ID: 1022206551

View in Genome Browser
Species Human (GRCh38)
Location 7:28169935-28169957
Sequence TGCAGAAGCGATTTAAGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022206547_1022206551 -9 Left 1022206547 7:28169921-28169943 CCCAGATGTGCTCCTGCAGAAGC 0: 1
1: 0
2: 3
3: 15
4: 163
Right 1022206551 7:28169935-28169957 TGCAGAAGCGATTTAAGGTCTGG 0: 1
1: 1
2: 0
3: 5
4: 88
1022206548_1022206551 -10 Left 1022206548 7:28169922-28169944 CCAGATGTGCTCCTGCAGAAGCG No data
Right 1022206551 7:28169935-28169957 TGCAGAAGCGATTTAAGGTCTGG 0: 1
1: 1
2: 0
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022206551 Original CRISPR TGCAGAAGCGATTTAAGGTC TGG Intronic