ID: 1022214376

View in Genome Browser
Species Human (GRCh38)
Location 7:28243688-28243710
Sequence GACACTAGTCAGATTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022214376_1022214379 20 Left 1022214376 7:28243688-28243710 CCTGTTTTAATCTGACTAGTGTC No data
Right 1022214379 7:28243731-28243753 GTACACACACAGAGACATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022214376 Original CRISPR GACACTAGTCAGATTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr