ID: 1022209537

View in Genome Browser
Species Human (GRCh38)
Location 7:28195074-28195096
Sequence TCATCTCCAAATGTGCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022209529_1022209537 16 Left 1022209529 7:28195035-28195057 CCCAGCAGCACAGGGCACGTCAG No data
Right 1022209537 7:28195074-28195096 TCATCTCCAAATGTGCTCAGGGG No data
1022209530_1022209537 15 Left 1022209530 7:28195036-28195058 CCAGCAGCACAGGGCACGTCAGG No data
Right 1022209537 7:28195074-28195096 TCATCTCCAAATGTGCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022209537 Original CRISPR TCATCTCCAAATGTGCTCAG GGG Intergenic