261347 AGAAATCACACTTCTTGGCCAGG - Intergenic
1157943087 18:51950721-51950743 AAAAATTATAATTTTTGGCCAGG + Intergenic
1158364613 18:56719266-56719288 AAAAAACAGAATTGCTGGCCGGG + Intronic
1159082068 18:63746053-63746075 AGAAATAAGAACTCTGGGCTGGG - Intergenic
1159161008 18:64643651-64643673 AAAAATCATCAGTGTGGGCCAGG - Intergenic
1159250077 18:65864591-65864613 AAAAATTACATTTGTGGGCCAGG + Intronic
1159935691 18:74365692-74365714 AAGAATAAGAATCCGGGGCCGGG + Intergenic
1159980108 18:74767959-74767981 AAAAATGAGAACTCAGGGGCAGG - Intronic
1160651214 19:229716-229738 AAAAAACAAAATTCCTGGCCAGG + Intergenic
1161050271 19:2160137-2160159 AAAAATTAGAAGGCTGGGCACGG - Intronic
1161099117 19:2411845-2411867 AAAAATTATAATTGTCGGCCGGG - Intronic
1161154466 19:2725283-2725305 AAAAAAAAAAATTCTGGGCTGGG + Intronic
1161180789 19:2880471-2880493 AAAAATGATACTTCTGGGCCAGG + Exonic
1161205786 19:3040632-3040654 AAAAAACAAAATGCTGTGCCGGG - Intronic
1161372237 19:3919296-3919318 AAAAATAAAAATTATCGGCCGGG + Intronic
1161472425 19:4465418-4465440 AAAAAAAAAAATTCTTGGCCAGG + Intergenic
1161546446 19:4883598-4883620 AAAAAAGAGACTGCTGGGCCAGG - Intergenic
1161744323 19:6045980-6046002 AAAACACACAATTCAGGGCCAGG - Intronic
1161831479 19:6607932-6607954 AAAAATAAAAATTCTCGGCCAGG - Intergenic
1161833705 19:6629981-6630003 AAAAATCAAACTGCCGGGCCGGG - Intergenic
1161842549 19:6691687-6691709 AAAACTCAGATTCCTAGGCCGGG + Intronic
1161878725 19:6932171-6932193 AGAAAATAAAATTCTGGGCCGGG + Intronic
1161908969 19:7178423-7178445 AAAACTCTGGATACTGGGCCGGG + Intronic
1161931022 19:7340171-7340193 AAAATTAAGAATTTGGGGCCGGG - Intergenic
1161936850 19:7377359-7377381 AATAGTCAGAATGCTGGGCGCGG - Intronic
1161972162 19:7588493-7588515 AAAAACCAACATTCTGGGCACGG - Intergenic
1162045392 19:7996482-7996504 AAAAAAAAGTGTTCTGGGCCAGG - Intronic
1162207074 19:9064135-9064157 AAAAAAAAAAATTCTTGGCCAGG + Intergenic
1162388772 19:10377198-10377220 ATAAATCAGAAAACTTGGCCAGG - Intronic
1163110137 19:15155342-15155364 AATAATGACAATTCTTGGCCGGG - Intergenic
1163322055 19:16580664-16580686 AAAGAGCTGAACTCTGGGCCGGG - Intronic
1163335369 19:16667911-16667933 TTAAATCAGAATTGTGGGTCAGG + Intronic
1163344715 19:16733223-16733245 AAAAAAAAAAAATCTGGGCCGGG + Intronic
1163357174 19:16821388-16821410 ATAAAACAGGATTCTGGGGCGGG + Intergenic
1163625151 19:18385269-18385291 AAAAAAAAGAATTCTGCGCCGGG - Intronic
1163825720 19:19523629-19523651 AAAAATATGTATTTTGGGCCGGG + Intronic
1163984235 19:20929823-20929845 AGAAATCAAAGTTTTGGGCCAGG + Intronic
1163989357 19:20984054-20984076 AAAAATCAGGATGTTCGGCCAGG + Intergenic
1163995508 19:21042490-21042512 AATAATCACGATTCTTGGCCGGG + Intronic
1164025761 19:21350740-21350762 AAAAATGAAACTTGTGGGCCTGG - Intergenic
1164078439 19:21842113-21842135 AAAAATCACAATCCCTGGCCAGG + Intronic
1164878523 19:31711197-31711219 TAAAAACTGAACTCTGGGCCCGG - Intergenic
1164952733 19:32351636-32351658 TAAAATAAGAATTCAGAGCCTGG + Intronic
1165201768 19:34150571-34150593 AAAAGTTAGAATTCTAGGCCAGG - Intergenic
1165241757 19:34474404-34474426 AAAAACCAAAAATGTGGGCCAGG + Intergenic
1165328502 19:35127679-35127701 GAAAATAAGATTTATGGGCCGGG - Intronic
1165459680 19:35936988-35937010 TGAACTCTGAATTCTGGGCCTGG + Exonic
1165497642 19:36162916-36162938 AAAAAAGAAAAATCTGGGCCGGG + Intergenic
1165539145 19:36476665-36476687 GAAAATGATCATTCTGGGCCAGG - Intronic
1165764398 19:38341604-38341626 AAAAATCAAAAAATTGGGCCGGG + Intronic
1165794275 19:38509750-38509772 TAAAATAATAATACTGGGCCGGG - Intronic
1165943531 19:39427623-39427645 AAAATTCAGATTCCTGGGCAGGG - Exonic
1166345710 19:42164072-42164094 AGAAATCAGAATTCTGAGTTTGG + Intronic
1166378310 19:42341134-42341156 TAAAAACAGAATTTTTGGCCAGG + Intronic
1166383268 19:42366492-42366514 AAAAAGAACAATGCTGGGCCAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166642800 19:44508683-44508705 AAAAAGAAGAAAACTGGGCCAGG - Intronic
1166643079 19:44511312-44511334 AAAAAGGAGAGTTCTGGGCCAGG - Intronic
1166744327 19:45133377-45133399 AAGAACGTGAATTCTGGGCCGGG - Intronic
1166744747 19:45136076-45136098 AAAAATCATCATTCCAGGCCAGG - Intronic
1166770259 19:45277661-45277683 AAAAAAAAAAATTCTTGGCCAGG - Intronic
1166993471 19:46707185-46707207 AGAAATCCTGATTCTGGGCCAGG - Intronic
1167230043 19:48276817-48276839 AAAAATCACCATTTTGGGCTGGG - Intronic
1167316036 19:48763276-48763298 AAAAATTAAAATTTCGGGCCAGG + Intergenic
1167555167 19:50190143-50190165 TAAAAACATAATACTGGGCCGGG - Intronic
1167632652 19:50635201-50635223 AAAAAGGAGCACTCTGGGCCAGG - Intronic
1167864486 19:52313431-52313453 AAAAAAAAGAATTATAGGCCAGG - Intronic
1167929237 19:52850602-52850624 AAAAATAACTATTATGGGCCGGG + Intronic
1168043157 19:53775095-53775117 AAAAAACAAATTTCTTGGCCAGG + Intergenic
1168082492 19:54020511-54020533 AAAATTCAAACTTCTAGGCCAGG + Intergenic
1168460926 19:56557210-56557232 AAAAAAAAAAATTCTTGGCCGGG - Intergenic
925203384 2:1987154-1987176 AAGAATCAGAATTTTAGGGCTGG + Intronic
925227863 2:2201402-2201424 AAAAATCATAAGTGTTGGCCGGG + Intronic
926089524 2:10041504-10041526 AAAAAACTGAACTCAGGGCCGGG - Intergenic
926169862 2:10546168-10546190 AAAAAGAAAAATTCTGGGCCAGG - Intergenic
926716498 2:15928434-15928456 AAAGATGAGATTTCTTGGCCAGG - Intergenic
926739346 2:16098140-16098162 AAAAATAAGAATGCTAGGCCAGG - Intergenic
926741066 2:16111301-16111323 AAAAGTGAAAAATCTGGGCCGGG - Intergenic
927147346 2:20175019-20175041 AAAAAAAAGAATTCTGGGCCAGG + Intergenic
927584742 2:24291781-24291803 ATAAAGCAGAAATATGGGCCGGG - Intronic
927604500 2:24474324-24474346 TAAAAACATAAATCTGGGCCGGG + Intergenic
927662623 2:25005749-25005771 AAAATGCAGTATTTTGGGCCGGG + Intergenic
927695569 2:25237470-25237492 AAAAGACTAAATTCTGGGCCAGG + Intronic
927899252 2:26807280-26807302 AAAAAAAAAAATTGTGGGCCAGG + Intergenic
928506056 2:31954286-31954308 AGAAATCATAATTCTTGGCCAGG + Intronic
928549173 2:32355084-32355106 AAAAATAGGAATACTTGGCCGGG - Intergenic
928957951 2:36890777-36890799 AAAAAATAGTTTTCTGGGCCAGG - Intronic
929134758 2:38613058-38613080 AGATATCAAAAGTCTGGGCCGGG - Intergenic
929191974 2:39148466-39148488 AAAAATCAAAATCCTCGGCCAGG + Intergenic
929204399 2:39274513-39274535 AAAAATGAAAATTCAGGGTCAGG - Intronic
929443285 2:41982942-41982964 AAATATCTGACTTCTGGGCCAGG + Intergenic
929535540 2:42781575-42781597 AAAAATAATTATTCTTGGCCAGG + Intronic
929579513 2:43072873-43072895 AAAATTCAGACTTCTGGGCTGGG + Intergenic
929637675 2:43541787-43541809 ATAAATTAAAATACTGGGCCTGG - Intronic
929883457 2:45857701-45857723 AAAAATCAAAATGCTGGGTGTGG - Intronic
930125014 2:47788865-47788887 AAATAGCAGTATGCTGGGCCGGG - Intronic
930190574 2:48455131-48455153 AAAAAAAAAAATTCAGGGCCGGG - Intronic
930589464 2:53310226-53310248 AAAAGTAAGAAATCTTGGCCAGG + Intergenic
930641412 2:53857892-53857914 AAAAATAAGAATTCCAGGTCAGG + Intronic
930756747 2:54982249-54982271 ATAAATCATACTTGTGGGCCGGG - Intronic
930800007 2:55434051-55434073 ACAAGTCACAAGTCTGGGCCTGG - Intergenic
930932938 2:56910529-56910551 AAAAATCAGACTTCTGGTTGTGG - Intergenic
930984008 2:57563142-57563164 AAATATCAGGATTCTAGTCCTGG + Intergenic
931351176 2:61490182-61490204 ATAAATGAAAAATCTGGGCCGGG - Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931731219 2:65155103-65155125 AAAAAGGAGAATTATGGGCTGGG - Intergenic
931742719 2:65262383-65262405 AAAAAAAAAAATTCTGGGCATGG - Intronic
931780082 2:65571885-65571907 AAAAATCGTACTTCTTGGCCAGG - Intergenic
932025715 2:68130423-68130445 AAATATCAAAATGGTGGGCCAGG - Exonic
932404041 2:71502044-71502066 AAAAATCACAAGTGTTGGCCAGG - Intronic
932684538 2:73857085-73857107 GAAAAACAGAATTCTGAGGCTGG - Intronic
932726674 2:74185534-74185556 AAATGTCGGAAGTCTGGGCCGGG - Intergenic
932769849 2:74494629-74494651 AAAATCCAGAGTTCTGGGACTGG + Exonic
932815151 2:74855527-74855549 TAAAATAAGGATTCTGGGCTGGG - Intronic
