ID: 1022205384

View in Genome Browser
Species Human (GRCh38)
Location 7:28158726-28158748
Sequence TTGGGTAAACTGATGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022205384_1022205386 -8 Left 1022205384 7:28158726-28158748 CCTCTCACCATCAGTTTACCCAA 0: 1
1: 0
2: 1
3: 13
4: 209
Right 1022205386 7:28158741-28158763 TTACCCAAATAACTTCTGACTGG 0: 1
1: 0
2: 0
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022205384 Original CRISPR TTGGGTAAACTGATGGTGAG AGG (reversed) Intronic
900510885 1:3060582-3060604 ATGGGAAAACTGATGCTCAGAGG - Intergenic
900693067 1:3993401-3993423 GTGGGGAAACTGAGGCTGAGAGG + Intergenic
902440727 1:16428139-16428161 TTGGGGAAGCTGTTGGAGAGGGG + Intronic
902542437 1:17164627-17164649 TTGAGGAAACTGAGGCTGAGAGG - Intergenic
902923703 1:19682107-19682129 TTGGGGAAACTGAGGCTCAGAGG - Intergenic
906490764 1:46266748-46266770 TTGGGTAGGCTGATGTGGAGGGG + Intronic
908650406 1:66326839-66326861 TTGAGAAAACTGAGGCTGAGAGG - Intronic
911969616 1:104415281-104415303 TTGGGGCAAATGATGGTGGGTGG + Intergenic
912511259 1:110191798-110191820 TTGGGGAAACTGAGGCTCAGAGG + Intronic
913017255 1:114751791-114751813 TTGGGTATGGTGATGGAGAGGGG - Intronic
913325264 1:117622828-117622850 CTGGGGAAACTGAAAGTGAGGGG - Exonic
915973227 1:160368243-160368265 TTAGTTGAGCTGATGGTGAGTGG + Intronic
917355107 1:174119344-174119366 TTGGGAAAAGTGAAGGTGAAAGG + Intergenic
918697173 1:187559272-187559294 TTGGAGTAACTGAAGGTGAGGGG - Intergenic
919426545 1:197439452-197439474 ATGTGTAAACTGAGGCTGAGAGG + Intronic
921948616 1:220906474-220906496 TTGGCTAGACTCATGGTCAGAGG + Intergenic
923461410 1:234212557-234212579 ATGGGGAAACTGAGGCTGAGAGG - Intronic
1066406528 10:35124533-35124555 TTGAGAAATCTGAAGGTGAGGGG + Intergenic
1066415664 10:35218852-35218874 TTGGGTTAACTGTGGGGGAGGGG + Intergenic
1068566756 10:58584364-58584386 TTGGGTGAAATGATGGTTGGTGG + Intronic
1068922433 10:62498794-62498816 TTGGTTAAACTTTTGGTGGGGGG + Intronic
1069160607 10:65086553-65086575 TTGGGGGAACTGGTGGTGATTGG - Intergenic
1070505664 10:77110806-77110828 TTGGATAAACTGATGGAAGGAGG - Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071793870 10:88985183-88985205 GTGAGAAAACTGATGCTGAGAGG + Intronic
1073347866 10:102798192-102798214 TTGGGGACAGTGTTGGTGAGTGG + Intronic
1075078927 10:119369902-119369924 CTGGGTAAACGGAGGGTCAGGGG - Intronic
1075599055 10:123753803-123753825 TTGGATAATCTGAGGGTCAGAGG - Intronic
1076696929 10:132251521-132251543 TGGGGTAAAGAGATGGTGTGGGG - Intronic
1081073969 11:38645692-38645714 TTGGGTAAAATGATGGTGTTAGG - Intergenic
1081812204 11:45920411-45920433 TGGGGCAAACTGAAGGAGAGAGG - Intergenic
1082299961 11:50493577-50493599 TAAGGGAAACTGAGGGTGAGGGG + Intergenic
