ID: 1022209536 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:28195073-28195095 |
Sequence | GTCATCTCCAAATGTGCTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022209530_1022209536 | 14 | Left | 1022209530 | 7:28195036-28195058 | CCAGCAGCACAGGGCACGTCAGG | No data | ||
Right | 1022209536 | 7:28195073-28195095 | GTCATCTCCAAATGTGCTCAGGG | No data | ||||
1022209529_1022209536 | 15 | Left | 1022209529 | 7:28195035-28195057 | CCCAGCAGCACAGGGCACGTCAG | No data | ||
Right | 1022209536 | 7:28195073-28195095 | GTCATCTCCAAATGTGCTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022209536 | Original CRISPR | GTCATCTCCAAATGTGCTCA GGG | Intergenic | ||