ID: 1022222262

View in Genome Browser
Species Human (GRCh38)
Location 7:28325012-28325034
Sequence TGCATTGGAGGTAAAAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 310}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022222262 Original CRISPR TGCATTGGAGGTAAAAGAAG TGG (reversed) Intronic
903373457 1:22851496-22851518 CACATTGGAGGGAAGAGAAGGGG - Intronic
906045274 1:42825385-42825407 AGCATTGGAGGAAAAGGGAGTGG + Intronic
906265898 1:44429138-44429160 TGGAGTGGAGGCAAAAGTAGAGG - Intronic
907089130 1:51708020-51708042 TGTAGTTGAGGTCAAAGAAGGGG + Intronic
908354267 1:63316365-63316387 TGCACTGGAGGGTAGAGAAGAGG + Intergenic
908604965 1:65787978-65788000 TGCAGTATAGGAAAAAGAAGAGG - Intergenic
910697018 1:90030189-90030211 TGCAGTGGAGGTAGAAGAGTCGG - Intronic
911257998 1:95654277-95654299 TGCAATGGAGTAGAAAGAAGAGG + Intergenic
911733602 1:101314173-101314195 TGTATTGCAGGTGAAAGAATAGG - Intergenic
911884204 1:103277121-103277143 AGTTTTGGAGGTAAAAGGAGAGG - Intergenic
913298274 1:117343601-117343623 TGCATTGGGGCTAAATGATGTGG - Intergenic
914473285 1:148002318-148002340 TGCATTCAGGGTAGAAGAAGTGG - Intergenic
917598466 1:176552824-176552846 TGCTTTGGAGTGAAAAAAAGGGG + Intronic
919567075 1:199201699-199201721 TTCATTGGAGGTTAAATCAGAGG - Intergenic
919647763 1:200112840-200112862 TGCATTGGAAGTACAAGACTGGG + Intronic
920195341 1:204222776-204222798 TGCACTGGAGAAAAAAGAAATGG + Exonic
920715636 1:208337683-208337705 TCCATTAGAGGGAAGAGAAGAGG + Intergenic
920852556 1:209638329-209638351 TTTATTGGAGGTGAAAGAAAGGG - Intronic
921558436 1:216627316-216627338 TGCATGGGAGGTAGAGGCAGAGG - Intronic
921561448 1:216663237-216663259 TGCTCTGGAGGCAAAAGCAGGGG + Intronic
922036689 1:221855055-221855077 TGCATTGTAAGTTAAAAAAGTGG + Intergenic
923622194 1:235588225-235588247 TGCGCTGGAGATAAAATAAGCGG + Intronic
1063105022 10:2985395-2985417 GTCAGTGGAGGGAAAAGAAGGGG + Intergenic
1063985443 10:11496869-11496891 TGTATTGAAGGTCAGAGAAGGGG + Intronic
1064705688 10:18070137-18070159 TGCTTTGAAGGTAGAGGAAGGGG - Intergenic
1066589152 10:36974141-36974163 GGCTTTGGAGATAGAAGAAGTGG + Intergenic
1066620517 10:37344769-37344791 GGCAATGTAGGTAGAAGAAGTGG + Intronic
1066641710 10:37560605-37560627 TGCTATGGAGGAAAAAAAAGAGG - Intergenic
1067827869 10:49592445-49592467 TGCATTGGACGTCTAAGCAGAGG + Intergenic
1069783672 10:70974391-70974413 TGGATTGGAAGTAAAGGAGGAGG + Intergenic
1070802083 10:79249805-79249827 TGCATTGGGGGGAAAGGGAGAGG - Intronic
1070888235 10:79923146-79923168 TGGATGGGAGGAAAATGAAGGGG + Intergenic
1071456592 10:85855966-85855988 CACAGTGGAGGTATAAGAAGGGG + Intronic
1071809086 10:89158899-89158921 TGGATTTCAGGTAAATGAAGAGG + Intergenic
1073614638 10:104981192-104981214 GGCATGGGAGGTAGAAGGAGTGG - Intronic
1074449339 10:113546472-113546494 TAGGTTGGAGGTAACAGAAGTGG + Intergenic
1074559396 10:114521684-114521706 TGAATGGGAGGGAAAAGGAGAGG - Intronic
1075846541 10:125549501-125549523 AGCATTGGAAGTGAAAGAAATGG - Intergenic