1083178541 11:60969570-60969592 GTGGGTAGACTTGTGGTGAGGGG + Intergenic
1084496657 11:69509120-69509142 TTGGGGACACTGATGGTTTGGGG + Intergenic
1084508634 11:69587448-69587470 ATGGGGAAACAGATGCTGAGGGG - Intergenic
1084708919 11:70831932-70831954 ATGGGGAAACTGAGGGTCAGGGG - Intronic
1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG + Intronic
1086323519 11:85674891-85674913 TTGGGTATTCTGAAGGAGAGAGG - Intronic
1088669079 11:112123663-112123685 TTGGATAAAATGAGGGGGAGAGG - Intronic
1089921565 11:122213787-122213809 GTGGGGAAACTGAGGCTGAGGGG - Intergenic
1093189315 12:16057184-16057206 TTGGTAAAAATTATGGTGAGAGG + Intergenic
1093969070 12:25357892-25357914 CAGGGAAAACTGATGGTTAGTGG - Intergenic
1094742145 12:33301997-33302019 TTTTGTAAACTGATGGGGATGGG + Intergenic
1095127994 12:38504701-38504723 TTAGGTAAACACATAGTGAGGGG + Intergenic
1096427083 12:51513069-51513091 TTAGATAAAATGATGGTGGGTGG + Exonic
1096849891 12:54428734-54428756 CTGGGGAGACTGCTGGTGAGGGG - Intergenic
1098137662 12:67419735-67419757 GTGGGTAAACTTTTGGTGAAGGG - Intergenic
1098739504 12:74154532-74154554 TTGGTTACACTCATGGTGTGTGG - Intergenic
1099555833 12:84107499-84107521 TAAGGGAAACTGAAGGTGAGAGG + Intergenic
1100834212 12:98550900-98550922 ATGAGGAAACTGATGGTTAGAGG + Intergenic
1101500724 12:105301321-105301343 TAAGGGAAACTGAGGGTGAGGGG - Intronic
1101816764 12:108151552-108151574 TTGGGGAAATTGATGTTCAGAGG + Intronic
1102385655 12:112507313-112507335 TTGGGGAAACTGATCTTGTGAGG + Exonic
1102440747 12:112962488-112962510 GTGGGTAAACTGAGGTTCAGAGG - Intronic
1102692203 12:114770180-114770202 TTGAGTCAACTGATGGAGACTGG + Intergenic
1102780136 12:115557208-115557230 TTGGGTAGACTGATGGGGCTGGG - Intergenic
1103159186 12:118713387-118713409 ATGGGTAAACTGAGGCTCAGAGG + Intergenic
1106879550 13:34114442-34114464 TTGGGTTAACTTATGGAGAATGG - Intergenic
1107596896 13:41972856-41972878 TTGGGAAATCTGGTGGTGGGGGG - Intergenic
1108577445 13:51802490-51802512 TTGGGTAAATTGAGGGTGTGGGG - Intronic
1114785106 14:25587614-25587636 CTGGATATAGTGATGGTGAGTGG + Intergenic
1114852174 14:26394469-26394491 TTATGTAAGCTGATGGTGTGAGG - Intergenic
1115678185 14:35705083-35705105 TTGGGGAAACTGGTAGGGAGGGG - Intronic
1116127680 14:40808908-40808930 TTTGGTAAACTTAAGGTCAGTGG - Intergenic
1116900271 14:50355892-50355914 ATGGGCAAACTGGTGGGGAGTGG + Intronic
1116994818 14:51312029-51312051 TGGGATAAACTGAAGGTGACAGG - Intergenic
1119333941 14:73816697-73816719 TTGAGTACACAGATGGTGACTGG - Intergenic
1119891783 14:78188245-78188267 TTGGGGAAACTGAGGCTTAGAGG + Intergenic
