ID: 1022209529

View in Genome Browser
Species Human (GRCh38)
Location 7:28195035-28195057
Sequence CTGACGTGCCCTGTGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022209529_1022209537 16 Left 1022209529 7:28195035-28195057 CCCAGCAGCACAGGGCACGTCAG No data
Right 1022209537 7:28195074-28195096 TCATCTCCAAATGTGCTCAGGGG No data
1022209529_1022209535 14 Left 1022209529 7:28195035-28195057 CCCAGCAGCACAGGGCACGTCAG No data
Right 1022209535 7:28195072-28195094 TGTCATCTCCAAATGTGCTCAGG No data
1022209529_1022209536 15 Left 1022209529 7:28195035-28195057 CCCAGCAGCACAGGGCACGTCAG No data
Right 1022209536 7:28195073-28195095 GTCATCTCCAAATGTGCTCAGGG No data
1022209529_1022209538 17 Left 1022209529 7:28195035-28195057 CCCAGCAGCACAGGGCACGTCAG No data
Right 1022209538 7:28195075-28195097 CATCTCCAAATGTGCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022209529 Original CRISPR CTGACGTGCCCTGTGCTGCT GGG (reversed) Intergenic