1076416831 10:130297259-130297281 TGCTTTGCAGATCAAAGAAGGGG + Intergenic
1076672327 10:132130155-132130177 TGCGTTGGAGGTGCTAGAAGAGG - Intronic
1079287431 11:19149495-19149517 TTCATTGGAGGGAAAAGGACAGG + Intronic
1081297894 11:41414240-41414262 TGCATTTGAGAAAAAAGAAGAGG + Intronic
1082942955 11:58727346-58727368 GGCATGTGAAGTAAAAGAAGAGG + Intronic
1084874046 11:72117579-72117601 TGCATTGGAGGCAAAGGCTGAGG + Intronic
1086241667 11:84701169-84701191 TGTATTGGAAGTAAGAGAAATGG - Intronic
1086892172 11:92270930-92270952 TGGATTGGATGTAAAAAATGAGG - Intergenic
1087810403 11:102604091-102604113 TGCAGTGGGGGTAAAGGAGGTGG - Intronic
1088228853 11:107652497-107652519 TGCATTGGAAATATAAGAAAAGG - Intronic
1088228878 11:107653111-107653133 TGCATTGGAAGTATAAGAAAAGG + Intronic
1088318080 11:108527525-108527547 TGGTTTGGAGATAAAAGAAATGG - Intronic
1091909762 12:4220149-4220171 TGCTTTGCAGGGAAAAGAAGCGG + Intergenic
1091965883 12:4741252-4741274 TACATTGGAAATAAAAAAAGAGG - Intronic
1093783245 12:23161744-23161766 TGTATTGAAGGAAAAAAAAGAGG + Intergenic
1095775796 12:46008787-46008809 TGCATTGGAGGTTGTAGAAAGGG - Intergenic
1098208611 12:68138628-68138650 TGAATTGGATGTAACTGAAGGGG - Intergenic
1098415673 12:70232053-70232075 TTCATTAGAAGGAAAAGAAGAGG + Intergenic
1098713292 12:73795628-73795650 TGCATTGAAGGAAAAAAAAGAGG + Intergenic
1098738275 12:74136264-74136286 TGGATTACAGGTAAAAAAAGTGG - Intergenic
1100440245 12:94610231-94610253 TGCACTGGAGGTAGAAGAAAGGG + Intronic
1100466875 12:94854061-94854083 CATATTGGAGGTAAATGAAGGGG + Intergenic
1101533999 12:105600732-105600754 TATAGTGGAGGTAATAGAAGGGG + Intergenic
1102682506 12:114700109-114700131 TGCATTCGAGGAAAAAGAGACGG - Intergenic
1104134076 12:125921113-125921135 TGAATTGGAGAAAAAAGAACGGG - Intergenic
1104198528 12:126565174-126565196 TGCATTGGAGGTTAATAAAAGGG + Intergenic
1104410392 12:128552989-128553011 TGCCTTGGAGGTTAGAGAAAGGG + Intronic
1106845522 13:33734213-33734235 TGCTTCTGAGGTAAAAGAACTGG + Intergenic
1106989947 13:35406793-35406815 TGAATTTCAGCTAAAAGAAGAGG - Intronic
1107429909 13:40331053-40331075 TGCTTTGGAGGGAAAAAAAATGG + Intergenic
1109172001 13:59108158-59108180 TGCAATGGAGGTATAAGCATTGG - Intergenic
1110095934 13:71520776-71520798 TGCATTGGAGAAAGAAGAAAGGG + Intronic
1110754132 13:79151963-79151985 TTAATGGGAGGTAAAGGAAGAGG - Intergenic
1110805166 13:79745765-79745787 GGCCATAGAGGTAAAAGAAGAGG + Intergenic
1111121280 13:83854030-83854052 TCCATAGGAAGTAAAAGAACAGG - Intergenic
1111996479 13:95170456-95170478 TGAAATGGAGGAAGAAGAAGGGG + Intronic
1112109661 13:96282203-96282225 TGGAATGGAGGTGGAAGAAGGGG + Intronic
1112656287 13:101455134-101455156 TACATTGAGGGTAAAATAAGTGG - Intronic
1112780770 13:102898260-102898282 TGCATTGGAGTGACAAGAAGTGG + Intergenic
1112834223 13:103493880-103493902 GGCTTTGGAGGTTGAAGAAGGGG + Intergenic
1113415637 13:110126400-110126422 TGCATTGGTGAGAAAAGAAAAGG - Intergenic