1121832237 14:97062513-97062535 TTGGGTAAAAGCATGGTGTGGGG + Intergenic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1125478136 15:40061459-40061481 TTGGGAGATCTGATGGTGAGAGG + Intergenic
1126997871 15:54465228-54465250 TAGGGTAAACTGAAGATAAGTGG - Intronic
1128069073 15:64782604-64782626 TTGGGGAAACTGAGGTTCAGCGG + Intergenic
1128159780 15:65416006-65416028 TTGGGGAAACTGAGGCTGAAAGG - Intronic
1128885952 15:71288442-71288464 ATGGGGAAACTGATGCTCAGAGG + Intronic
1133704237 16:8338044-8338066 TTGAGGAAACTGATGAAGAGAGG - Intergenic
1133809282 16:9148765-9148787 TTGGGGAAAGTAATGGTGGGAGG + Intergenic
1140719472 16:77758318-77758340 ATGGTTACACTGATGCTGAGTGG - Intergenic
1140861562 16:79022898-79022920 CTGAGTAAACTGATGCTCAGGGG - Intronic
1141014163 16:80432555-80432577 TTGGGAAGAGTGATGGGGAGTGG + Intergenic
1141642352 16:85348648-85348670 ATGGGAAAACTGAGGCTGAGCGG - Intergenic
1142183612 16:88684084-88684106 TTAGGAAAACTGAGGGTGGGAGG - Intronic
1143652236 17:8270497-8270519 TGGGGTCCACAGATGGTGAGGGG + Intergenic
1144160298 17:12551396-12551418 CTGGGTATAATGATGCTGAGTGG + Intergenic
1144877681 17:18410982-18411004 TTGGGGAAAGAGATGGAGAGGGG - Intergenic
1144885879 17:18460908-18460930 TTGGGAATCCTGATGTTGAGAGG - Intergenic
1145146333 17:20483464-20483486 TTGGGAATCCTGATGTTGAGAGG + Intergenic
1145154550 17:20533421-20533443 TTGGGGAAAGAGATGGAGAGGGG + Intergenic
1145802065 17:27693974-27693996 TTAGGGAAACTGAGGGTGAGGGG + Intergenic
1149175859 17:53868998-53869020 TTGTATAAATGGATGGTGAGTGG + Intergenic
1151116000 17:71736045-71736067 GTGGGTGAACAGATGGTTAGTGG - Intergenic
1151288000 17:73127461-73127483 ATGGATAAACTGATATTGAGTGG - Intergenic
1151354057 17:73548175-73548197 TTGAGGAAACTGAGGTTGAGAGG + Intronic
1152119473 17:78409456-78409478 AAAGGTGAACTGATGGTGAGAGG + Intronic
1154353528 18:13607199-13607221 AAGGGCAAACTGCTGGTGAGAGG - Intronic
1155898237 18:31355249-31355271 TTGGTTAAAGTGATGGTCAGAGG - Exonic
1158129438 18:54136500-54136522 TTGGGTAAGCTGAGGAGGAGGGG - Intergenic
1159696800 18:71569013-71569035 TTGGGTGAACTGATGGTGAATGG + Intergenic
1159769504 18:72532059-72532081 TCAGCTAAACTGATGGTGAGGGG - Intergenic
1160361851 18:78290090-78290112 TGGAGTGAAGTGATGGTGAGAGG - Intergenic
1160665632 19:326723-326745 TTGGGTAAACAGATGGGCACAGG + Intronic
1160720016 19:592933-592955 TTGGGGAAACTGAGGCAGAGGGG - Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1164335985 19:24321701-24321723 TCAGGGAAACTGAGGGTGAGGGG - Intergenic
1164336309 19:24324420-24324442 ATAGGGAAACTGAGGGTGAGGGG - Intergenic
1164365840 19:27580706-27580728 TAAGGGAAACTGAGGGTGAGAGG - Intergenic
1164378541 19:27711258-27711280 TAAGGGAAACTGAGGGTGAGAGG + Intergenic
1165026326 19:32965167-32965189 TAGGGTAAACTGATCCTGGGAGG - Intronic