932983659 2:76700023-76700045 ATTAATCAAAATTCTGGGCAGGG - Intergenic
933238073 2:79887110-79887132 CAAAAACACAAGTCTGGGCCAGG - Intronic
933429423 2:82156485-82156507 AAAAATCACCATTCTTGGCCAGG - Intergenic
933554052 2:83809867-83809889 AATAAACAGTGTTCTGGGCCAGG + Intergenic
934639342 2:96017985-96018007 AAAAATCATTGTTCTTGGCCGGG - Intergenic
934718376 2:96556168-96556190 AAAAACCAGAATTTTTGGCCAGG + Intergenic
934794304 2:97087400-97087422 AAAAATCATTGTTCTTGGCCGGG + Intronic
935134087 2:100284129-100284151 AAAAATGACAATTCTGTGTCTGG - Exonic
935202496 2:100870192-100870214 GAAAGTCAGGAGTCTGGGCCAGG - Intronic
935227974 2:101070706-101070728 AAAAATCAGATTTGTTGGCTGGG - Intronic
935442568 2:103118771-103118793 AAAATTAAAAATTGTGGGCCTGG + Intergenic
935603369 2:104945459-104945481 AAAAATCAAACTTCTGGTCATGG + Intergenic
935633365 2:105230825-105230847 ACAATTAAGAATTGTGGGCCAGG - Intergenic
936034429 2:109099541-109099563 TAAAAACTGAGTTCTGGGCCAGG - Intergenic
936233151 2:110721675-110721697 AAAAAAAAGAGCTCTGGGCCGGG - Intergenic
936714301 2:115167264-115167286 AAAAAAAAAAAATCTGGGCCTGG + Intronic
937614201 2:123901150-123901172 AAAAATGTGACTTGTGGGCCAGG - Intergenic
937808114 2:126169509-126169531 AAAAATCAGAATTGCAGGCTGGG + Intergenic
938049135 2:128151144-128151166 GAAATTAAGAAATCTGGGCCGGG - Intronic
938210635 2:129463556-129463578 AAAAAAAAAAATTCTGGGCGTGG + Intergenic
938245065 2:129769885-129769907 AAAAGGCAGAGTTCAGGGCCTGG + Intergenic
938476876 2:131624078-131624100 AAGAAAATGAATTCTGGGCCGGG + Intergenic
939204684 2:139085561-139085583 AAAAGTCAGATTTCTGCCCCTGG + Intergenic
939364165 2:141211324-141211346 AAAACTAAGCATTCAGGGCCGGG + Intronic
939721475 2:145658315-145658337 AAAAAAAAAAATTCTTGGCCTGG - Intergenic
939965336 2:148605024-148605046 GAGAATAAGAATCCTGGGCCGGG - Intergenic
940048159 2:149432398-149432420 AAACCTCAGATTTCTGTGCCAGG + Intronic
940062784 2:149591040-149591062 CAACATGAGAATTCTGGGGCAGG - Intergenic
940230659 2:151447834-151447856 AAATAACAGAATTCCAGGCCAGG - Intronic
940535982 2:154944724-154944746 AAAGGTGAGAATTCTGGGCTGGG + Intergenic
940837173 2:158535714-158535736 AAAAATAATAATTATGGGCCAGG - Intronic
940932361 2:159448296-159448318 AAGAATCATGATTCTGGGCTGGG + Exonic
941586103 2:167361776-167361798 CAAAATCAGAGTTTTGGGCTGGG + Intergenic
941812940 2:169771989-169772011 TATAATTAAAATTCTGGGCCGGG + Intronic
942230555 2:173857691-173857713 AAAAATTAGAATTCTAGGCCAGG + Intergenic
942707091 2:178786473-178786495 GAAAATCAGAATTTTGGAGCTGG + Intronic
942884049 2:180900427-180900449 TAAAAGTAGCATTCTGGGCCAGG - Intergenic
943063947 2:183067801-183067823 AAAAAACACAATTTTTGGCCAGG - Intergenic
943370941 2:187014745-187014767 AAAAACCAAAATATTGGGCCGGG - Intergenic
943483932 2:188456327-188456349 AAAAATCGGTTTTCTGGGCTGGG + Intronic
943676843 2:190724021-190724043 AATTATAAGAATTCTAGGCCAGG + Intergenic
944142173 2:196468470-196468492 AAAAATCAGAATCCTAGGCAAGG - Intronic
944201491 2:197112412-197112434 AGAAATATGAATTCTGGGCCAGG + Intronic
944284985 2:197939351-197939373 CAAAATCAGAATTCTGGGAATGG + Intronic
944341537 2:198606297-198606319 AAAAAACAAGATTCTTGGCCAGG - Intergenic
944442833 2:199760142-199760164 ATAAACCAGAATTCTGGGGGTGG + Intergenic
944448643 2:199818647-199818669 TAAGATCAGAATTCTGTGCCAGG + Exonic
944642084 2:201738003-201738025 AAAATACAGAATTTTTGGCCTGG + Intronic
944767221 2:202876640-202876662 AAAAATCTGTATTTTTGGCCAGG + Exonic
944799112 2:203219558-203219580 AAAAACCAAAAATGTGGGCCGGG + Exonic
944960133 2:204863060-204863082 AAAAAACAGACTGCTGGTCCCGG - Intronic
945049159 2:205807017-205807039 AAAAATCAATATCGTGGGCCAGG - Intergenic
945500299 2:210564669-210564691 TAAAATGAGCATTCTAGGCCGGG - Intronic
945506155 2:210642858-210642880 AAAAATAATCACTCTGGGCCAGG - Intronic
946451305 2:219782172-219782194 TAAAAACACAAATCTGGGCCGGG - Intergenic
946920865 2:224581099-224581121 AAAAAACAGAACTATTGGCCGGG + Intronic
947194867 2:227552704-227552726 AAAAATCTGAAATATGGGCTGGG + Intronic
947502289 2:230680119-230680141 AAAATGCAGAGTACTGGGCCTGG + Intergenic
947549396 2:231035990-231036012 AATAATTAGACTTCTGGGGCCGG - Intergenic
947566814 2:231199333-231199355 AAAAGGCAGATTTCTGGGCATGG + Intronic
947608908 2:231509842-231509864 AAAAAACAGAATGCTGGGCATGG + Intergenic
947619998 2:231583768-231583790 CAAAATCAGAAAACAGGGCCGGG - Intergenic
947678234 2:232004875-232004897 AAAAATGAGAATTTTAGACCAGG - Intronic
947895146 2:233664179-233664201 AAAAATCAGCAGTGAGGGCCAGG - Intronic
947969993 2:234315366-234315388 AAAAATTTGAAATCTAGGCCAGG - Intergenic
948130183 2:235594867-235594889 AAAAAACAGCAATCTGGGCCGGG - Intronic
948142314 2:235682638-235682660 CAAAATCAGGGTTCTGTGCCAGG - Intronic
948525672 2:238569458-238569480 AAAAATAAGAATTATGGGGAAGG + Intergenic
1168833281 20:859159-859181 AAAAATCACAACCTTGGGCCTGG + Intergenic
1169116025 20:3066489-3066511 AAAAAAAAGATTTCTGGGCCAGG - Intergenic
1169243290 20:4003262-4003284 AAAAAGAAAAATTCTGGGCCGGG - Intronic
1169331321 20:4718738-4718760 AAAATACATAATGCTGGGCCGGG + Intergenic
1169366916 20:5000139-5000161 AAAAATCAGAATTCTGTGCTGGG - Intronic
1169427182 20:5505400-5505422 AAAAAACTAAGTTCTGGGCCAGG - Intergenic
1169550432 20:6696433-6696455 CAAAATAATGATTCTGGGCCTGG - Intergenic
1169559639 20:6786269-6786291 AAAAATCACTGTTCTGGGCTGGG - Intergenic
1169847047 20:10005313-10005335 GAAAATAAGAATACTGAGCCAGG - Intronic
1170201178 20:13745745-13745767 AAAAGTAAACATTCTGGGCCAGG - Intronic
1170201509 20:13749348-13749370 AATAATTGGAAGTCTGGGCCAGG - Intronic
1170616010 20:17951926-17951948 AAAAGTCATAATTCGCGGCCGGG + Intronic
1170727205 20:18940891-18940913 AAAAATCATAATTCCTTGCCAGG - Intergenic
1171050014 20:21849125-21849147 AAAAACCAGAAAAGTGGGCCAGG - Intergenic
1171126371 20:22605434-22605456 AAGAAACAGGATTTTGGGCCTGG - Intergenic
1171285110 20:23930468-23930490 AAAAAACAGAACTCTAGCCCAGG + Intergenic
1171755364 20:29103208-29103230 AAATATCAGAACTAGGGGCCCGG + Intergenic
1172144394 20:32745947-32745969 AAAAATAAAAATTCCGGGCCAGG - Intergenic
1172259715 20:33552362-33552384 AAAAATCAGAAGACAGGACCAGG - Intronic
1172542289 20:35728080-35728102 AAAAATAAGAATTGTAGGCCAGG - Intronic
1172552174 20:35809723-35809745 AAAAAAAAAAATTCTGGGCATGG + Intronic
1172667335 20:36609533-36609555 AAGACTCAGAACTCGGGGCCGGG - Intronic
1172711178 20:36924861-36924883 AAAAATTAGATTTCTCGGCCGGG + Intronic
1172721812 20:37004729-37004751 AAAAAAAAGAATTCTGGGGCCGG + Intronic
1172754737 20:37275460-37275482 AGAAATCAGATTTCTAGACCAGG + Intergenic
1172826101 20:37787637-37787659 AAAAAACACAGTTATGGGCCGGG - Intronic
1172933820 20:38604687-38604709 AAAAACCACTGTTCTGGGCCAGG - Intronic
1172983699 20:38964943-38964965 ATAACTCAGATTTCTGGGCTGGG + Intronic
1173190294 20:40870835-40870857 AAAAAGGAGAAATCTGGGCTGGG - Intergenic
1173489461 20:43468112-43468134 ATAAATTAAAACTCTGGGCCGGG + Intergenic
1173685076 20:44917665-44917687 CAAAATCAAAATTCTGGGCAGGG - Intronic
1173853223 20:46232147-46232169 AAAAAAAAGAATTCTGGCCTGGG - Intronic
1173974022 20:47173715-47173737 AAAAATGCAGATTCTGGGCCAGG - Intronic
1174017411 20:47500056-47500078 AAATATCTCATTTCTGGGCCGGG - Intergenic
1174026676 20:47582506-47582528 AAAAAACAAAAGTCAGGGCCAGG - Intronic
1174383049 20:50169796-50169818 TAAAATAAGGATTCTGGGCCAGG + Intergenic
1174384806 20:50180933-50180955 AAAAAACAGAATTACTGGCCGGG + Intergenic
1174430563 20:50465510-50465532 AAAAATAAATATACTGGGCCGGG + Intergenic
1174451001 20:50620329-50620351 TAAAATTAGGATCCTGGGCCAGG + Intronic
1174587857 20:51622758-51622780 AAAGACCCGGATTCTGGGCCTGG - Intronic
1174651205 20:52127243-52127265 TAAAAAAAAAATTCTGGGCCAGG - Intronic
1174818807 20:53710001-53710023 AAAAAATAGAATTCTGGGCTGGG - Intergenic
1174819265 20:53713148-53713170 AAAAATCAAAATCCTGGCCCAGG - Intergenic