1114516819 14:23305835-23305857 TGGATTGGAGGTAGAAGCAAAGG + Intronic
1115073184 14:29351728-29351750 TATATTGGAGATAAAAGCAGTGG + Intergenic
1115154353 14:30321262-30321284 TGCATAGGTGGGAAAAAAAGCGG + Intergenic
1115767462 14:36638155-36638177 TGCACAGGAGGTATAGGAAGAGG + Intergenic
1116854657 14:49941421-49941443 TGCATTGGAGGGAAGAGATTAGG - Intergenic
1117297272 14:54391836-54391858 TGTATTGGAGGAAAAGGGAGTGG - Intergenic
1117593757 14:57305354-57305376 TTCTTTGGAGTTAAAAAAAGAGG + Intergenic
1118704723 14:68470319-68470341 GGCATTGCTGGTAAAAGCAGAGG - Intronic
1118791609 14:69098376-69098398 TGCAGTAGAGGAAAATGAAGTGG - Intronic
1119583385 14:75808602-75808624 TTCACTCAAGGTAAAAGAAGAGG - Intronic
1120230084 14:81832622-81832644 TGCAATGGAGGAAGAAAAAGTGG + Intergenic
1120546466 14:85818299-85818321 TGCATGGGAGGTAAGGGAGGAGG + Intergenic
1120992488 14:90390099-90390121 TGCATTGGATGGATCAGAAGGGG + Intergenic
1121021640 14:90583930-90583952 GGCATTTGAGGCAAAAGAGGAGG - Intronic
1122090476 14:99335239-99335261 TGCATGGGAAGGAAAAGCAGGGG + Intergenic
1122337564 14:101004028-101004050 TGCAGTGGAAGAAAAAGAAAAGG - Intergenic
1123961643 15:25408657-25408679 TACAGTGGAGGTAAAAGGAGTGG - Exonic
1124791444 15:32731035-32731057 TGCACTGGCCGTAACAGAAGCGG - Exonic
1125144183 15:36447235-36447257 TGAATTGAAAGTTAAAGAAGAGG - Intergenic
1125727638 15:41876234-41876256 TGCAGTGGATGGAAGAGAAGGGG - Exonic
1126669445 15:51102861-51102883 TGTACAGGAGGTAAAAGGAGAGG - Intronic
1127417906 15:58774818-58774840 AGCATAGGAGGTAAACGAAATGG + Intronic
1129888516 15:79055667-79055689 GGCATTGTAGGTCAGAGAAGGGG - Intronic
1132170546 15:99648760-99648782 TGTATTGGATGCAACAGAAGAGG - Intronic
1132991841 16:2799450-2799472 CGCATTGTAGGTGACAGAAGAGG - Intergenic
1133702315 16:8320419-8320441 CGCAGTGGAGGGAAAGGAAGGGG - Intergenic
1134585638 16:15408138-15408160 TGCATTTTAGGTAAAAAATGTGG - Exonic
1139543090 16:67633429-67633451 TCCATTCGTGGTAAAATAAGTGG - Intronic
1141699256 16:85634987-85635009 GGCCTTGGAGGTGAATGAAGCGG - Intronic
1141760967 16:86028449-86028471 AGTATTGGAGGTAGAAGGAGTGG - Intergenic
1142123955 16:88400990-88401012 TCCACTGCAGGAAAAAGAAGAGG + Intergenic
1143182074 17:4989541-4989563 TGCTTTGGAGAAGAAAGAAGAGG - Exonic
1143586677 17:7853974-7853996 AGCATTGGAAGTAAAAAAGGAGG - Exonic
1148346539 17:46907301-46907323 TCCTTTGGAGGAAGAAGAAGCGG + Intergenic
1148674233 17:49435747-49435769 TGCATTGGGGGTGAACGTAGGGG - Intronic
1150308973 17:64111941-64111963 AGCAATGGAGGTAAGAGATGAGG - Intronic
1150323810 17:64239211-64239233 TGCCTTGGAGGTCAAATAATGGG + Intronic
1152383637 17:79955609-79955631 TGCATTGGAACTAAAAGGATGGG + Intronic
1153174582 18:2356754-2356776 TGAGATGGAGGTAAAAGATGGGG - Intergenic
1153852295 18:9106847-9106869 GGCTTTGGAGATGAAAGAAGGGG - Intronic
1157034401 18:43953695-43953717 TGCAATGGAGGTATAGGAATTGG - Intergenic
1157521136 18:48346411-48346433 TGCATTAGAGGTACAGGAAGCGG - Intronic
1158432554 18:57402607-57402629 TGCTTTGTAGTTAAAAGAAACGG - Intergenic
