ID: 1022209538

View in Genome Browser
Species Human (GRCh38)
Location 7:28195075-28195097
Sequence CATCTCCAAATGTGCTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022209532_1022209538 -10 Left 1022209532 7:28195062-28195084 CCCCTAGATCTGTCATCTCCAAA No data
Right 1022209538 7:28195075-28195097 CATCTCCAAATGTGCTCAGGGGG No data
1022209529_1022209538 17 Left 1022209529 7:28195035-28195057 CCCAGCAGCACAGGGCACGTCAG No data
Right 1022209538 7:28195075-28195097 CATCTCCAAATGTGCTCAGGGGG No data
1022209530_1022209538 16 Left 1022209530 7:28195036-28195058 CCAGCAGCACAGGGCACGTCAGG No data
Right 1022209538 7:28195075-28195097 CATCTCCAAATGTGCTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022209538 Original CRISPR CATCTCCAAATGTGCTCAGG GGG Intergenic