1174956916 20:55107715-55107737 ACAAAGCAGAATTCAGAGCCAGG - Intergenic
1174980334 20:55387375-55387397 AAAAATCTGAGAGCTGGGCCAGG + Intergenic
1175200262 20:57272065-57272087 TAAAATCAGAATTCTGACGCCGG + Intergenic
1175777926 20:61664519-61664541 TAAAACCAGACTCCTGGGCCCGG - Intronic
1176006526 20:62866888-62866910 AAAAAAAAAAATTCTGGGCACGG + Intergenic
1176006780 20:62869277-62869299 AAAAAAAAGAATTTTGGGCTGGG - Intergenic
1176455384 21:6903787-6903809 AAAAATCAGACTTGGGTGCCGGG + Intergenic
1176790587 21:13314697-13314719 CAAGATAAGAATTATGGGCCAGG + Intergenic
1176833556 21:13768835-13768857 AAAAATCAGACTTGGGTGCCGGG + Intergenic
1176942440 21:14940255-14940277 AAAAATGGGAATCATGGGCCAGG - Intergenic
1177133804 21:17289561-17289583 AAAAAAAAAAAATCTGGGCCAGG + Intergenic
1177484993 21:21745799-21745821 AAAAAGCAGTTTTGTGGGCCGGG + Intergenic
1177537221 21:22443418-22443440 AAAAATATATATTCTGGGCCAGG - Intergenic
1177575581 21:22950739-22950761 AAAAGTCCAAATTCAGGGCCAGG + Intergenic
1177643587 21:23874238-23874260 AAAAGTGAGAGTTCTTGGCCAGG - Intergenic
1177989766 21:28022986-28023008 CAAGATAAGAATTATGGGCCAGG + Intergenic
1178178116 21:30128439-30128461 AAAATTCAGGATTCAGGGCCAGG - Intergenic
1178450284 21:32692279-32692301 AAAAATGAGGATTCCTGGCCGGG + Intronic
1178864942 21:36319724-36319746 AAAAAAAAGAGTTCTGGGGCCGG - Intergenic
1179149495 21:38797669-38797691 AAAGAGCAGAGGTCTGGGCCTGG + Intergenic
1179318391 21:40267599-40267621 TAAAATCTGGATTATGGGCCGGG + Intronic
1179467986 21:41590632-41590654 AAAAATACCAATTCAGGGCCGGG + Intergenic
1179501109 21:41809524-41809546 AAAAATGAAAAATCTGGGCCGGG - Intronic
1179637500 21:42722804-42722826 TAGAATCAGAATTATGGGTCAGG + Intronic
1179772803 21:43635942-43635964 AAAAAACAGAATCATAGGCCAGG + Intronic
1179834445 21:44020418-44020440 AAAAATAAGAAAAATGGGCCAGG - Intronic
1180236604 21:46464001-46464023 AAAATTAAGAATTATGGGCCAGG - Intronic
1180756001 22:18161652-18161674 TTAAACCAGAATTCTGGGTCCGG - Intronic
1180941564 22:19662651-19662673 AAAGATAAGAATTTTAGGCCAGG - Intergenic
1181075767 22:20375751-20375773 TTAAACCAGAATTCTGGGTCCGG + Intronic
1181079606 22:20405313-20405335 TCAAATCTGAATTCTAGGCCAGG + Intronic
1181090449 22:20468949-20468971 ACATATCAGGCTTCTGGGCCAGG - Intronic
1181156540 22:20925341-20925363 AAATATTTTAATTCTGGGCCGGG + Intronic
1181322423 22:22018522-22018544 AAAAATCAGAGTTGTGGGGTAGG + Intergenic
1181922517 22:26331686-26331708 TAAAACAAGAAGTCTGGGCCAGG + Intronic
1181966489 22:26659540-26659562 AAAAATGAGAATTTTGGGCTGGG + Intergenic
1181989666 22:26827876-26827898 AGAATTCAGCATTCTGGGCAAGG + Intergenic
1182160667 22:28118101-28118123 TAAAAAAAGAATTATGGGCCAGG + Intronic
1182162428 22:28136440-28136462 AAAAATAAGCATTTTGGGCTGGG - Intronic
1182305116 22:29362638-29362660 AAGAATGGGAAATCTGGGCCAGG - Intronic
1182312426 22:29418791-29418813 AAGAATGGGAAATCTGGGCCAGG - Intronic
1182612988 22:31564803-31564825 AAAAAAAAAAATTCTGGGCCAGG - Intronic
1182687835 22:32134473-32134495 AAGAATGGGAAATCTGGGCCAGG + Intergenic
1182847984 22:33447188-33447210 TCAAAACACAATTCTGGGCCAGG - Intronic
1183018930 22:35011820-35011842 TAAAAGCAGAGTCCTGGGCCGGG + Intergenic
1183109931 22:35641532-35641554 AAAGACCAGACTTCTGGTCCTGG + Intergenic
1183205544 22:36416532-36416554 AAAAAAAAGAAATCTTGGCCAGG - Intergenic
1183212423 22:36459095-36459117 AAAAACCAGGATTTGGGGCCTGG + Intergenic
1183397366 22:37579727-37579749 AAAAAACAGCATCTTGGGCCAGG - Intronic
1183803886 22:40192169-40192191 AAAATCCAAATTTCTGGGCCAGG - Intronic
1184276979 22:43414398-43414420 AAAAATCAGCATTCTGGGTGCGG + Intronic
1184542915 22:45141536-45141558 AAAAAAAAAAAATCTGGGCCAGG + Intergenic
1184574031 22:45347747-45347769 ATAAATTGGCATTCTGGGCCAGG - Intronic
1185122889 22:48983331-48983353 GAAAATGGGACTTCTGGGCCGGG + Intergenic
1185135564 22:49069912-49069934 CAAAATTAGAATACTGGGCCAGG - Intergenic
949356235 3:3183138-3183160 CAAAATCAGAGTTCTTGGCAAGG - Intergenic
949403712 3:3693119-3693141 AAAAATTAGAAATCTAGGCTGGG - Intergenic
949476097 3:4447070-4447092 AAAAATTCTAATTCTGGACCTGG + Intronic
949490870 3:4587564-4587586 CAAAATGAGAAGTGTGGGCCGGG - Intronic
949609290 3:5687628-5687650 AAAAATGAGAATCCAGGGCATGG - Intergenic
950686967 3:14625682-14625704 AAAAACCAGAACTCAGGGACTGG - Intergenic
950696780 3:14706952-14706974 AAAAATTATATGTCTGGGCCGGG + Intronic
951097480 3:18648914-18648936 TAAGATGAAAATTCTGGGCCAGG + Intergenic
951483057 3:23182212-23182234 AAACAAGAGTATTCTGGGCCAGG - Intergenic
951554662 3:23909224-23909246 GAAAAACAGAAATGTGGGCCAGG + Intronic
951577199 3:24126095-24126117 TAAAAAAAGAATTCTAGGCCAGG + Intronic
951589974 3:24254066-24254088 AAAAATCAGATTTACCGGCCGGG + Intronic
951649631 3:24936688-24936710 AAAAATCATAATTTTCTGCCTGG - Intergenic
951764670 3:26184372-26184394 AAAAATTTGAGGTCTGGGCCGGG - Intergenic
952507166 3:34017797-34017819 AACTATCAGAAATGTGGGCCTGG + Intergenic
952779043 3:37076226-37076248 AAAAATAAAAATTTTGGGCTGGG + Intronic
952802520 3:37309258-37309280 AAAAATAACAATTATAGGCCGGG + Intronic
953010239 3:39018521-39018543 AAAAATCATTGTTTTGGGCCAGG + Intergenic
953046899 3:39301644-39301666 AAAAAACAAAATTTTGGGCTGGG + Intergenic
953332166 3:42063038-42063060 TAAAGTCAGAATTCCAGGCCTGG + Intronic
953671639 3:44967730-44967752 AAAAATCAGAATTTTAGAGCTGG + Intronic
954050378 3:47970517-47970539 AAACATCAGAAGGCTGGGCGTGG + Intronic
954062359 3:48078872-48078894 AAAAATCTCAATCCTGGGCTGGG + Intronic
954083905 3:48228940-48228962 AAAAATCAAGATACTGGGCCGGG - Intergenic
954183808 3:48901577-48901599 AAAAAAAAGAATTATGGGCCGGG + Intergenic
954187718 3:48931719-48931741 AAAAATCACAATTTTCAGCCGGG + Intronic
954501566 3:51021954-51021976 AAAAATGTAAATTCTCGGCCAGG - Intronic
954650395 3:52158200-52158222 AGAAAACAGAATTCAGGGCTGGG - Intergenic
954821938 3:53337164-53337186 AAAAATGAGAAGTCTTGGCCAGG - Intronic
954961478 3:54569277-54569299 TAAAATCAGAAATTTTGGCCTGG - Intronic
955107043 3:55908444-55908466 AGAAAGCAGAATTCTGCTCCAGG + Intronic
955282191 3:57603915-57603937 AAAAAAAAAAATTCTGGGCTGGG - Intergenic
955416709 3:58698861-58698883 AAAATTCACAATGGTGGGCCAGG - Intergenic
955577062 3:60377450-60377472 AAAAAAAAGAATTCTTGGCTGGG - Intronic
955986743 3:64581540-64581562 AAAAATGAGAAATCTTGGCCAGG - Intronic
956117120 3:65930019-65930041 AAAAATTATATTTCTAGGCCGGG + Intronic
956499530 3:69866941-69866963 AAACATCAGAATTGTCTGCCTGG + Intronic
956535738 3:70273955-70273977 CAAAAAGAAAATTCTGGGCCGGG - Intergenic
956857823 3:73293298-73293320 AAAAATCAAAAGAATGGGCCGGG + Intergenic
956972018 3:74537409-74537431 AAAAATACAAATTCTGGGCCTGG - Intergenic
957528732 3:81412560-81412582 AAAAAGAAAAAATCTGGGCCGGG - Intergenic
957673163 3:83331820-83331842 AAAAATATGAATTCTGGCCTGGG - Intergenic
957858384 3:85909017-85909039 AAAAATCACAACTGTAGGCCGGG - Intronic
957963405 3:87290056-87290078 AAAAAAGAAAAATCTGGGCCTGG + Intergenic
958031487 3:88116223-88116245 AAAAATAAGATATATGGGCCAGG + Intronic
958599588 3:96278351-96278373 AAAAATAACAGTTCTTGGCCGGG + Intergenic
958894680 3:99816534-99816556 AAAATTAAGAAGTATGGGCCGGG - Intergenic
958980709 3:100715865-100715887 AAAAATCTGAATTGTAGGCTGGG - Intronic
959371810 3:105536387-105536409 AACAGAAAGAATTCTGGGCCGGG - Intronic
959756537 3:109906158-109906180 AAAAAACAGTCTTGTGGGCCAGG - Intergenic
959785719 3:110295079-110295101 AAAAAACAGTTTCCTGGGCCAGG - Intergenic
960102953 3:113764079-113764101 AAAAATCAAAAAGCTGGGCATGG + Intronic
960572896 3:119203045-119203067 AAAAATCTGATATCTAGGCCAGG + Intronic
960590946 3:119364795-119364817 AAAAAAAACAATTCTTGGCCAGG + Intronic
960807072 3:121594161-121594183 AATAATAGAAATTCTGGGCCAGG - Intronic
960980852 3:123224496-123224518 AAAAATCAAGACTTTGGGCCAGG + Intronic
961018814 3:123487018-123487040 AGAAATGAGAGTTCTGGGCTGGG + Intergenic
961055314 3:123783199-123783221 CAAAAGCAGAATTCTTGGCAAGG + Intronic