1159025507 18:63179252-63179274 TGGAGTGGAGGGAAAAGAAAAGG + Intronic
1160102466 18:75935788-75935810 TTCATTGAAGGTAAAATAACAGG - Intergenic
1160271274 18:77386544-77386566 GGCTTTGGAGATAGAAGAAGGGG + Intergenic
1163983785 19:20925911-20925933 TGCACAGGGTGTAAAAGAAGTGG + Intronic
1165056670 19:33181559-33181581 TGCATGGGAGGTAGAAACAGAGG - Intronic
1165401467 19:35603393-35603415 TGCACTGGAGGAGAAAGATGGGG + Intergenic
1165985445 19:39764985-39765007 GGCTTTTCAGGTAAAAGAAGTGG + Intergenic
1166022495 19:40044977-40044999 TGGATTGAAAGTAAAAGAACAGG + Intronic
1166432457 19:42739129-42739151 TGCATTGGGGTGAAAAGATGTGG + Intronic
1167647368 19:50712989-50713011 TGCATGGGAGATACATGAAGAGG + Intronic
1168093724 19:54102641-54102663 AGCCGTGGAGGTAAAGGAAGTGG - Exonic
925235957 2:2277380-2277402 TTGATGGGAGGTAACAGAAGTGG - Intronic
926757789 2:16250065-16250087 TGCACTGGAGGCAGAAGCAGAGG + Intergenic
927750138 2:25661531-25661553 TGCTTTGGGGGGAAAGGAAGGGG + Intronic
929511767 2:42570074-42570096 TGTATTGGAGGAAAAAGATGTGG + Intronic
929610865 2:43269787-43269809 TGCAGGGGAGGAAACAGAAGAGG - Intronic
930359039 2:50355452-50355474 TGAAATGGAGGTAAAACAAGAGG - Intronic
930364192 2:50418213-50418235 TGCTTTAGAGATATAAGAAGAGG - Intronic
931830633 2:66047438-66047460 TGCAAAGGATGTAAAGGAAGAGG - Intergenic
932084924 2:68749443-68749465 TGAAAGGGAGGTAAGAGAAGTGG - Intronic
937522962 2:122734175-122734197 TACATTGGAGAGAAAAGCAGAGG - Intergenic
939049224 2:137287698-137287720 TGCAGTGGAGGTACAAGAAAGGG - Intronic
939693131 2:145290861-145290883 TGCATCGGAGGTAAGAGGAGTGG - Intergenic
940621063 2:156114472-156114494 TACATTGAAGATAAAACAAGAGG + Intergenic
941090801 2:161172885-161172907 TGTATTCTAGGTAAAAGATGAGG - Intronic
941148149 2:161879566-161879588 TACATTTTTGGTAAAAGAAGTGG + Intronic
943680940 2:190766889-190766911 TGCACAGGAGGAAAAAGAAGAGG + Intergenic
943775088 2:191756670-191756692 TGCATTGGACGTAGAGCAAGAGG + Intergenic
944172896 2:196799270-196799292 AGTATTGGGGGAAAAAGAAGAGG + Intronic
944707059 2:202301186-202301208 TGTCTTGGGGGTAAAAAAAGAGG - Intronic
944878525 2:203987221-203987243 TGCACTGTTGGTAAAGGAAGGGG + Intergenic
945396813 2:209328557-209328579 TGCACTGCAGGAAAAAAAAGTGG + Intergenic
945643581 2:212461365-212461387 TGACTTGGATGTAAGAGAAGGGG + Intronic
946276919 2:218638524-218638546 TGCAGAGGCGGCAAAAGAAGGGG + Exonic
947300986 2:228688654-228688676 TACATTGGAGCTATAAGATGAGG - Intergenic
948508966 2:238450380-238450402 TGTAATGAAGGTAAAAGTAGAGG + Exonic
1169349439 20:4856327-4856349 GGCATTGGAGGGAAAAGGAAAGG - Exonic
1170502324 20:16987536-16987558 GTCATTTGAGGTGAAAGAAGAGG - Intergenic
1171312146 20:24153135-24153157 GACATTGGAGGTAATGGAAGTGG + Intergenic
1172297764 20:33825637-33825659 GGCATTTGTGATAAAAGAAGAGG + Intronic
1172546005 20:35762178-35762200 TGCATTTGAGGTTAAAAAAAAGG + Intergenic
1173557754 20:43978959-43978981 TGCATTGGAGATAAAGTTAGTGG + Intronic
