ID: 1022206494

View in Genome Browser
Species Human (GRCh38)
Location 7:28169270-28169292
Sequence GCTCCACTTCAGCACTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022206494_1022206497 -8 Left 1022206494 7:28169270-28169292 CCCTGAAAGTGCTGAAGTGGAGC 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1022206497 7:28169285-28169307 AGTGGAGCCAATATATAAAAGGG No data
1022206494_1022206500 7 Left 1022206494 7:28169270-28169292 CCCTGAAAGTGCTGAAGTGGAGC 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1022206500 7:28169300-28169322 TAAAAGGGAGTTTCCAATCTGGG No data
1022206494_1022206499 6 Left 1022206494 7:28169270-28169292 CCCTGAAAGTGCTGAAGTGGAGC 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1022206499 7:28169299-28169321 ATAAAAGGGAGTTTCCAATCTGG 0: 1
1: 0
2: 1
3: 17
4: 274
1022206494_1022206496 -9 Left 1022206494 7:28169270-28169292 CCCTGAAAGTGCTGAAGTGGAGC 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1022206496 7:28169284-28169306 AAGTGGAGCCAATATATAAAAGG 0: 1
1: 0
2: 1
3: 23
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022206494 Original CRISPR GCTCCACTTCAGCACTTTCA GGG (reversed) Intronic
903753352 1:25644003-25644025 GTTCCACTTCAGCTTTTTCAGGG + Intronic
908943095 1:69460356-69460378 ACTTCTCTTCAGCACTTTAATGG + Intergenic
908944827 1:69482650-69482672 GCCACATTTCAGCATTTTCAGGG + Intergenic
909813075 1:79955293-79955315 TTTCCACTTCTGAACTTTCATGG - Intergenic
910767335 1:90794842-90794864 GCTTCCCTCCAGCACTTTGATGG + Intergenic
913447883 1:118969350-118969372 GCTTCCCTTCAGGTCTTTCATGG - Intronic
915415235 1:155736863-155736885 ACTCTACTTAAGCACTTTGAAGG - Intronic
916766910 1:167869765-167869787 GCTCAACTTCTGCCCTTTTAAGG - Intronic
918758361 1:188367783-188367805 GCTCCACTTCAGTAGTAGCAAGG - Intergenic
919928236 1:202204033-202204055 GCTCTACTTCATCAGATTCAGGG + Intronic
920234519 1:204494113-204494135 ACTCCACTCCAGCAGCTTCAGGG - Intronic
922622591 1:227001457-227001479 GCCTCACTTCAGCACTTCTAAGG + Intronic
1064853322 10:19735435-19735457 TCTCCTCTTCAACACCTTCAGGG - Intronic
1066479248 10:35779503-35779525 TCTCCACTTCAGCTCTTTCATGG + Intergenic
1068353503 10:55880921-55880943 GCTCCACTGCAGCTGTTCCAAGG - Intergenic
1069055229 10:63838021-63838043 GTTCCATTGCAGCATTTTCAGGG - Intergenic
1079086494 11:17449308-17449330 GCCCCACTTCATCATTTTTATGG - Intronic
1080764440 11:35282293-35282315 GTTCAACTGCAGAACTTTCACGG - Intronic
1084214245 11:67639018-67639040 GCTGCCCCTCAACACTTTCAGGG + Intronic
1084379346 11:68801193-68801215 GTTCCACTTCAGCTCATTCAGGG - Intronic
1088322917 11:108571591-108571613 GCTCCCCTTCAGCATTACCAGGG - Intronic
1089528533 11:119112357-119112379 GCTGCTCCTCAGCACTTTGAGGG - Exonic
1090395977 11:126418572-126418594 GCTCCACTTCTTCACTTAAAGGG + Intronic
1096499047 12:52054478-52054500 GCCCAGCTTCAGCACCTTCATGG + Exonic
1098590956 12:72211363-72211385 CAGCCACTTCAGCTCTTTCATGG - Intronic
1100050098 12:90437918-90437940 CCCCCACTCCAGCACTTTAAAGG + Intergenic
1101909138 12:108849803-108849825 GCTCCCCTCCAGCCCTTTCTTGG - Intronic
1102752272 12:115305752-115305774 GCTCCACTTCTGCCCATTCATGG - Intergenic