961113259 3:124303938-124303960 AAAAATCAAGATTCTGAGGCAGG + Intronic
961170586 3:124795194-124795216 ATAAAGAGGAATTCTGGGCCGGG + Intronic
961255970 3:125552820-125552842 AAAAATAAGCATTCTTGGCCAGG + Intronic
961399026 3:126621299-126621321 ATGAATCAGGATTCTGGTCCTGG - Intronic
961463818 3:127069585-127069607 AAAAATGAGAATTAAGGGCTAGG + Intergenic
961625182 3:128257038-128257060 AAAAACATAAATTCTGGGCCAGG - Intronic
961775957 3:129285740-129285762 AAAAAAAAAAATCCTGGGCCGGG - Intronic
962213716 3:133501822-133501844 AAGAAAGAGGATTCTGGGCCGGG + Intergenic
962217532 3:133535554-133535576 TAAAATGAAAATTCTGGGCTGGG + Intergenic
962537046 3:136339244-136339266 AAAAAATAAATTTCTGGGCCAGG + Intronic
962585949 3:136843026-136843048 AAAAATCAGAGTTCTGGGCCAGG + Intronic
962850459 3:139304863-139304885 AAAAATTAGAACTCAGGGCCCGG + Intronic
963005658 3:140724233-140724255 CAAAATCAGGACTCTGGGCTGGG - Intergenic
963931106 3:151005104-151005126 AAAAGTGCGAATTCTGGTCCAGG - Intergenic
964110310 3:153080419-153080441 TAAAAACATAATTTTGGGCCGGG - Intergenic
964583622 3:158269792-158269814 AGAAATCTGTTTTCTGGGCCAGG - Intronic
964712235 3:159683344-159683366 AAAATGCAGATTCCTGGGCCGGG - Intronic
964717618 3:159739236-159739258 AAAAATCAAACTTCTTAGCCTGG - Intronic
964856411 3:161150693-161150715 AAAAATCTGGAGTCAGGGCCGGG + Intronic
964883635 3:161453343-161453365 AATAATAATACTTCTGGGCCGGG - Intergenic
965844990 3:172951077-172951099 AAACATAAAAATTCTGGGGCTGG + Intronic
965883297 3:173413304-173413326 AAAAATGAGACTTCTCGGCCGGG + Intronic
965970948 3:174555593-174555615 AAAAAACTGAATTTTTGGCCAGG - Intronic
965982066 3:174705487-174705509 AAAAATTCCAGTTCTGGGCCGGG + Intronic
966023260 3:175242153-175242175 AAAAATCTGCATCCAGGGCCGGG - Intronic
966405280 3:179591225-179591247 AGAAATCAGAATTCAAGGCTGGG - Intronic
966692527 3:182756420-182756442 ATAAATCAGAATTTAGGGCCAGG - Intergenic
966796003 3:183714096-183714118 AAAATTTAAAATTATGGGCCGGG - Intronic
966805523 3:183804690-183804712 AAAAAACAGACCACTGGGCCGGG + Intronic
966840861 3:184086255-184086277 AAAAATCAGTCTTCTTGGCCGGG + Intergenic
966953852 3:184852720-184852742 AACAAACAGAGTTCTGGGCCTGG + Intronic
967056697 3:185835520-185835542 AAAAATCACAAGTTTGGGCTGGG + Intergenic
967333715 3:188319051-188319073 AAGAATCATAATTTTTGGCCGGG - Intronic
967391417 3:188959472-188959494 AAAAAAGTGAATTCTGGCCCTGG - Intronic
967402052 3:189074497-189074519 AAAGAAAACAATTCTGGGCCGGG - Intronic
967484053 3:190009465-190009487 AACACTCAGCATTCAGGGCCAGG - Intronic
968014674 3:195318956-195318978 AAAAAATAGTATTGTGGGCCAGG + Intronic
968016716 3:195341616-195341638 AAAAACTAGAAATCTGGGCCAGG - Intronic
968023016 3:195412027-195412049 AAAAATAAGAATTGGGGGCTGGG + Intronic
968151739 3:196342469-196342491 AAAAATCTGAGTGCTAGGCCAGG - Intergenic
968245121 3:197137672-197137694 AAACGTAAGAATTTTGGGCCAGG + Intronic
968366618 3:198190264-198190286 AAAAAACAAAATTCCTGGCCAGG - Intergenic
968879089 4:3289497-3289519 AAAAATAAAAATTGTAGGCCAGG - Intergenic
968932904 4:3592151-3592173 AAAAATATAAATTGTGGGCCGGG - Intergenic
969295036 4:6264790-6264812 AAAATGCAGATTCCTGGGCCTGG + Intergenic
969419511 4:7083867-7083889 AAAAAATAGAAATCTGGGGCAGG - Intergenic
970395961 4:15666100-15666122 AAAAATATGAATTTTGGGACTGG + Intronic
970451012 4:16166456-16166478 AAAACTCAGAACACTGGGCCAGG + Intronic
970585147 4:17508139-17508161 AATAATCAGATATGTGGGCCAGG + Intronic
970899666 4:21144001-21144023 CAGAATAAGAACTCTGGGCCTGG - Intronic
970921102 4:21396258-21396280 AAAAATGAGGATCCTGGGCCGGG + Intronic
971765640 4:30826935-30826957 AAAAATAAGAATTCCTAGCCTGG - Intronic
971874631 4:32290889-32290911 AGAAATGACACTTCTGGGCCGGG - Intergenic
972111900 4:35573315-35573337 TCAAATCAGGTTTCTGGGCCAGG + Intergenic
972148030 4:36053297-36053319 AAAAAACTGCATGCTGGGCCGGG - Intronic
972305212 4:37824277-37824299 AAAAAAAAAAAGTCTGGGCCTGG + Intergenic
972347095 4:38201544-38201566 GAAATGCAGAATTTTGGGCCTGG + Intergenic
972510855 4:39767616-39767638 AAAACTGATAATCCTGGGCCGGG - Intronic
972519847 4:39843436-39843458 AAAAATAAACATTTTGGGCCAGG + Intronic
972606708 4:40620210-40620232 AAAAAAAAAAACTCTGGGCCGGG + Intronic
972727712 4:41760015-41760037 TAAAATAAGAGTTTTGGGCCGGG - Intergenic
972751484 4:41993859-41993881 AAAAATTATAATTCAGGGCTGGG + Intronic
973052978 4:45617309-45617331 AAAAATCAGCTTTCTAGGCTGGG - Intergenic
973175022 4:47195069-47195091 ATAAATCAATATCCTGGGCCGGG + Intronic
973232768 4:47861154-47861176 AAAACACAGATTGCTGGGCCGGG - Intronic
973992325 4:56421973-56421995 TTAAAACACAATTCTGGGCCAGG + Intronic
973997450 4:56473471-56473493 GAAAATCAGTTTTCTGGGTCGGG + Intronic
974109195 4:57507185-57507207 AAAAATCTAAATTCCTGGCCGGG + Intergenic
974314968 4:60267705-60267727 CAAAATCAGAATTGTGACCCAGG - Intergenic
974701474 4:65453983-65454005 AATAATATGAATTGTGGGCCAGG + Intronic
974725634 4:65794910-65794932 AAAAATTGGTTTTCTGGGCCAGG - Intergenic
975644766 4:76535335-76535357 AAGAATCAGAATTCAGGCTCAGG - Intronic
975659604 4:76675283-76675305 AAAAAGCAGAATTCTTAACCTGG + Intronic
975676738 4:76834684-76834706 CAAAATCAGATGTCTGGCCCAGG + Intergenic
975700578 4:77062277-77062299 AAAAATTAAATTTCTGGGCATGG + Intronic
975814360 4:78202393-78202415 AAAAGTCAGTTTTCTGGGCTGGG + Intronic
976031888 4:80765210-80765232 AAAAATCAAAACTCTGGGCATGG + Intronic
976078934 4:81332556-81332578 AAAAATCTGATTTCTGAGTCTGG - Intergenic
976237598 4:82915550-82915572 AAAAAACACACTTATGGGCCAGG - Intronic
976734234 4:88294673-88294695 AGAAAAAAAAATTCTGGGCCAGG + Intergenic
976847199 4:89503504-89503526 AAGAATGAAAATCCTGGGCCGGG + Intergenic
976994316 4:91411634-91411656 AAAAATCATAATTATGGGTTTGG - Intronic
977073801 4:92427965-92427987 AAAAATAATAGTTTTGGGCCAGG + Intronic
977100744 4:92811076-92811098 AAAAATCTTGATTCTAGGCCAGG - Intronic
978608338 4:110507678-110507700 CAAAATCAGAATATTGGGCCAGG + Intronic
978786606 4:112616539-112616561 AAGAAACACAATTATGGGCCAGG + Intronic
978813701 4:112878916-112878938 AAAAATAAGAATCAGGGGCCGGG - Intronic
978885100 4:113760143-113760165 AAAAATCAGCATTCACGGCTTGG + Intronic
979333313 4:119440640-119440662 AAAAAACAAAATTCCTGGCCTGG + Intergenic
979346329 4:119591854-119591876 AAAAAGCTGTGTTCTGGGCCGGG + Intronic
979413292 4:120405660-120405682 AAAATTCAAATTTCAGGGCCAGG - Intergenic
979615541 4:122738503-122738525 AGAAATTAGAAATCTAGGCCAGG - Intronic
979702015 4:123679885-123679907 AGTAATCAGAATACTGAGCCTGG - Intergenic
979847280 4:125531540-125531562 AAAAAGTAAAATTCTAGGCCAGG - Intergenic
980468428 4:133217706-133217728 AAAAATCAAAATATTGGGCTGGG + Intergenic
980502182 4:133670359-133670381 AAAAATCATAATTCTAGGCCAGG - Intergenic
980758469 4:137196830-137196852 AAAAATAAGTATTATGGGCCAGG - Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
981049468 4:140296045-140296067 AAAATGCAGATTCCTGGGCCTGG - Intronic
981475780 4:145185257-145185279 AGAAAAAAGAATTATGGGCCAGG - Intergenic
981712458 4:147722792-147722814 AAAAATGAGAAATCCAGGCCAGG + Intergenic
981783825 4:148455531-148455553 AAATATCAGCATATTGGGCCGGG - Intergenic
982046579 4:151453309-151453331 AAAAATTAAAACTATGGGCCAGG - Intronic
982254508 4:153439051-153439073 AAAAATCGGGATTCTAGGCCGGG + Intergenic
982277839 4:153655276-153655298 TAAAATCTGAAATCTGGGTCTGG - Intergenic
982690453 4:158542231-158542253 GAAAAGCATCATTCTGGGCCAGG - Intronic
983061303 4:163164734-163164756 AAAAAAGGGAATTCTGGGCATGG + Intronic
983126277 4:163955043-163955065 AAAAATAAGAAATATGGGCATGG - Intronic
984482249 4:180320116-180320138 AAAAATCAAATTTTTCGGCCAGG - Intergenic
984825498 4:183920396-183920418 AAAAATAAGAAGGCTGGGTCTGG - Intronic
985032720 4:185806751-185806773 CAAAAACAGGATTCTAGGCCGGG - Intronic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985285280 4:188330771-188330793 AAGTATCAGAAGTGTGGGCCTGG - Intergenic