1173881044 20:46412422-46412444 GGCATTGGAGGTGGAAGATGAGG + Intronic
1174582616 20:51582968-51582990 TGTATTGGTGCTAAGAGAAGGGG + Intergenic
1175287024 20:57843889-57843911 GGCAGTGGAGGTGAAAGAAAAGG + Intergenic
1176953814 21:15076270-15076292 TGCATTAGAGGAAAAAGATTTGG - Intergenic
1177338891 21:19772172-19772194 TGTATTGGAGGTAAGTGTAGAGG - Intergenic
1177980255 21:27904827-27904849 TGCAATGGAGGTATAGGAATTGG - Intergenic
1178000305 21:28154556-28154578 TGAATTGAAGGGAAGAGAAGAGG + Intergenic
1179037441 21:37770832-37770854 TAGATAGGAGATAAAAGAAGGGG - Intronic
1181863954 22:25840698-25840720 TGCCTTGTAGGTAAAAGAGACGG + Intronic
1182066615 22:27435769-27435791 TGCTTTGGAGCTAAAGGTAGGGG - Intergenic
1182553700 22:31117036-31117058 TCCATTAGATGTAAATGAAGAGG - Intronic
1182638414 22:31748045-31748067 TGCATTGGAATTAAAGGGAGGGG - Intronic
1203297660 22_KI270736v1_random:54565-54587 TGGAGTGGAGTTGAAAGAAGTGG + Intergenic
1203303993 22_KI270736v1_random:96604-96626 TGCAGTGGAGGTGAATGGAGTGG + Intergenic
1203309214 22_KI270736v1_random:130836-130858 TGGAGTGGAGGGAAAAGGAGTGG + Intergenic
950435770 3:12978917-12978939 GGCATTGCAGGTACATGAAGTGG + Intronic
951730752 3:25808021-25808043 AGCATGGGAAGTAAAAGAAGTGG - Intergenic
952791559 3:37204672-37204694 TAGATTGGAGGAAAAAAAAGTGG + Intergenic
953105032 3:39869600-39869622 GGCAATGGAAGTCAAAGAAGGGG - Intronic
955389393 3:58509577-58509599 TGCTTCTGAGGAAAAAGAAGTGG - Intronic
955623271 3:60889161-60889183 TGCTTTGGAGGGAAAAAAAATGG - Intronic
955749183 3:62169973-62169995 TGAAAAGGAGCTAAAAGAAGAGG + Intronic
955963183 3:64361985-64362007 TGCATTGGAGATAAAAGGATGGG + Intronic
956447618 3:69341246-69341268 TGCATTTGAGTTGAAAGAATAGG - Intronic
958057244 3:88428242-88428264 TACATTGGAGGTACAAGCATTGG - Intergenic
959464984 3:106674736-106674758 TGCATTGGGTGTACAACAAGTGG + Intergenic
960779595 3:121304038-121304060 TACGTTGAAAGTAAAAGAAGGGG + Intronic
961192957 3:124977673-124977695 TGCCTGTGAGGAAAAAGAAGGGG - Intronic
961699787 3:128734122-128734144 TCCATTGGGGTTAAAAGCAGAGG + Intronic
961980469 3:131072742-131072764 CATATTGTAGGTAAAAGAAGAGG + Intronic
962041073 3:131708026-131708048 TGAATGGGAGAGAAAAGAAGAGG - Intronic
962444107 3:135449617-135449639 AGCATTGGAGAACAAAGAAGAGG - Intergenic
966710659 3:182969104-182969126 TGCATTGTAAGTGTAAGAAGTGG - Intronic
967838974 3:193988905-193988927 TTCATTGGAGCTTAAAGGAGAGG + Intergenic
969206173 4:5647920-5647942 AGCTTTGGAGATAGAAGAAGGGG + Intronic
969286919 4:6208380-6208402 TGCATAGGAGATGAAAGGAGGGG - Intergenic
969817873 4:9699550-9699572 TCCATTGGAAGTGAAAGAATTGG + Intergenic
972063524 4:34910642-34910664 TGCAATGGGGGTACAAGAATTGG - Intergenic
972965958 4:44510049-44510071 AGCATGGGAGGAAAAAGAACAGG - Intergenic
975662842 4:76704778-76704800 TGGATTGGAGGGGACAGAAGTGG + Intronic
976705380 4:88014146-88014168 TCCATGGGAGGGATAAGAAGAGG + Intronic
979368230 4:119850653-119850675 TACATTAGAGGGAAAAGATGTGG - Intergenic