1102944437 12:116973647-116973669 TGTCCTCTTCAGCACTGTCAAGG + Intronic
1103176423 12:118867513-118867535 CCTCCGCCTCAGCAATTTCAAGG + Intergenic
1103330627 12:120151422-120151444 GCTCCGCTGCAGCCGTTTCATGG + Intronic
1103556507 12:121769909-121769931 GCCCCACTTCACCTCCTTCATGG - Intronic
1104185573 12:126427215-126427237 GCTCCACATCTGCAGTTACAAGG + Intergenic
1108569796 13:51738050-51738072 GCTACACTTAAGAGCTTTCAGGG - Intronic
1108686071 13:52819485-52819507 GCTCCACCTCTGGACTTTCCAGG + Intergenic
1109755321 13:66751169-66751191 GCTCTGCTTCAGAACTTGCAAGG - Intronic
1110161545 13:72384398-72384420 GCTCTTCTTCCTCACTTTCAAGG + Intergenic
1112234769 13:97625348-97625370 ACTTCCCTTCAGCTCTTTCAGGG - Intergenic
1119622368 14:76140838-76140860 GCTCCAATTCAGCAAGTTCTGGG - Intergenic
1123578521 15:21695789-21695811 GCTCCCCTTCAGGGCTTTCTGGG - Intergenic
1123615148 15:22138271-22138293 GCTCCCCTTCAGGGCTTTCTGGG - Intergenic
1124834043 15:33178246-33178268 GCTTCACTCCAGCACTTCCAAGG + Intronic
1126989102 15:54350745-54350767 ACTCCACTACAGCAGTTTTATGG - Intronic
1129537329 15:76324663-76324685 GCTTCACTTCAGCATTATGAAGG - Intergenic
1129809547 15:78497195-78497217 GCTCCACTTCAGTTCCTTCCAGG + Exonic
1130139827 15:81215925-81215947 GCTCCACCTGAGTACTTTCCTGG - Intronic
1202987391 15_KI270727v1_random:430034-430056 GCTCCCCTTCAGGGCTTTCTGGG - Intergenic
1135280231 16:21147942-21147964 GCTGCCGTTCAGCACTTTAAAGG + Intronic
1135546320 16:23369434-23369456 GCCCCACTTCCTCACTTCCATGG - Intronic
1137626547 16:49912473-49912495 TCTCCTCTTCAGCTCATTCATGG - Intergenic
1139331250 16:66193197-66193219 TCACCACTTCAGCACTTTGCTGG + Intergenic
1140742883 16:77957154-77957176 TCCCCACTTGAGAACTTTCAAGG + Intronic
1141498723 16:84428907-84428929 GCACCACTGCATCATTTTCATGG - Intronic
1141657307 16:85423075-85423097 GCTCCACTTCAGTGCTTGCGAGG - Intergenic
1142900543 17:3008710-3008732 GCTCCACTTGAATACTTCCAGGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1146139950 17:30357194-30357216 GCCCCACTTCTGAACTTTGAGGG - Intergenic
1147704257 17:42415021-42415043 CCTCTACTTCAGCACTTACAAGG + Intronic
1148437031 17:47693249-47693271 GCCCCACCTAAGCACTCTCATGG - Intergenic
1151352657 17:73540987-73541009 CCTCCCCTACAGCACTTTCCTGG + Intronic
1152297831 17:79478637-79478659 CCTCCCCTTCACCACTCTCATGG - Intronic
1156133301 18:34004957-34004979 TTTCCATTTCTGCACTTTCAGGG + Intronic
1162784445 19:13025416-13025438 GCTCCCCATCAGTACTTTCCAGG - Exonic
1164166883 19:22687021-22687043 AATCCTCTTCAGCACTTTAAAGG - Intergenic
1165863573 19:38922240-38922262 GCTGCACTTCACCACTGTCCTGG + Exonic
931075526 2:58707231-58707253 CCAGCAATTCAGCACTTTCAGGG - Intergenic
931725626 2:65107731-65107753 GCTCCAGTACAGCAAATTCAGGG - Intronic
931757309 2:65385502-65385524 CCTCCACTGCAGCACTGGCATGG - Intronic
932362695 2:71122207-71122229 CCTCCACCTCAGCACTTCCTGGG + Intronic
934087965 2:88525998-88526020 CCTCCACAACAGCACTTGCAGGG - Intronic
937626562 2:124050555-124050577 ACTCCACTTCTGCACTTTCCGGG + Intronic
938033025 2:128011756-128011778 TGTCCCCTTAAGCACTTTCAGGG - Intronic