985857082 5:2436836-2436858 AAAAATCTGAAATTTAGGCCGGG - Intergenic
986687353 5:10286367-10286389 AATACTCAGAATTCAGGGCAGGG - Exonic
986696953 5:10365585-10365607 AAAAATTCCAATTCTCGGCCAGG - Intronic
987272821 5:16329666-16329688 GAAAAATAGAATTTTGGGCCAGG - Intergenic
987359093 5:17090640-17090662 AAAATTGAGAATTATAGGCCAGG - Intronic
987417606 5:17680329-17680351 AAAAATAAGCATTGTTGGCCGGG - Intergenic
987442500 5:17973526-17973548 AGAAATCTGACTTCTGTGCCTGG - Intergenic
987509341 5:18815485-18815507 AAAAAACAGTTTTGTGGGCCAGG - Intergenic
987942433 5:24557962-24557984 AAAAATTTGAATTCTGGGGGTGG - Intronic
988042273 5:25904946-25904968 AAAAATCAGAAGTCTGGTCCTGG + Intergenic
988440364 5:31226468-31226490 AGAAATAAGTACTCTGGGCCGGG - Intronic
988526495 5:31991731-31991753 AAAACTGACAATTGTGGGCCCGG + Intronic
988726652 5:33933133-33933155 AAAAATTTGAATTCTGGGTTGGG - Intergenic
989009579 5:36855190-36855212 AAAAATTTGAATTCTGGGTCTGG + Intergenic
989185614 5:38622575-38622597 AAAAATGAGAATTACGGGCAAGG - Intergenic
989229478 5:39070168-39070190 AAAAGTTAGAGTTCAGGGCCGGG + Intronic
989748723 5:44864501-44864523 ACAAATAAGAATTACGGGCCAGG - Intergenic
990247587 5:53878831-53878853 AAAAATAAAAAATTTGGGCCAGG + Intergenic
990383712 5:55239215-55239237 TAAAATGTGATTTCTGGGCCTGG + Intergenic
990515572 5:56528127-56528149 AAAGTACAGATTTCTGGGCCAGG - Intronic
991314695 5:65287823-65287845 AAAAATCATAATTATTGGCCAGG - Intronic
991356344 5:65773111-65773133 AAAAAATAGAATTCAGGGCTGGG - Intronic
991386340 5:66094368-66094390 AAAAATGAGAAATCAGGGCCAGG - Intergenic
991664606 5:68986198-68986220 AAGAATCAGGGTTCTTGGCCGGG + Intergenic
991677514 5:69102562-69102584 GAAAATAAGAGTTCTCGGCCAGG + Intronic
991699242 5:69301739-69301761 AAAAAAAAGAAATCTGGGCATGG + Intronic
991724437 5:69522124-69522146 AAAAATAAGAAGTCTGGGCATGG - Intronic
992257668 5:74937501-74937523 AAAAAACAGACTTTAGGGCCAGG - Intergenic
992436194 5:76758166-76758188 AAATATCAGAATTTTCAGCCGGG - Intergenic
992633483 5:78704090-78704112 AATGTTCAGAATTCTAGGCCTGG + Intronic
992635653 5:78723712-78723734 AAGAATCAGAAATCTAGGCCAGG + Intronic
992723234 5:79581007-79581029 AAAACTCCAAATTCTCGGCCGGG + Intergenic
992820333 5:80489627-80489649 AAAAAACAAATTTTTGGGCCGGG + Intronic
992905436 5:81340653-81340675 AAGAATCATACTTTTGGGCCAGG - Intronic
993382255 5:87221215-87221237 AAAAATCTGGATTCTGGGCATGG - Intergenic
993640836 5:90403574-90403596 AAAAATCACAATTTTTGGCCGGG + Intronic
994695408 5:103067508-103067530 AAAAATCACAAATTTTGGCCAGG - Intergenic
995004935 5:107181037-107181059 AGACATGAGAATACTGGGCCAGG - Intergenic
995241708 5:109892194-109892216 AAAAATCTGAACTTTTGGCCAGG - Intergenic
995507129 5:112872277-112872299 ACACATCTGAATTCTGGGCTGGG - Intronic
996034642 5:118745089-118745111 AAAAATGATTATTCTAGGCCAGG + Intergenic
996571213 5:124934140-124934162 AAAATTTAGAAGTTTGGGCCAGG - Intergenic
996740674 5:126795919-126795941 AAAAAAAAGCATCCTGGGCCAGG - Intronic
997119649 5:131161305-131161327 AAAAATTTGTATTCTGGGGCTGG + Intronic
997296204 5:132770473-132770495 AAAATATAGATTTCTGGGCCAGG - Intronic
997928508 5:138052938-138052960 AAAAAACAGAATTTCTGGCCAGG + Intergenic
998239709 5:140429079-140429101 AAAAAAAAAAATTCTAGGCCGGG - Intronic
998309045 5:141108472-141108494 AAAAATTAGTGTTCTGGGACTGG + Intronic
998686561 5:144533685-144533707 AAAAATCACAAATCCAGGCCAGG - Intergenic
998687337 5:144543561-144543583 AAACATAAAGATTCTGGGCCGGG - Intergenic
998836469 5:146206876-146206898 AAAAATAAGTATTCTAGACCAGG - Intronic
998883836 5:146673567-146673589 AAAATGCAGAATTCTCAGCCTGG - Intronic
999041709 5:148420950-148420972 AAAAATTAAAATTCTTGGCTTGG - Intronic
999041756 5:148421257-148421279 AAAAATTCAAATTCTTGGCCGGG - Intronic
999145548 5:149390932-149390954 AAAAACCAAAATCCTGGTCCAGG - Intronic
999821285 5:155231611-155231633 AAAAAGGAGCATTCTTGGCCAGG - Intergenic
999894225 5:156011731-156011753 TAAAAATAGAATTCTGGGCCAGG - Intronic
1000093876 5:157953835-157953857 AGAAATACGAATTATGGGCCGGG + Intergenic
1000103993 5:158041291-158041313 AAAAATCAGAGCCTTGGGCCAGG - Intergenic
1000256093 5:159540125-159540147 AAAACACAGATTTCAGGGCCAGG + Intergenic
1000310799 5:160042523-160042545 AAAGAACTGAATTCTGGTCCTGG - Intronic
1000434952 5:161196708-161196730 AAAAAGCAGAAGTCATGGCCAGG - Intergenic
1000559753 5:162771061-162771083 ATAAGTAAGAATTCTAGGCCCGG - Intergenic
1001037105 5:168305117-168305139 AAAAAAAAAAATACTGGGCCAGG - Intronic
1001046507 5:168376347-168376369 AAAAATGACAAATATGGGCCAGG - Intronic
1001157444 5:169285210-169285232 AAAAATCTGTATTCAGGCCCAGG - Intronic
1001610095 5:172993557-172993579 AAAAATAAGAGTTCTGGGCCAGG + Intronic
1001616089 5:173044840-173044862 AAAAATCAAAATGGAGGGCCGGG - Intergenic
1001921459 5:175603401-175603423 TAGAATAAGAATTCTTGGCCAGG + Intergenic
1002119724 5:176993187-176993209 AAAAAAAAAAATTCTTGGCCGGG + Intronic
1002255780 5:177957752-177957774 ATAAATCAGACTTCTGCACCTGG - Intergenic
1002387536 5:178879672-178879694 AAAACTCTGGTTTCTGGGCCAGG - Intronic
1002725841 5:181295471-181295493 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1003212909 6:4083005-4083027 TAAAATCTGAATCCTGGGCATGG - Intronic
1003327975 6:5107097-5107119 ACAAATCCGAATTCTGTGGCAGG - Intronic
1003354550 6:5354887-5354909 AAAAATAGGAACTCTGGGGCAGG - Intronic
1003487498 6:6592237-6592259 AAAAAGCAGAAGTCCTGGCCTGG + Intronic
1003699652 6:8447521-8447543 CAAGCTAAGAATTCTGGGCCGGG - Intergenic
1003841043 6:10119644-10119666 AAAAATCAAAATATTGGGCCAGG + Intronic
1004024133 6:11802826-11802848 AAAAAACAGGATTCTTAGCCAGG + Intronic
1004126634 6:12880549-12880571 AAAAGTATGAATTCTAGGCCAGG - Intronic
1004227936 6:13804477-13804499 AAAAAGTAGAAGTCTTGGCCGGG + Intronic
1004258813 6:14089792-14089814 AAAGATTAGATTTCTGGGCTGGG - Intergenic
1004362062 6:14979897-14979919 AAGAATGTGAATTGTGGGCCAGG - Intergenic
1004383941 6:15155926-15155948 AATAAACAGAAATATGGGCCAGG - Intergenic
1004706022 6:18124528-18124550 AAAAATAAGAGTTTAGGGCCAGG - Intergenic
1004847157 6:19656876-19656898 AAGAAACATAATTCTAGGCCGGG - Intergenic
1004892049 6:20110202-20110224 AAAAAAAAGAGTCCTGGGCCGGG - Intronic
1005155012 6:22794587-22794609 AAAAATCAGATGGTTGGGCCAGG + Intergenic
1005343304 6:24864004-24864026 AAAAAACATTATTCTAGGCCGGG + Intronic
1005380995 6:25234230-25234252 AAAAATGAGAATTCTCAGCCAGG - Intergenic
1005497557 6:26401546-26401568 AAAAATGTGCATTGTGGGCCGGG + Intergenic
1005686499 6:28258480-28258502 TAAAATCATGACTCTGGGCCGGG + Intergenic
1005830296 6:29665389-29665411 AAAAATCACAAATATTGGCCAGG - Intronic
1005867692 6:29948493-29948515 GAAAGTCAGAATGCAGGGCCTGG + Intergenic
1005943594 6:30579749-30579771 AAAAATGATAGTTCTTGGCCGGG - Intronic
1006165681 6:32063090-32063112 AAAAAACAGCAATCAGGGCCAGG + Intronic
1006345313 6:33476476-33476498 AAAAATTAAAATTTTAGGCCGGG + Intergenic
1006555376 6:34861419-34861441 AAAAATTAAAATTATAGGCCAGG - Intronic
1006616485 6:35331512-35331534 AAAAATCACAAATTTGGGCCAGG + Intergenic
1006777481 6:36606828-36606850 AAAAATGAAACTTCTAGGCCGGG - Intergenic
1007046664 6:38782575-38782597 AAAAATAAAATTTCTTGGCCGGG - Intronic
1007121963 6:39389733-39389755 AATAATTACAAATCTGGGCCAGG + Intronic
1007669882 6:43543168-43543190 AAAAGTCAGAATAGTGGGCTGGG + Intronic
1007855322 6:44849520-44849542 AAAAATTAGTATTCATGGCCGGG - Intronic
1007884536 6:45211553-45211575 TTAAAAGAGAATTCTGGGCCAGG + Intronic
1007913299 6:45537180-45537202 CAATATCAGAATTCTGGGGCTGG + Intronic
1008018832 6:46552787-46552809 AGAAATGCAAATTCTGGGCCAGG + Intronic
1008101217 6:47393123-47393145 TAAAATTAGACTTTTGGGCCAGG - Intergenic
1008790144 6:55221516-55221538 AAAAATTAAAGATCTGGGCCGGG + Intronic
1009334860 6:62474568-62474590 TAAAATGAAAATTATGGGCCAGG + Intergenic
1009417243 6:63429438-63429460 AAAATCAAGAAATCTGGGCCAGG + Intergenic