979697042 4:123624292-123624314 TGCGATGGGGATAAAAGAAGTGG + Intergenic
979929959 4:126617726-126617748 TGCATTGGAGGGGGAAGAGGAGG - Intergenic
979997809 4:127453539-127453561 CGAATAGGAGGTAAAAGAGGAGG + Intergenic
980589241 4:134862995-134863017 TGAAATGGAGATAAAAGAATGGG + Intergenic
981884030 4:149651106-149651128 TAAATTGGAAGTGAAAGAAGAGG + Intergenic
983013036 4:162573145-162573167 TGTATTGGAGGAAAAAAAAATGG + Intergenic
983689369 4:170449842-170449864 TGCATTGTAAGTAAAACAACAGG - Intergenic
983759148 4:171384232-171384254 TGGATGGGAGGTAAATCAAGTGG - Intergenic
984606512 4:181791301-181791323 TTCATTGTAGGAAAAATAAGAGG - Intergenic
985271988 4:188202526-188202548 TGTATTGGAGGCAAGAGAAGAGG - Intergenic
986387696 5:7251225-7251247 TGTATTTGCGGTAAAATAAGAGG + Intergenic
986685975 5:10275421-10275443 TGCATGGGAGGGAAAAGAAATGG + Intergenic
986791944 5:11170214-11170236 TGAATTGGAGGGAAGAGATGTGG + Intronic
987702900 5:21424624-21424646 TGCATAGAAGGTAGAAGTAGTGG + Intergenic
988198640 5:28042381-28042403 TGGTTTATAGGTAAAAGAAGAGG + Intergenic
988260365 5:28879018-28879040 TGCATTTGATGTACAAGAAATGG + Intergenic
988534385 5:32053203-32053225 TTCACTGGAGGTAAAAGTTGAGG - Intronic
989456933 5:41654874-41654896 TGCATATAAGCTAAAAGAAGAGG - Intergenic
989461207 5:41700501-41700523 TGGATTAGAGGTAACTGAAGAGG + Intergenic
992083191 5:73254421-73254443 TGCATTGCATGTAAAAGATCAGG - Intergenic
993698296 5:91088284-91088306 GGCATTGGGGGAAAAAGATGGGG - Intronic
993793848 5:92241546-92241568 GGCATTGGAGTTGAATGAAGTGG + Intergenic
994783451 5:104122664-104122686 TGTATTGGAGATAAAATAATAGG + Intergenic
996739737 5:126787962-126787984 TGCTGTGGAGGGAAAAAAAGAGG + Intronic
997724504 5:136109309-136109331 TCCATGGGAAGAAAAAGAAGGGG - Intergenic
999347455 5:150836817-150836839 TGTCTTGGAGGTCAAAAAAGAGG - Intergenic
999527344 5:152421970-152421992 TGGATTAGAGGAAAAAGAAGTGG + Intronic
1000342491 5:160288463-160288485 TGCATTGTAGGAAGATGAAGTGG - Intronic
1001427765 5:171635284-171635306 TGGAATGGAGGTAAAAGCACTGG - Intergenic
1002068723 5:176665729-176665751 GGCATTTCAGGAAAAAGAAGGGG + Intergenic
1004888398 6:20073521-20073543 TGCATTGAAGTTAAAATAATAGG - Intergenic
1005375392 6:25176462-25176484 TGGATTGAAAGTAAAAGAAAGGG + Intergenic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1006956444 6:37877526-37877548 TGGATGTGAGGTGAAAGAAGAGG + Intronic
1007186300 6:39975205-39975227 TGCAATGGAGGTGACAGAAGAGG - Intergenic
1008749636 6:54716590-54716612 TTCCTTGGAGGCTAAAGAAGAGG - Intergenic
1010111461 6:72239261-72239283 TACTTAGGAAGTAAAAGAAGAGG + Intronic
1010936175 6:81864762-81864784 TGCATTGTTGGGAAAAGAAAGGG - Intergenic
1011089643 6:83582824-83582846 TGCACTGGTGGTAACAGCAGTGG - Intronic
1012160595 6:95880464-95880486 CGCAAGAGAGGTAAAAGAAGAGG + Intergenic
1012603699 6:101131120-101131142 GGAATTGGTGGTAAAAGAAAGGG + Intergenic
1013821756 6:114162477-114162499 TGGATTGGTGGAAAAAGAACAGG - Intronic
1014408153 6:121077793-121077815 TGCATTTAAAGTAACAGAAGGGG - Intergenic