1168050969 19:53829621-53829643 ATGGGGAAACTGAGGCTGAGAGG + Intergenic
927319043 2:21721187-21721209 TTTTGTAAAGGGATGGTGAGTGG - Intergenic
927346436 2:22048750-22048772 TTGACAAAACTGATGGGGAGGGG + Intergenic
927826233 2:26311908-26311930 TTGGGTAAGCTGAAGGCGAAGGG + Exonic
927860196 2:26555939-26555961 ATGAGGAAACTGAGGGTGAGTGG + Intronic
934589002 2:95529536-95529558 TTGGCAAATCTGAAGGTGAGAGG + Intergenic
940248567 2:151647521-151647543 TTGGTTAAAGTGATGGTGCCAGG - Intronic
941038891 2:160598464-160598486 TTGGGTCAGCTGTTGCTGAGGGG + Intergenic
945044630 2:205770950-205770972 AGTGGTAAACTGATGGAGAGGGG - Intronic
946393432 2:219430304-219430326 TTGGGTGAGCTTGTGGTGAGAGG - Intergenic
947601642 2:231454592-231454614 TTGGTTGAAATGCTGGTGAGGGG - Exonic
948541931 2:238697409-238697431 GTGGGGAAACCCATGGTGAGGGG - Intergenic
1168917896 20:1506281-1506303 TGGGGTAAGCAGGTGGTGAGGGG + Intergenic
1169655469 20:7917889-7917911 TTGGGTAAAATGTTTGTGAAGGG - Intronic
1171435112 20:25116261-25116283 TCGGGTCAGCTGAGGGTGAGTGG - Intergenic
1172838387 20:37887408-37887430 CTGGGGAAACTGAGGCTGAGAGG + Intergenic
1175649456 20:60705792-60705814 TTGAGTAAACGGATGGTGGATGG - Intergenic
1176423830 21:6535599-6535621 TTGGGGAAACTGAGGCTCAGAGG + Intergenic
1178003766 21:28193339-28193361 TCGGGAACACTGATGATGAGTGG - Intergenic
1179699323 21:43143914-43143936 TTGGGGAAACTGAGGCTCAGAGG + Intergenic
1181468418 22:23123210-23123232 TCGGGAAAGCAGATGGTGAGCGG - Exonic
1182051186 22:27314046-27314068 ATGGGTAAACTGAGGCTCAGAGG - Intergenic
1183035161 22:35135576-35135598 TTTGGCAAACTGAGGGTGAAGGG + Intergenic
1183248908 22:36714444-36714466 TTGGGAAAACTGAAGCTCAGGGG + Intergenic
1183888943 22:40909308-40909330 TTGTGAAAGCTGAAGGTGAGAGG - Intronic
1185214169 22:49589119-49589141 TTGGAAAAATAGATGGTGAGTGG + Intronic
949481302 3:4495837-4495859 TTGGGGATGCTGGTGGTGAGAGG + Intronic
949840361 3:8313375-8313397 ATGGGTAAACTGAGGCTCAGAGG - Intergenic
953260278 3:41331679-41331701 TTGGCAAAGATGATGGTGAGTGG - Intronic
953275209 3:41489045-41489067 GTGGATAAACTGAGGGTCAGGGG - Intronic
953788606 3:45929521-45929543 CTGGGGAACGTGATGGTGAGTGG + Intronic
954487017 3:50862436-50862458 TTAGGTAGGCTGATGGTAAGTGG + Intronic
955386238 3:58483300-58483322 TTGAGGAAACTGAGGCTGAGAGG + Intergenic
956931235 3:74045755-74045777 TTGGGAAAACTGTTGGAGAAGGG + Intergenic
957353393 3:79053707-79053729 TAAGGCAAACTGAGGGTGAGGGG - Intronic
959533078 3:107455812-107455834 ATGGGTAATCTCATTGTGAGAGG + Intergenic
959973661 3:112434459-112434481 TTGAGTAAACTGAGGCTCAGAGG - Intergenic
962900717 3:139759136-139759158 TTAGGTGAACTGAGGGTCAGTGG - Intergenic
963413300 3:144960462-144960484 TTGGAGAAACAGATGATGAGTGG - Intergenic