1010138605 6:72585950-72585972 AGAAGTAAGAATTTTGGGCCAGG - Intergenic
1010155415 6:72786709-72786731 AGAAATGAGAATCCTGGGCCGGG + Intronic
1010383318 6:75248955-75248977 AAAAGACAGAATTTTGGGCCGGG + Intronic
1010518692 6:76806303-76806325 AAATAACAGAATTCTGGCCTGGG - Intergenic
1010885018 6:81225709-81225731 AAAAATCAGTTTTATAGGCCTGG - Intergenic
1010905239 6:81479045-81479067 AAAAATTAGAATCCTGGCCCAGG - Intergenic
1011250992 6:85371976-85371998 AAAAATAAGAAGGCTGGGCACGG + Intergenic
1011256137 6:85423092-85423114 AAAAAGGAGCATCCTGGGCCAGG + Intergenic
1011448858 6:87472347-87472369 AAAAATCAGATGTATCGGCCGGG - Intronic
1011495298 6:87931410-87931432 AAAAATCACTCTTGTGGGCCGGG - Intergenic
1011567840 6:88697567-88697589 ATAAATATGAATTCTGGGCTGGG + Intronic
1011683428 6:89804734-89804756 AAAATACAAAATTCTAGGCCGGG + Intronic
1011751219 6:90457177-90457199 AAAACTAAAAAGTCTGGGCCGGG + Intergenic
1012563527 6:100617301-100617323 AAAGCTCAGAATACTGGGCCAGG - Intronic
1012941568 6:105421236-105421258 AGAAACAATAATTCTGGGCCGGG + Intergenic
1012955516 6:105565466-105565488 AAAAAGCACTATACTGGGCCAGG - Intergenic
1013132051 6:107242537-107242559 AAAAATAATAATTTTTGGCCAGG - Intronic
1013151989 6:107455458-107455480 AAAACTAAGAAATCTGGGCCAGG + Intronic
1013517655 6:110903054-110903076 TAAAAACAGAAGTCTAGGCCAGG - Intergenic
1014380513 6:120735339-120735361 AAAAAACTGAGTCCTGGGCCGGG + Intergenic
1014487380 6:122016259-122016281 ACATATCAGAATTCTCTGCCTGG + Intergenic
1014619989 6:123655637-123655659 AAAAATGAGAATTCTGTTTCAGG + Intergenic
1014953898 6:127593145-127593167 AAAAACCAGACTGCTGGTCCCGG - Intergenic
1015012248 6:128363838-128363860 ATAAATCTAAAGTCTGGGCCTGG - Intronic
1015030117 6:128584916-128584938 AAAAAACATAATTAAGGGCCGGG - Intergenic
1015102475 6:129497528-129497550 AAAAAGCTAAATTCTGGGCCAGG - Intronic
1015123139 6:129722880-129722902 AAAAACCTCAATTATGGGCCAGG - Intergenic
1015147537 6:130004512-130004534 AAAAATCCCAAATCTTGGCCGGG + Intergenic
1015720633 6:136237514-136237536 AAAAATTAAAAATGTGGGCCAGG + Intronic
1015750763 6:136556203-136556225 AAAATACAGTATTCTTGGCCAGG + Intergenic
1015781464 6:136870991-136871013 AAAATTTAGAATTTTTGGCCAGG - Intronic
1015804824 6:137098270-137098292 AAAAAACATCATTCTTGGCCAGG - Intergenic
1015970134 6:138735292-138735314 AGAAATCAGCATACTCGGCCGGG + Intergenic
1016317899 6:142809887-142809909 AAAAATTAGAATATTGGGCCGGG - Intronic
1016393520 6:143598569-143598591 TAAAAGCAGAAGTGTGGGCCAGG + Intronic
1016472142 6:144386002-144386024 AAAAATTAGGGTTCTGGGCCGGG - Intronic
1017253648 6:152309021-152309043 AAAAATACGAATTATGGGCTGGG + Intronic
1017263681 6:152417201-152417223 ATAAAACACAACTCTGGGCCAGG + Intronic
1017302051 6:152873247-152873269 AATAAATAGAGTTCTGGGCCGGG + Intergenic
1017906721 6:158761601-158761623 AGAAATGTGCATTCTGGGCCGGG - Intronic
1018537180 6:164833665-164833687 AAAAATACAAATTCTGGGCCGGG + Intergenic
1018602228 6:165556842-165556864 AAAAAAAAAAATTCTGAGCCGGG + Intronic
1019094985 6:169572243-169572265 AATTAAAAGAATTCTGGGCCGGG + Intronic
1019582871 7:1776420-1776442 AAAAATGTGTATTCTGGGCTGGG - Intergenic
1020268900 7:6580294-6580316 CAAGATAAAAATTCTGGGCCAGG - Intronic
1020276847 7:6629832-6629854 AAAAATTAGAGGTCGGGGCCGGG - Intergenic
1020522773 7:9214849-9214871 AACAATCAGAAGACTGGGCTTGG - Intergenic
1020700416 7:11474971-11474993 AATAAGCAGAATTCTGGGAAGGG + Intronic
1020803190 7:12757048-12757070 AAAAATGAGATTCCTGGGCTGGG + Intergenic
1021210001 7:17837639-17837661 AAAAATGAGCATTGTAGGCCTGG - Intronic
1021294298 7:18885190-18885212 AAACATCATAATTCTGGCCTGGG + Intronic
1021553425 7:21896022-21896044 AAAAATCAAAAGTGTGGGCCAGG - Intronic
1021559584 7:21956541-21956563 AAAACACAGAACTCTTGGCCGGG - Intergenic
1021967109 7:25930598-25930620 CAAAAGCAGAATTCTGGGGAAGG + Intergenic
1022204130 7:28147139-28147161 AAAAATCAGAATTCTGGGCCAGG - Intronic
1022299837 7:29092802-29092824 AAAAATCTGAAGTCTGAGCTTGG - Intronic
1022718306 7:32918945-32918967 AAAATTCACAATTATGGGCCGGG + Intergenic
1023181711 7:37491490-37491512 AAAAAACATAATTTTAGGCCGGG - Intergenic
1023214205 7:37844299-37844321 AAAAAGAAGAAATCTGGTCCAGG - Intronic
1023368213 7:39486329-39486351 AAAAAAAAAAATTCTGGGCCAGG - Intronic
1023810711 7:43909429-43909451 AAAAACCAGTATTTTAGGCCAGG + Intronic
1023832692 7:44049147-44049169 AAAGAACAGAACTCTGGGCCAGG - Intronic
1023969781 7:44982230-44982252 AAAAAAAAAAATGCTGGGCCTGG + Intergenic
1023975116 7:45023220-45023242 TAAAAAAAGAAGTCTGGGCCGGG - Intronic
1024070730 7:45783044-45783066 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1024285654 7:47755350-47755372 TAAAAACAGAATCATGGGCCAGG - Intronic
1024637544 7:51302599-51302621 AAGATTCACAATTCTGGGCTGGG + Intronic
1024820143 7:53318990-53319012 AAAAATCATAAATCTGGGTGTGG + Intergenic
1024911867 7:54455798-54455820 AAAAACCAGAAGCCTGGGCCAGG - Intergenic
1024992631 7:55248203-55248225 AAAAAACAAAATTTTGGGCCGGG + Intronic
1025005711 7:55353097-55353119 AAAAAAAAAAATTGTGGGCCAGG + Intergenic
1025094155 7:56084666-56084688 AAAAATCGGGATACTCGGCCAGG - Intronic
1025154749 7:56594549-56594571 AAAAACCAGAAATCCTGGCCAGG - Intergenic
1025244257 7:57304281-57304303 AAAAATAAATATACTGGGCCTGG - Intergenic
1026116980 7:67503857-67503879 AATATTCAGAATTCTTGGCCAGG + Intergenic
1026365072 7:69640069-69640091 AAAAATAATAATTCAAGGCCTGG - Intronic
1026634607 7:72070407-72070429 AAACAACAGAATGCTGGGCCAGG - Intronic
1026643491 7:72148272-72148294 AAAAAAAAAAAGTCTGGGCCAGG + Intronic
1026685329 7:72504760-72504782 AGAAGTCAGTATTCTGGGCTGGG + Intergenic
1026797377 7:73375087-73375109 AAAAATAAGAATAATTGGCCAGG + Intergenic
1026844308 7:73689340-73689362 AAAAAAAAAAAGTCTGGGCCGGG - Intronic
1026958189 7:74391522-74391544 AAAAATCAGAAGATGGGGCCAGG + Intronic
1026995569 7:74613798-74613820 AGAAAAGAGCATTCTGGGCCAGG - Intergenic
1027171154 7:75873607-75873629 AAAAAGCAACATTCTTGGCCAGG + Intronic
1027298822 7:76808201-76808223 GAAAATCAGAATTTTAGTCCTGG - Intergenic
1027520166 7:79197074-79197096 AAAAAACAAACTTCTGGGCCAGG - Intronic
1028393294 7:90338933-90338955 AAAGATCAGGACTGTGGGCCGGG - Intronic
1028544980 7:91987874-91987896 AAAAATGAGATTTATTGGCCGGG + Intronic
1028690757 7:93647021-93647043 AAAAATCAGAAAAGGGGGCCGGG + Intronic
1029175468 7:98661618-98661640 AAAAATCAGATTTCTGCTCCAGG + Intergenic
1029182167 7:98710805-98710827 TAAAATCTAAACTCTGGGCCAGG + Intergenic
1029288835 7:99486020-99486042 GAAATTCAGAATTTTGGGCTGGG + Intronic
1029478309 7:100798384-100798406 AAAATACATAATTTTGGGCCAGG - Intergenic
1029533223 7:101139303-101139325 AGAAATCAGAAGCCTAGGCCAGG + Intergenic
1029584979 7:101464704-101464726 AAAAATAAGAATTAGAGGCCGGG - Intronic
1029656698 7:101930135-101930157 AAAAATTTGGCTTCTGGGCCAGG - Intronic
1030069079 7:105683382-105683404 TAAAACCTGAATTCAGGGCCAGG + Intronic
1030128735 7:106179071-106179093 AACAATCAGGATTCTGTACCAGG + Intergenic
1030302704 7:107990333-107990355 AAAACTCATAACTCTTGGCCAGG - Intronic
1030442247 7:109600463-109600485 TAAAATCAGAATTCAGTGCAGGG - Intergenic
1031350439 7:120724005-120724027 AAAAATAAGAAATCTGGTTCAGG + Intronic
1031382358 7:121102655-121102677 AGCAATCTGAATCCTGGGCCTGG + Intronic
1031624866 7:123980823-123980845 AAAAATAAGAATGATAGGCCAGG + Intergenic
1032061456 7:128728647-128728669 AAAAATCAGAATATTTGGCCTGG - Intronic
1032170075 7:129577399-129577421 AAAAAATAGAATTATAGGCCAGG - Intergenic
1032379511 7:131462323-131462345 AAAATTTAATATTCTGGGCCAGG - Intronic
1032404251 7:131644300-131644322 AAAATTCAGACTGTTGGGCCGGG + Intergenic
1032488042 7:132303166-132303188 AAAAATAAGAAATCTAGGCTGGG - Intronic
1032727668 7:134606087-134606109 TAAAATCAAACTTCTTGGCCAGG - Intergenic
1032834052 7:135657086-135657108 AAAAATCAGAAAGCTTGGCCAGG - Intergenic
1033077542 7:138263546-138263568 AAAAATTAAAAATCTGGGCTGGG - Intergenic