1016676281 6:146772895-146772917 TGCTTTGGAAGTAGAAGTAGCGG + Intronic
1018042441 6:159936792-159936814 AGCATGGGAAGTTAAAGAAGAGG - Intergenic
1019928947 7:4210857-4210879 TGCTTTGGAGGAAAGAGAGGAGG + Intronic
1021065661 7:16169870-16169892 TGTATTGAAGGAAAAGGAAGAGG + Intronic
1021145850 7:17088007-17088029 TGGAATGGAGGTGAGAGAAGTGG - Intergenic
1021248103 7:18289785-18289807 TGAATGAGAGGAAAAAGAAGAGG - Intronic
1021310661 7:19091981-19092003 TACAGGGGAGGTAGAAGAAGAGG - Intronic
1021395689 7:20145202-20145224 AGCAGTGGAGGTAACAGAAAAGG - Intronic
1022222262 7:28325012-28325034 TGCATTGGAGGTAAAAGAAGTGG - Intronic
1023109168 7:36792747-36792769 TGCATTGGAGTTCATGGAAGAGG + Intergenic
1023238495 7:38116329-38116351 TGCACTGGAGGTGAAAATAGTGG + Intergenic
1025986414 7:66456673-66456695 TGGGTTGGAGGCAAAAGAGGAGG - Intergenic
1026173892 7:67978615-67978637 TGCTTTGAAGGTGGAAGAAGGGG + Intergenic
1027120533 7:75515775-75515797 TGGAGTGGAGGTGAAGGAAGTGG - Intergenic
1027198977 7:76050534-76050556 GGCAGTGGAGGTAACAGAACAGG + Intronic
1028464952 7:91140899-91140921 TTCATTTTAGGTAAAAGAAATGG - Intronic
1029046359 7:97633186-97633208 TCCTTTGCAGGAAAAAGAAGGGG + Intergenic
1029722254 7:102376243-102376265 TGGAGTGGAGGTGAAGGAAGTGG + Exonic
1030151594 7:106411763-106411785 TGCTTGGGAGGAAAAAGGAGAGG + Intergenic
1030468256 7:109930187-109930209 TGAATTGGTGGTAAAACAGGTGG + Intergenic
1030903933 7:115159637-115159659 GGAAATAGAGGTAAAAGAAGTGG + Intergenic
1031988256 7:128177920-128177942 TGGATTGGAGGAAGAAGAAAAGG + Intergenic
1032591532 7:133196573-133196595 TGCATGGGAGGTACAAGAGAGGG - Intergenic
1032667640 7:134052755-134052777 TGCATCTTAGGTAAAAGATGTGG + Intronic
1033197861 7:139342462-139342484 TGAAGTGGAGGTAGATGAAGTGG + Intronic
1034470149 7:151250501-151250523 GGCATTCCAGGTAAAAGAATCGG - Intronic
1035196726 7:157227850-157227872 TGCATTGAAGTTAAAAGATTTGG + Intronic
1036608372 8:10328347-10328369 TTCATTGGAGGGAAAAGGCGAGG - Intronic
1037746196 8:21646877-21646899 TGCACTGAAGGAACAAGAAGCGG + Intergenic
1042246598 8:66714064-66714086 TGCAGTGGCAGTTAAAGAAGGGG - Intronic
1043156916 8:76794385-76794407 TGCATTTCATGTATAAGAAGAGG + Intronic
1043174385 8:77005979-77006001 GGCTTTGAAGGTAGAAGAAGGGG - Intergenic
1043282446 8:78485010-78485032 TGCATTGGAAGCTACAGAAGTGG - Intergenic
1044417536 8:91953323-91953345 GACATTGAAGGTAAAAGAAAAGG - Intergenic
1045079000 8:98604092-98604114 TGCTTTGAAGATAAAGGAAGAGG + Intronic
1046741282 8:117831736-117831758 TCCATTGGAGGGGAAGGAAGTGG + Intronic
1046949356 8:120005232-120005254 TGGATGGGAGGTAAGAAAAGTGG - Intronic
1047106718 8:121739560-121739582 TGCAGTGGAGAGAAATGAAGTGG - Intergenic
1047952326 8:129945136-129945158 TGTATTGCAGGTAAAAAATGCGG + Intronic
1050041728 9:1502733-1502755 TTCATTGGGGGTAAAAAAAATGG + Intergenic
1050747101 9:8889120-8889142 TTCATTGCAGGGAAATGAAGAGG + Intronic
1051356271 9:16242099-16242121 TGCATTGGAGGTAAATCGATTGG + Intronic