967413203 3:189187666-189187688 TTGAGAAAACTGAGGCTGAGGGG + Intronic
968939246 4:3629546-3629568 TTGGGGAAACTGAGGCTCAGCGG + Intergenic
971300084 4:25434692-25434714 CTGAGTAAACTGAGGCTGAGTGG + Intergenic
975068166 4:70096405-70096427 TTGGGGAAACAGATGGTGTTTGG + Intergenic
977364738 4:96053856-96053878 TAAGGGAAGCTGATGGTGAGAGG - Intergenic
979171532 4:117606303-117606325 TTTGTGAAATTGATGGTGAGGGG - Intergenic
979314041 4:119238372-119238394 TTGGGGAAACAGATGGTCAGTGG + Intronic
979454872 4:120915904-120915926 CTGGGTGGGCTGATGGTGAGGGG - Intronic
981661678 4:147174899-147174921 TTGAGTACACTGATTTTGAGAGG + Intergenic
982294667 4:153814865-153814887 TTAGTTAATCTGATGGTGGGGGG - Intergenic
983140150 4:164140467-164140489 TTAGGTAATCTGTGGGTGAGGGG - Intronic
985122353 4:186656605-186656627 CAGGGTAAACTGATGATGAATGG + Intronic
989318083 5:40104962-40104984 TAAGGAAAACTGAGGGTGAGAGG - Intergenic
989775530 5:45202392-45202414 TTGGGTAAAGTGGGGGAGAGTGG - Intergenic
992538537 5:77738384-77738406 ATGGGGAAACTGAGGGTCAGGGG - Intronic
993889976 5:93462015-93462037 TTGGGGAAAGTGTTGGTGTGAGG + Intergenic
994021452 5:95030309-95030331 TTAGGTAGGCTGATGTTGAGTGG - Intronic
994517597 5:100790498-100790520 TTATGTTAACTGAAGGTGAGAGG + Intergenic
996598657 5:125235005-125235027 TTGGATAAACTGTTGATGAAAGG + Intergenic
997296913 5:132774297-132774319 TTGGGGAAAGTGAAGCTGAGGGG - Intronic
997867322 5:137476000-137476022 TGGGGTAAAATGTTGGGGAGGGG + Intronic
998266451 5:140671095-140671117 TTGGGTTAAGTTGTGGTGAGGGG - Exonic
999089941 5:148927212-148927234 TTGGGGAAACTGAGGCCGAGAGG - Intronic
999139410 5:149348011-149348033 ATGAGAAAACTGATGCTGAGAGG - Intronic
999429642 5:151515147-151515169 TTGGGTGATCTGCTGCTGAGAGG - Intronic
999601742 5:153273777-153273799 TAGGGTAAAGTCATGGTTAGAGG + Intergenic
1003286893 6:4742258-4742280 CTTGGGAAACTGATGGTGGGAGG + Intronic
1003489777 6:6611358-6611380 TTGGGAAAACTGAGGCAGAGAGG - Intronic
1004458782 6:15816678-15816700 TGGGGGAGACTGATGGGGAGTGG + Intergenic
1005469850 6:26152481-26152503 TTGAGAAAACTGTTGGTAAGAGG - Intergenic
1006243386 6:32707197-32707219 TTGGTTAGTCTGATGGTTAGAGG - Intergenic
1006311477 6:33264231-33264253 GTGGTGAAACTCATGGTGAGTGG - Intronic
1006786980 6:36674790-36674812 TTGGTAACACTGATGCTGAGGGG + Intergenic
1006925250 6:37650381-37650403 TTGGGCACACTGATGGTGGGCGG + Exonic
1008742636 6:54627968-54627990 GTGGGAAAAATGATGGTGGGTGG + Intergenic
1009061369 6:58401045-58401067 TAAGGGAAACTGAGGGTGAGGGG - Intergenic
1013379202 6:109550009-109550031 TTAAGTAAATTGATGGTGATTGG + Intronic
1013571427 6:111430182-111430204 TTGGCTAAAGTGCTTGTGAGAGG - Intronic