938224821 2:129606626-129606648 GCTCCACATCAGCACTCCCGAGG + Intergenic
940685560 2:156846205-156846227 GCCACACTTCAACAATTTCAAGG - Intergenic
942249712 2:174037501-174037523 TCTCCACTCCAGCTCTTCCAAGG + Intergenic
943076634 2:183203484-183203506 AATCCACTTCTACACTTTCATGG - Intergenic
1172364392 20:34337880-34337902 ACTCCATCTCAGCACTTTCCAGG + Intergenic
1172779403 20:37426901-37426923 GCAGCATTTCAGCACTTTCTGGG + Intergenic
1173466507 20:43287003-43287025 TCTACACTTAAGCATTTTCAGGG - Intergenic
1173822769 20:46029693-46029715 GCTCCACATCAGCCCATTCTAGG - Intronic
1176342155 21:5709229-5709251 GCGCAACTTCAGAGCTTTCAGGG - Intergenic
1176474409 21:7141381-7141403 GCGCAACTTCAGAGCTTTCAGGG - Intergenic
1176502672 21:7615227-7615249 GCGCAACTTCAGAGCTTTCAGGG + Intergenic
1176536476 21:8107298-8107320 GCGCAACTTCAGAGCTTTCAGGG - Intergenic
1177862236 21:26468247-26468269 GATCCACCTAAGCACATTCAGGG - Exonic
1178580971 21:33838367-33838389 GTTGCACTTCAGTATTTTCACGG + Intronic
1183525370 22:38319406-38319428 CCTCTTCTTCAGCACTTTCAAGG + Intronic
1183985879 22:41570194-41570216 GCCCCACTTCAGCCTTTTCAGGG + Intronic
1185095372 22:48803479-48803501 GCAGCACCTCAGCAGTTTCAAGG - Intronic
1203241421 22_KI270733v1_random:23710-23732 GCGCAACTTCAGAGCTTTCAGGG - Intergenic
951418753 3:22458277-22458299 GGTGCACTGCAGCACTTTCAAGG + Intergenic
952748639 3:36805445-36805467 GCTGCACTTTGGCACCTTCATGG + Intergenic
954850893 3:53599378-53599400 GCTTCAATGCAGCAATTTCAAGG - Intronic
959563341 3:107808009-107808031 ACTCCTCTCCAGCAGTTTCAGGG - Intronic
960132463 3:114071885-114071907 TCTCCACTTCAACTCTTACATGG + Intronic
963247612 3:143077066-143077088 GCTCCCCTTCAGGACTGTAACGG - Intergenic
968697114 4:2036602-2036624 GCTCCACTACAACATGTTCAGGG + Intronic
970855980 4:20650055-20650077 TCTCCACTTCCACCCTTTCAAGG + Intergenic
971004333 4:22356933-22356955 GCTGCACCTGAGCACTTTCCTGG + Intronic
973324434 4:48844236-48844258 GCTCTACTTCAGCTATTTAATGG - Intronic
975052261 4:69880409-69880431 GCCACACTTAAGCTCTTTCAAGG - Intergenic
975445930 4:74465525-74465547 CCTCCACTTCATCACTTTCTTGG - Intergenic
976784413 4:88801811-88801833 CCTCCCCTACACCACTTTCATGG - Intronic
978063235 4:104364559-104364581 GCTCTACTTGAGCACATTCCTGG + Intergenic
981036822 4:140178674-140178696 GTTCCACTTCAGAATTTTCTTGG - Intergenic
982505827 4:156216761-156216783 TTTCCACTTCTGCAATTTCAAGG + Intergenic
985014806 4:185623074-185623096 GCTCCTCCTCAGCGCTCTCAGGG + Exonic
985246837 4:187987445-187987467 GCTTCACTGCATCACTTTCCTGG + Intergenic
985857913 5:2445017-2445039 GCTATACTTCTGTACTTTCAGGG + Intergenic
986148681 5:5106142-5106164 ACTCCACTTCAGCAGTCTCTGGG + Intergenic
986359224 5:6959912-6959934 GCCCCACTTCATCACTATCCTGG + Intergenic
988527824 5:32001885-32001907 GCTCCACTTCACCAGTTCCTCGG - Intronic
991522707 5:67518372-67518394 GCTTCAGTTCTGCACATTCAGGG + Intergenic
995061054 5:107812371-107812393 ACTCCACTTCTGCTCTTTCCTGG + Intergenic
996749283 5:126872825-126872847 GATCCACTTTAGCATGTTCAGGG - Intronic
997734713 5:136204714-136204736 GCTCTACTTAAGCTCTTTCTAGG + Intergenic
998375498 5:141687912-141687934 GCCCTATTTCAGCATTTTCAAGG - Intergenic