1051444481 9:17125873-17125895 TGGATTGGGTGTGAAAGAAGAGG - Intergenic
1052510830 9:29417803-29417825 TGCTGAGGAGGTAAAAGTAGGGG + Intergenic
1052732471 9:32306061-32306083 TGCATGTGAGGTAGGAGAAGAGG - Intergenic
1054453470 9:65416663-65416685 TGCAGTGGAGATAAAGGGAGAGG + Intergenic
1055055747 9:72022337-72022359 AGCAGGGGAGGGAAAAGAAGTGG - Intergenic
1055141640 9:72883215-72883237 TGCTTTGGGGGAGAAAGAAGGGG - Intergenic
1056085105 9:83140322-83140344 TGCATTAGAGGTAAAATGTGGGG - Intergenic
1058837961 9:108876430-108876452 TGCTTTGAAGGTTAAATAAGAGG - Intronic
1059392035 9:114005476-114005498 TTTATTGGAGGTAACAGATGTGG + Intronic
1059531559 9:115040081-115040103 TGCATTGAAGGAGAATGAAGTGG - Intronic
1059916030 9:119101434-119101456 TGCATTGGTGGTAAAAATAAGGG - Intergenic
1060888322 9:127171893-127171915 TGAAGTGGAGGTTAAGGAAGGGG - Intronic
1185882116 X:3750766-3750788 TGCTTTGGAGATAAAGGAAGGGG + Intergenic
1186410455 X:9341481-9341503 TGCTTTGGGGGTGAAAAAAGGGG + Intergenic
1187237859 X:17485005-17485027 GCCATTGGAGCTAAATGAAGAGG - Intronic
1189683078 X:43536701-43536723 TGCAGTGGGGGTAAGAGAAGTGG + Intergenic
1192127901 X:68519243-68519265 CACATTGTAGGTAAAGGAAGAGG + Intronic
1192287816 X:69756865-69756887 TGCTTTGCAGGGGAAAGAAGAGG + Intronic
1194545767 X:95231604-95231626 TGCAGTGGAGGGAAAGAAAGGGG + Intergenic
1195165536 X:102215803-102215825 GGAATTGGAGAGAAAAGAAGAGG - Intronic
1195193322 X:102471288-102471310 GGAATTGGAGAGAAAAGAAGAGG + Intronic
1195620159 X:106944892-106944914 TGATCTGGAGGTAAGAGAAGGGG - Intronic
1195755576 X:108195753-108195775 TGCATTTGAGGTGGAAGACGAGG - Intronic
1200782858 Y:7232440-7232462 TGCTTTGGAGATAAAGGAAGGGG - Intergenic
1201098902 Y:10656424-10656446 TGCAGTGGAGGGGAATGAAGTGG - Intergenic
1201099041 Y:10657514-10657536 TGGAGTGGAGGTGAAAGGAGTGG - Intergenic
1201101970 Y:10684871-10684893 TGCATTGGAATAAAATGAAGAGG - Intergenic
1201103461 Y:10745997-10746019 TGCATTGGAATAAAATGAAGAGG - Intergenic
1201103986 Y:10749880-10749902 TGGATTGGAGGGAAGAGGAGTGG - Intergenic
1201116448 Y:10838899-10838921 TGCAATGGAGTGAAACGAAGTGG - Intergenic
1201117224 Y:10844017-10844039 TGGAATGGAGTTAAAAGGAGTGG - Intergenic
1201140956 Y:11027580-11027602 TGCAATGGAAGGGAAAGAAGTGG - Intergenic
1201141412 Y:11031710-11031732 TGCAGTGGAGTGAAAAGGAGTGG - Intergenic
1201716070 Y:17045189-17045211 TACATTGGAGAAATAAGAAGGGG + Intergenic
1202606563 Y:26644252-26644274 TGGATTGGAGAGGAAAGAAGTGG + Intergenic
1202607303 Y:26649995-26650017 TGGATTGGAGTGGAAAGAAGTGG + Intergenic
1202608153 Y:26656550-26656572 TGGATTGGAGTGGAAAGAAGTGG + Intergenic
1202608881 Y:26662261-26662283 TGGATTGGAGTGGAAAGAAGTGG + Intergenic
1202609257 Y:26665109-26665131 TGGATTGGAGTGGAAAGAAGTGG + Intergenic
1202609632 Y:26667973-26667995 TGGATTGGAGTGGAAAGAAGTGG + Intergenic
1202610149 Y:26671838-26671860 TGGATTGGAGTGGAAAGAAGTGG + Intergenic
1202622894 Y:56831056-56831078 TGCATTGGAGAGGAAAGGAGTGG - Intergenic