ID: 1022214275

View in Genome Browser
Species Human (GRCh38)
Location 7:28242937-28242959
Sequence TTAGTGCTCCAGCACTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022214275_1022214277 5 Left 1022214275 7:28242937-28242959 CCCATATAGTGCTGGAGCACTAA No data
Right 1022214277 7:28242965-28242987 AGAGCTTTTGAACTACTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022214275 Original CRISPR TTAGTGCTCCAGCACTATAT GGG (reversed) Intergenic
No off target data available for this crispr