1033310312 7:140256465-140256487 AAAAAACAGAAATTGGGGCCGGG - Intergenic
1033326277 7:140381191-140381213 AAAGAGAAGAATTCTTGGCCAGG - Intronic
1033734726 7:144210368-144210390 CAAGATCAGAATTCTGGGGTTGG + Intergenic
1033748329 7:144340601-144340623 CAAGATCAGAATTCTGGGGTTGG - Intergenic
1033892584 7:146033395-146033417 AAAAAATAGAATTTTTGGCCGGG + Intergenic
1034182944 7:149152552-149152574 AAAAAAAAGAAATCTAGGCCAGG - Intronic
1034335609 7:150321786-150321808 AAAAATCACTATTCTTGGGCAGG + Intronic
1035136733 7:156710198-156710220 AATAATCAACCTTCTGGGCCGGG - Intronic
1035350964 7:158246096-158246118 AAAAATGAATATTCTGGGCCAGG + Intronic
1035566697 8:645782-645804 GAAATTCAGATTTCTGGGCTGGG - Intronic
1035823409 8:2618872-2618894 TAAACTCAAAATTCTTGGCCTGG + Intergenic
1036538447 8:9676306-9676328 CTAAAAAAGAATTCTGGGCCAGG - Intronic
1037370101 8:18168011-18168033 AAAAATTAGGATTTTTGGCCAGG - Intergenic
1037486939 8:19356708-19356730 AAAGAGGAGAATTGTGGGCCAGG + Intronic
1037874500 8:22534258-22534280 AAAAATTAAAAGTTTGGGCCAGG + Intronic
1038119094 8:24591672-24591694 AAAAAATAGAACTCTGGGGCAGG + Intergenic
1038495806 8:28001345-28001367 AAAAATCTGAAATCCAGGCCAGG - Intergenic
1038799256 8:30734320-30734342 AAAAATCACCATTTTGGGCTGGG + Intronic
1039090043 8:33818194-33818216 TAAAATCAGTAGTCTGGGCAGGG - Intergenic
1039329344 8:36519740-36519762 AAAAAACAACATTCTGGGCCGGG - Intergenic
1039381463 8:37089402-37089424 AAAAATCACCATTTTCGGCCGGG - Intergenic
1039603062 8:38858015-38858037 AAATACCAGAACTTTGGGCCAGG + Intergenic
1039804090 8:40984008-40984030 AAAAATCAAATTGCTGGGCATGG + Intergenic
1039872429 8:41557791-41557813 AACAATCACAATGGTGGGCCGGG - Intergenic
1039914209 8:41847871-41847893 AAAAAATAGAACTGTGGGCCAGG + Intronic
1039959066 8:42231097-42231119 AACAATGAGAATTCTGGACAAGG + Intergenic
1039989430 8:42475393-42475415 AAAATTCCTAAGTCTGGGCCGGG - Intronic
1040017039 8:42708169-42708191 TAAAATGTGGATTCTGGGCCGGG + Intronic
1040053633 8:43039009-43039031 AAAAGTTGGAATTTTGGGCCGGG + Intronic
1040103159 8:43522727-43522749 AAAAAACAAAAACCTGGGCCTGG + Intergenic
1040446025 8:47494281-47494303 AAAAAAAAAAATTCTAGGCCAGG - Intronic
1040483254 8:47846118-47846140 AAAATCCAACATTCTGGGCCAGG + Intronic
1040486397 8:47876364-47876386 AAAAATCAATAATCGGGGCCAGG + Intronic
1041064046 8:54064117-54064139 GTAATTAAGAATTCTGGGCCGGG + Intronic
1041442588 8:57913309-57913331 ACAAATCAGAATTCTGAAACCGG + Intergenic
1041508168 8:58624340-58624362 AAAAATCCTAACTCTAGGCCAGG - Intronic
1042168330 8:65968490-65968512 AAAAATCAGAATTAACAGCCTGG + Intergenic
1042540648 8:69904291-69904313 AAAAAAAAAAATTGTGGGCCAGG - Intergenic
1042650831 8:71039097-71039119 TAAAATCAGCATCCTGGGCCAGG - Intergenic
1043017044 8:74952038-74952060 AAAAAGCATAATTCTGGGAAAGG - Intergenic
1043200431 8:77362843-77362865 AAAAATAAAACTTCTGGGCTGGG - Intergenic
1043409150 8:79974038-79974060 AAAATTCAGATTTCTAGGCCAGG - Intronic
1043637607 8:82405894-82405916 AAAAATCATTAGTCTTGGCCAGG - Intergenic
1043830112 8:84978372-84978394 AAAAAAAAAAATTCTGGGCATGG - Intergenic
1044136187 8:88588891-88588913 AAAAATGACATTTGTGGGCCGGG + Intergenic
1044663053 8:94610379-94610401 AAAAATTAAAAATCAGGGCCAGG + Intergenic
1044700625 8:94962586-94962608 AAAAAACAGAAGTCTGGGCTAGG - Intronic
1044874627 8:96652928-96652950 CAAAAACAAAATTCTGGGGCCGG - Intronic
1045031599 8:98141861-98141883 TAAAAAAAAAATTCTGGGCCAGG - Intronic
1045075908 8:98567760-98567782 AAAAATTATAATTTTAGGCCAGG + Intronic
1045134476 8:99199464-99199486 AAAAATTATGGTTCTGGGCCGGG - Intronic
1045211423 8:100104020-100104042 TAAAAGCAGAGCTCTGGGCCTGG + Intronic
1045319816 8:101073619-101073641 AAAAATAAAAATTTTGGGCCGGG - Intergenic
1045357515 8:101402784-101402806 AAAAATCATAAGTATGGGCCAGG + Intergenic
1045526758 8:102947142-102947164 AAAAATAAGATTTCTGGGCTGGG - Intronic
1045815007 8:106269541-106269563 AAAATTCAGAATTCTTTGCAAGG - Intergenic
1046213136 8:111105198-111105220 TAAAATCAGAATTCAGGGCTTGG + Intergenic
1046341987 8:112870569-112870591 AAAAATAGCCATTCTGGGCCGGG - Intronic
1046503402 8:115107979-115108001 AAAAAGCTGAATTTTAGGCCAGG + Intergenic
1046547029 8:115666781-115666803 AGAAATGATAACTCTGGGCCTGG - Intronic
1047321283 8:123786112-123786134 ATAAATAAAATTTCTGGGCCAGG - Intronic
1047380871 8:124361536-124361558 AAAAAGCAAGATTTTGGGCCGGG + Intronic
1047494587 8:125400474-125400496 AAAAAAAAAAATTCTAGGCCAGG + Intergenic
1047684158 8:127287033-127287055 AAAAATCAAAATTAGTGGCCGGG - Intergenic
1047833915 8:128667209-128667231 AAGAATGAGATTTCTGGCCCAGG - Intergenic
1048011654 8:130461915-130461937 AAAAATTAGATTTATAGGCCGGG - Intergenic
1048312141 8:133332049-133332071 AAAAATAATACTTATGGGCCGGG - Intergenic
1048669048 8:136695883-136695905 AAAAATGAGTTTCCTGGGCCTGG + Intergenic
1048921686 8:139237223-139237245 AAAAAAAAGAATTATAGGCCAGG - Intergenic
1049165789 8:141125083-141125105 AAAAATAAGAAATGTGGGCGAGG - Intronic
1049759302 8:144324770-144324792 AAAAATCTCAATTCCCGGCCGGG + Intronic
1050530630 9:6585998-6586020 AAAAATAAAGATTCTAGGCCAGG + Intronic
1050639891 9:7656136-7656158 AGGAATCAGAATTATGTGCCTGG - Intergenic
1051008600 9:12381484-12381506 AAAAATTATAAAGCTGGGCCAGG - Intergenic
1051368849 9:16340992-16341014 AGAAATCTCCATTCTGGGCCGGG - Intergenic
1051526432 9:18049916-18049938 CAGAATCAGAAGTCCGGGCCGGG - Intergenic
1051543187 9:18244420-18244442 AAAATTCTGGATTCTGGGCTAGG - Intergenic
1051622342 9:19064260-19064282 AAAAATAAGTCTGCTGGGCCAGG - Intronic
1051635573 9:19178245-19178267 AAAAAAAAAAATTCAGGGCCAGG - Intergenic
1051702871 9:19843203-19843225 AAAAAAAATAATTTTGGGCCAGG + Intergenic
1052238266 9:26239606-26239628 AAATGTCAGAATTTTAGGCCTGG - Intergenic
1052312674 9:27084906-27084928 AAAAATATGAATTCAAGGCCGGG - Intergenic
1052887651 9:33665742-33665764 AAAAATCAAATCTATGGGCCGGG - Intergenic
1052896755 9:33754532-33754554 CAAAGTAAGAATTTTGGGCCAGG + Intronic
1052976401 9:34413791-34413813 AGAAAGCAGAAATCAGGGCCAGG + Intronic
1053079079 9:35159667-35159689 AAGAATCCTAATTCTAGGCCAGG - Intergenic
1053491705 9:38511083-38511105 ATAAATTAGAAATCAGGGCCAGG + Intergenic
1053586396 9:39463570-39463592 ATAAATCAGAATTTTTGGCCAGG - Intergenic
1054579908 9:66901647-66901669 ATAAATCAGAATTTTTGGCCAGG + Intronic
1054977851 9:71169657-71169679 AAAAATCCAAATTCGGGTCCAGG + Intronic
1055013364 9:71590974-71590996 AAAAATCCCAATTCAGGGCTGGG - Intergenic
1055109182 9:72542610-72542632 AAAAAAAAGAATTCTGATCCAGG + Intronic
1055219579 9:73912656-73912678 AAAAAATATAATTCTGGGCCAGG + Intergenic
1055399593 9:75909027-75909049 AAACATAGGATTTCTGGGCCGGG + Intronic
1055435460 9:76287932-76287954 AAAAATGAGAAATCTGTGCCAGG - Intronic
1055464203 9:76547793-76547815 CAAAATTAAAATCCTGGGCCAGG - Intergenic
1055541024 9:77305231-77305253 AAAAGTCTGAAATCTCGGCCAGG - Intronic
1055799396 9:80017117-80017139 AAAAATTAGAATTCGGGCCTTGG - Intergenic
1056315284 9:85382652-85382674 AAAAATCAGCATTCTATGTCAGG - Intergenic
1056418593 9:86401788-86401810 CACAATTAGAACTCTGGGCCGGG + Intergenic
1056747982 9:89321369-89321391 AAAAATTAGTTTTCTTGGCCGGG + Intronic
1057045838 9:91885667-91885689 AAAAATCAGAACCTTGGGGCAGG - Intronic
1057176945 9:93007383-93007405 AAAATAAAAAATTCTGGGCCAGG - Intronic
1057197778 9:93124568-93124590 AAAAAAAAGATTTCTGGGTCAGG - Intronic
1057244126 9:93439954-93439976 AAAACTAAGAATTCTAGGCCGGG + Intergenic
1057575116 9:96236219-96236241 TAAAATGAGGATCCTGGGCCAGG + Intronic
1057672002 9:97100287-97100309 ATAAATTAGAAATCAGGGCCAGG + Intergenic
1058008074 9:99940774-99940796 AAAAAGTAAAATTCTAGGCCGGG - Intronic
1058023983 9:100119851-100119873 AAAAAAGTGAATTCTGGACCAGG - Intronic
1058108728 9:101005317-101005339 AAAAATAAGAATTCTCTGCCAGG - Intergenic
1058239421 9:102538176-102538198 AAAAAAAAAAATTCTGGGCATGG + Intergenic