1001229764 5:169976219-169976241 CTTCCACATCAGCACTCTCATGG - Intronic
1001786050 5:174414508-174414530 TCTCAACATCAGCACTGTCAAGG + Intergenic
1002080977 5:176737260-176737282 GATCCATTTGAGCAGTTTCAGGG + Intergenic
1003091574 6:3108385-3108407 TCTCCACTTCGTAACTTTCATGG + Intronic
1003186577 6:3836884-3836906 GATCAACTTCAGCACTCTGAAGG + Intergenic
1004951328 6:20675900-20675922 GCTCCACTAGAAGACTTTCAGGG - Intronic
1013057030 6:106592943-106592965 CCTCAAATTTAGCACTTTCAAGG + Intronic
1017869157 6:158471610-158471632 GTTCTACTTCAGCTCTTTCCTGG - Intronic
1018430146 6:163715778-163715800 GCTCCGCTTCAGCACCTTCCAGG - Intergenic
1019762434 7:2823378-2823400 GCCCCAATTCAGGACTTTGACGG + Intronic
1020413852 7:7923602-7923624 GCTTTACTTTAGCATTTTCAGGG + Intronic
1021285764 7:18779247-18779269 GCTCCATTTCAAGACTCTCAGGG + Intronic
1022092466 7:27116501-27116523 GACTCACTTTAGCACTTTCATGG + Intronic
1022206494 7:28169270-28169292 GCTCCACTTCAGCACTTTCAGGG - Intronic
1022531040 7:31067071-31067093 GCTCCACTTGTGCCCTCTCAGGG + Intronic
1023352792 7:39336779-39336801 TCTCCACTTCAGCATTTACTTGG - Intronic
1023753731 7:43396342-43396364 GCTCCTCTCCAGCAGTTTCCTGG + Intronic
1025792993 7:64709823-64709845 GCTCCTCTTCTTCACTTTAAAGG - Exonic
1028058291 7:86276467-86276489 AAACCACTTCAGCACTTTCAAGG - Intergenic
1028387315 7:90270995-90271017 GCATTACTTCAGTACTTTCAAGG - Intronic
1028985935 7:97007961-97007983 GCTCCAGTTATGCACTTTCCTGG + Intronic
1030333322 7:108296336-108296358 GCTCTACTTCAGTTCTTTCTAGG - Intronic
1030492845 7:110259931-110259953 GCACCACTTCAAAAATTTCAAGG + Intergenic
1031208883 7:118796504-118796526 GATAAACTTCAGCAGTTTCAGGG - Intergenic
1032542398 7:132714069-132714091 GCTAAACTTCTGCACTCTCATGG + Intronic
1033288569 7:140062553-140062575 GCTCCACCTCTGCAGGTTCATGG - Exonic
1038342677 8:26700621-26700643 CCTCCAGTTCAGGACTTTCAAGG - Intergenic
1046116633 8:109792393-109792415 ACTCCACTTCAGCTCATTCTTGG + Intergenic
1047526990 8:125641925-125641947 GCTCCACGGCACCACATTCAAGG + Intergenic
1050946246 9:11523107-11523129 GTTTCACTTCTGCACTTTCCAGG + Intergenic
1053077584 9:35147184-35147206 AATCCTCTTCAGCACTTTAAAGG + Intergenic
1053484673 9:38442778-38442800 GCTCCATTTGGGCACTGTCAGGG - Intergenic
1057258882 9:93573179-93573201 GCTGCACTTCAGCACTTAGGAGG - Intergenic
1061033192 9:128099187-128099209 GCTCGGCTTCCTCACTTTCAGGG - Intronic
1061224597 9:129273449-129273471 GCTGCATGTCGGCACTTTCACGG - Intergenic
1062043804 9:134416050-134416072 GCCCCAGCTCAGGACTTTCAGGG + Intronic
1203457742 Un_GL000220v1:6783-6805 GCGCAACTTCAGAGCTTTCAGGG - Intergenic
1186850344 X:13573894-13573916 ACTCTAGTTCAGCACATTCAAGG + Intronic
1189049056 X:37624934-37624956 GCTCACATTCACCACTTTCATGG + Intronic
1189563222 X:42212585-42212607 GCTCCACGTGATCACTTTAAGGG - Intergenic
1191177193 X:57516889-57516911 GCTCCCCTACAGCACATTCCTGG - Intergenic
1191605579 X:63058491-63058513 GCTGCATTTCACCTCTTTCATGG - Intergenic
1192917970 X:75674021-75674043 GGTCCACTTCTGAGCTTTCAGGG - Intergenic
1193006790 X:76627984-76628006 GCTCAACTTCACTAATTTCAGGG + Intergenic