ID: 1022215234

View in Genome Browser
Species Human (GRCh38)
Location 7:28253204-28253226
Sequence AAGGAGAAGGAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022215234_1022215241 13 Left 1022215234 7:28253204-28253226 CCTGCTTCCTTCTCCTTCTCCTT No data
Right 1022215241 7:28253240-28253262 CCTGCACCGTGGTCCCTTCCAGG No data
1022215234_1022215239 2 Left 1022215234 7:28253204-28253226 CCTGCTTCCTTCTCCTTCTCCTT No data
Right 1022215239 7:28253229-28253251 GAGGTAGCAGACCTGCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022215234 Original CRISPR AAGGAGAAGGAGAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr