ID: 1022209639

View in Genome Browser
Species Human (GRCh38)
Location 7:28195840-28195862
Sequence CATACTTCCCAAATTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022209628_1022209639 24 Left 1022209628 7:28195793-28195815 CCTTTGCTTTGAGAAGCCCTAGA No data
Right 1022209639 7:28195840-28195862 CATACTTCCCAAATTGATATTGG No data
1022209634_1022209639 8 Left 1022209634 7:28195809-28195831 CCCTAGATCTCATGGGTCGGGGG No data
Right 1022209639 7:28195840-28195862 CATACTTCCCAAATTGATATTGG No data
1022209636_1022209639 7 Left 1022209636 7:28195810-28195832 CCTAGATCTCATGGGTCGGGGGT No data
Right 1022209639 7:28195840-28195862 CATACTTCCCAAATTGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022209639 Original CRISPR CATACTTCCCAAATTGATAT TGG Intergenic
No off target data available for this crispr