ID: 1022214289

View in Genome Browser
Species Human (GRCh38)
Location 7:28243108-28243130
Sequence CAAGGTCACTCATAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022214286_1022214289 -10 Left 1022214286 7:28243095-28243117 CCAGGAGAGTGAACAAGGTCACT No data
Right 1022214289 7:28243108-28243130 CAAGGTCACTCATAGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022214289 Original CRISPR CAAGGTCACTCATAGGAAGG TGG Intergenic
No off target data available for this crispr