1058308828 9:103475394-103475416 AAAAAACTGAATTCAGGGCCGGG - Intergenic
1058339599 9:103878224-103878246 AAGAATCAGAATTATTGGCCGGG - Intergenic
1058484260 9:105427568-105427590 AAAAATCATATTTCTGAGGCCGG - Intronic
1058532912 9:105924800-105924822 AATAATCAGAAGTCAGGGCTGGG - Intergenic
1058727402 9:107817387-107817409 AAGAATTAAAATTCTCGGCCAGG + Intergenic
1059127900 9:111711283-111711305 AAAAACCAGACTGCTGGTCCTGG + Intronic
1059163880 9:112060590-112060612 GAAAATCAGGACCCTGGGCCAGG - Intronic
1060233844 9:121846913-121846935 AAAAATCAGAACACAAGGCCGGG + Intronic
1060252707 9:121998933-121998955 AAAAATGAAAATTCTGGGTCGGG - Intronic
1060627629 9:125128011-125128033 AAAAAAAAAAATTCTAGGCCAGG + Intronic
1060628502 9:125135354-125135376 AAAAATCATAATTTTAGGCCAGG + Intronic
1060628554 9:125135672-125135694 TAAAATCCTAATTCTGGGCTGGG + Intronic
1060636515 9:125203735-125203757 AAAAATCAGACTCCTGGGCTGGG + Intronic
1060721778 9:125984427-125984449 AAAAAAAAGGAATCTGGGCCTGG + Intergenic
1061109688 9:128560028-128560050 AAAAATCAAAATTATCGGCCAGG - Intronic
1061345336 9:130019851-130019873 TAAAATAAGCATTGTGGGCCGGG - Intronic
1061486203 9:130921693-130921715 AGAAATCAGAGTTCAGGGTCAGG - Intronic
1061630380 9:131868569-131868591 GTAAATCAGAATAGTGGGCCGGG - Intronic
1061632588 9:131882609-131882631 TAAAATCCGAATTCTGCACCAGG + Intronic
1061701619 9:132420503-132420525 AAAAAAAAAAATTCTGGGCATGG + Intronic
1061891262 9:133621708-133621730 AAAAAACAGAAATCTTGGCCGGG - Intergenic
1062161306 9:135081678-135081700 AGAAGTCAGAATTAGGGGCCAGG + Intronic
1062209867 9:135357581-135357603 AAAAAGCAAAGTTCTGGCCCAGG - Intergenic
1062329882 9:136034796-136034818 AATAATCATAATTGGGGGCCAGG + Intronic
1062714738 9:138003089-138003111 AAAAAAAAGAAATTTGGGCCAGG - Intronic
1062750977 9:138253115-138253137 AAAAAACAAAATTCCTGGCCAGG - Intergenic
1203482790 Un_GL000224v1:21883-21905 ACAAATCAGTAGTCTGGGCAAGG + Intergenic
1185590092 X:1270532-1270554 AAAAATGATAATATTGGGCCAGG - Intronic
1185690072 X:2147258-2147280 AGAAATAAGAATGTTGGGCCTGG - Intergenic
1185783718 X:2871391-2871413 AAAAAAAAAAATTCTAGGCCAGG + Intronic
1185850391 X:3480501-3480523 AAAAATCAGAGTTTCTGGCCAGG - Intergenic
1186494794 X:10003660-10003682 AAAAATGGGGATTCTCGGCCGGG - Intergenic
1186749454 X:12606699-12606721 AAAACTCAGAATTCAGGGCCAGG + Intronic
1186906583 X:14117487-14117509 AAAAATTAGAATTCAGGTTCAGG - Intergenic
1187204825 X:17171819-17171841 AAGAATTATAATTATGGGCCAGG - Intergenic
1187339602 X:18409369-18409391 AAAAAAAAGTATTCAGGGCCAGG - Intergenic
1187347240 X:18477061-18477083 AAAAAACAAGATTCAGGGCCAGG - Intronic
1187349877 X:18503477-18503499 AAAAATCACATTTATGGGCGGGG - Intronic
1187380382 X:18796250-18796272 GAAAACCAGAGTTCTGGGGCCGG - Intronic
1187520138 X:20005807-20005829 AGAAAGCACAATTATGGGCCGGG - Intergenic
1187782693 X:22846411-22846433 ATTAATCAGAATTCTGAGGCAGG - Intergenic
1188031439 X:25268460-25268482 AAAAAAAAGAATTCACGGCCAGG - Intergenic
1188133135 X:26462457-26462479 AAAAATCAGAATTTTTGGGGGGG + Intergenic
1188585267 X:31766551-31766573 TAAATAGAGAATTCTGGGCCGGG - Intronic
1188768280 X:34123724-34123746 AAAAAGAATAAATCTGGGCCAGG - Intergenic
1188844049 X:35051702-35051724 CAAAATGTGAATACTGGGCCGGG - Intergenic
1188845985 X:35073181-35073203 AAGAATGTGTATTCTGGGCCGGG + Intergenic
1188887891 X:35572754-35572776 AAAACTCACACTCCTGGGCCGGG - Intergenic
1189009567 X:37033608-37033630 AAGAACAAGAATTCTGGGACAGG + Intergenic
1189039007 X:37522110-37522132 AAGAACAAGAATTCTGGGACAGG - Intronic
1189121171 X:38396255-38396277 AAAAATCAGAATCCATGGCAGGG - Intronic
1189310895 X:40016754-40016776 AAAAATCTGCAATCTGGGCAGGG + Intergenic
1189314667 X:40046233-40046255 AAAAAAAAAAGTTCTGGGCCAGG + Intergenic
1189380971 X:40501835-40501857 CAAAATCAGAAATCTATGCCGGG + Intergenic
1189430989 X:40947215-40947237 AAAAATCAGGATACTGGCCATGG + Intergenic
1189849914 X:45167978-45168000 AAAAATAATCACTCTGGGCCGGG - Intronic
1190040685 X:47069175-47069197 AAAAAAAAAAATTCAGGGCCAGG + Intergenic
1190041196 X:47073732-47073754 AAAAATTAAAAATCTGGGCCAGG + Intergenic
1190085467 X:47391843-47391865 AAAAATCCAAAATCTTGGCCAGG - Intronic
1190293327 X:49007861-49007883 AAAAATTAGCCCTCTGGGCCGGG - Intergenic
1190315705 X:49149363-49149385 AAAAATAGGCATTCAGGGCCGGG + Intergenic
1190637584 X:52451453-52451475 AAAAATCAGAATACTGTGATTGG + Intergenic
1191682302 X:63853548-63853570 AAATAGCATAATTCTGGACCTGG - Intergenic
1192078414 X:68023657-68023679 ATAAATGAGAATTCTTGGCTGGG + Intergenic
1192499891 X:71643702-71643724 AATAATGGCAATTCTGGGCCAGG + Intergenic
1192824798 X:74683692-74683714 AATAATTACAATTCTTGGCCGGG - Intergenic
1193071727 X:77313433-77313455 AAAAATCAAAAGGCTAGGCCTGG + Intergenic
1193433561 X:81442465-81442487 AAAAATCAGAAGGCCGGGCATGG - Intergenic
1193686199 X:84579989-84580011 AAAAATTGGTTTTCTGGGCCAGG + Intergenic
1194080395 X:89455811-89455833 AATAAACAGTAATCTGGGCCAGG - Intergenic
1194174579 X:90630218-90630240 AAAAATCAGACTGTTGGGTCAGG + Intergenic
1194178092 X:90677223-90677245 AAAAATGAGAAAAATGGGCCGGG + Intergenic
1194220083 X:91179065-91179087 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1194283050 X:91976211-91976233 AAAAATCATAAATATGAGCCGGG - Intronic
1194489605 X:94530366-94530388 AAAAATCAGTTTTCTTGGCTGGG - Intergenic
1195149877 X:102056107-102056129 AAAAAAAAGAATTCTATGCCAGG - Intergenic
1195499872 X:105583427-105583449 AAAAAATTGAATTCTTGGCCGGG - Intronic
1195732195 X:107979151-107979173 AATAATCAGGATTGAGGGCCAGG - Intergenic
1195873686 X:109515166-109515188 AAAAAAAAAAATTCTTGGCCAGG + Intergenic
1196327527 X:114425284-114425306 AAAAAAAAAAATTGTGGGCCGGG + Intergenic
1196576028 X:117320383-117320405 AGAAATGCAAATTCTGGGCCGGG + Intergenic
1196678408 X:118444998-118445020 AAAAATGAGAAATTTGGGCCTGG + Intronic
1196684510 X:118498842-118498864 AAAATTCAGATGGCTGGGCCTGG + Intronic
1196849598 X:119924979-119925001 AAAAATCCAAATTATGGGCTGGG - Intergenic
1197023505 X:121718309-121718331 AAAAAATAGATTCCTGGGCCAGG - Intergenic
1197027096 X:121765975-121765997 AAAAAAGAAAATTCTGGGGCTGG + Intergenic
1197038170 X:121903489-121903511 AAAAACCAGATTGCTGGTCCCGG + Intergenic
1197299408 X:124759985-124760007 AAAAACCAGACTGCTGGTCCCGG + Intronic
1197570165 X:128140893-128140915 AAAAATAAGCTTTCTAGGCCAGG + Intergenic
1198045204 X:132894434-132894456 AAAAATCTGAAACCCGGGCCTGG - Intronic
1198082610 X:133253328-133253350 AAAAAGTAGCATTCTGGGCCGGG + Intergenic
1198562538 X:137866529-137866551 AAAATACATGATTCTGGGCCGGG + Intergenic
1198611549 X:138406771-138406793 AAAAATCAGAATTCAAAACCTGG + Intergenic
1198712678 X:139523001-139523023 AAATATCGCAATTCTAGGCCAGG + Intergenic
1198911172 X:141616468-141616490 AAAAGTCACACATCTGGGCCGGG + Intronic
1199012809 X:142777424-142777446 AAGAGTCACAATTCTGGGCAGGG + Intergenic
1199015842 X:142813857-142813879 AAAAATCAGTATACACGGCCGGG - Intergenic
1199234971 X:145481186-145481208 ATAAAACAGAAATCAGGGCCGGG - Intergenic
1199337649 X:146639274-146639296 GAAAATCAGAATTTGGGGCCTGG + Intergenic
1199390723 X:147275160-147275182 GAAAATCACATATCTGGGCCGGG + Intergenic
1199767126 X:150949471-150949493 GAAAACAAGAATTCTGGGGCTGG - Intergenic
1199821831 X:151457082-151457104 AAAAATGAGATATCTTGGCCAGG + Intergenic
1200433073 Y:3111877-3111899 AATAAACAGTAATCTGGGCCAGG - Intergenic
1200524758 Y:4259380-4259402 AAAAATGAGAAAAATGGGCCGGG + Intergenic
1200556593 Y:4642825-4642847 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1200600630 Y:5200745-5200767 AAAAATCATAAATATGAGCCAGG - Intronic
1201440547 Y:14003628-14003650 AAAAAAAAAAATTCTGGGCGCGG - Intergenic
1201444024 Y:14039080-14039102 AAAAAAAAAAATTCTGGGCGCGG + Intergenic
1201485785 Y:14493340-14493362 AGAAACAAGAATTCTTGGCCAGG + Intergenic
1201548070 Y:15188645-15188667 AAAAAAAAGAATACTGGGCCGGG + Intergenic