1014191415 6:118500863-118500885 TTGGATAAACAGCTTGTGAGAGG + Intronic
1014765788 6:125404870-125404892 TTCGGTAAAGTGGTGGTGATGGG + Intergenic
1015117769 6:129668335-129668357 TTGGGTAAATTGATGGTTTGGGG - Intronic
1015745983 6:136510257-136510279 TGGGCTCAGCTGATGGTGAGAGG + Intronic
1015863497 6:137704748-137704770 TTGGGGAAACTGATCTTGTGAGG - Intergenic
1016429103 6:143964297-143964319 TTTGATAAACTGAAGGTCAGAGG + Intronic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1022205384 7:28158726-28158748 TTGGGTAAACTGATGGTGAGAGG - Intronic
1022779098 7:33560029-33560051 CTGGGTAAACTGATAGAGAGGGG - Intronic
1023677745 7:42648306-42648328 TTGGGTGAACTGGTAGGGAGTGG - Intergenic
1024211368 7:47208574-47208596 TTGGGAACACTAATGGGGAGTGG + Intergenic
1024567377 7:50692938-50692960 ATGGGAAAACTGAGGCTGAGAGG - Intronic
1031432825 7:121694133-121694155 TTTGGTAAGCTGATGGTATGAGG - Intergenic
1034695285 7:153048008-153048030 TTAGGTAAACTGATGTTCCGTGG - Intergenic
1036917477 8:12818470-12818492 TTGGGAAAAGTGAAGATGAGAGG - Intergenic
1040640301 8:49326490-49326512 TTTGTTGAAGTGATGGTGAGGGG + Intergenic
1041489976 8:58422744-58422766 TTGGGGAAACTGATCTTGTGAGG - Intronic
1043085166 8:75821598-75821620 TTGGGTAAAGTGATGGTTAATGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1044142848 8:88675887-88675909 TAAGGGAAACTGAGGGTGAGAGG + Intergenic
1044448548 8:92306876-92306898 TTAGGAAAAATGATGCTGAGAGG - Intergenic
1045017657 8:98012862-98012884 ATGAGAAAACTGATGGTCAGAGG - Intronic
1048902952 8:139057456-139057478 TTTGGTAAAATGAGGGAGAGGGG - Intergenic
1049933936 9:482518-482540 ATGGGTAAACTGAGGCTCAGGGG + Intronic
1056294570 9:85179451-85179473 TTTGGGAAAGGGATGGTGAGTGG + Intergenic
1058981343 9:110173551-110173573 CTAGGAAAACTGATGGTCAGGGG - Intergenic
1059422667 9:114201982-114202004 TTGAGGAAACTGATGTTCAGAGG - Intronic
1059841712 9:118224482-118224504 TTGGTCAAACAGATGGGGAGTGG - Intergenic
1060320449 9:122554121-122554143 TTGGGTAAACTTTTTGTCAGTGG + Exonic
1061665358 9:132157746-132157768 TTGGGTAAAGTGAGGCAGAGAGG + Intergenic
1062284079 9:135765409-135765431 AGGGGTAAACTGAGGCTGAGAGG - Intronic
1062674237 9:137730885-137730907 GTTGGTAAGTTGATGGTGAGGGG - Intronic
1185883816 X:3764101-3764123 AGGGGTAAATTGATGGTGGGTGG - Intergenic
1188048062 X:25450956-25450978 ATGGGTAAACTGAGTCTGAGAGG + Intergenic
1189661426 X:43304009-43304031 TTAGGTAAACTGATGGAGTGGGG + Intergenic
1198231286 X:134692093-134692115 TTGGGAAGACGGATGGTGACAGG + Intronic
1198530122 X:137544319-137544341 GTGGGTAAAGTGAAGGTAAGAGG - Intergenic
1199509255 X:148602040-148602062 TGGGGTAAAGTGATGGAGTGAGG + Intronic
1200738058 Y:6821743-6821765 TTGGGGAAACAGATGGTGTTTGG + Intergenic