ID: 1022223700

View in Genome Browser
Species Human (GRCh38)
Location 7:28340921-28340943
Sequence AGAGACAGCACAGTGATTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 3, 2: 16, 3: 82, 4: 361}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022223700_1022223706 30 Left 1022223700 7:28340921-28340943 CCCATAATCACTGTGCTGTCTCT 0: 1
1: 3
2: 16
3: 82
4: 361
Right 1022223706 7:28340974-28340996 CTGTGCCACATGGCTACTGCTGG No data
1022223700_1022223705 20 Left 1022223700 7:28340921-28340943 CCCATAATCACTGTGCTGTCTCT 0: 1
1: 3
2: 16
3: 82
4: 361
Right 1022223705 7:28340964-28340986 CAGATTTTCTCTGTGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022223700 Original CRISPR AGAGACAGCACAGTGATTAT GGG (reversed) Intronic
901148808 1:7086596-7086618 AGAGACAGCATGGAGATTAGTGG - Intronic
901786752 1:11629848-11629870 AGAGACAGCCCTGTGATTCATGG + Intergenic
902299609 1:15492654-15492676 AGAGACAACACAGGGATCATGGG + Exonic
903076744 1:20775167-20775189 AAAGACAGCACTGTTATCATAGG + Intronic
905189908 1:36225236-36225258 AGTGGCAGTACAGTGTTTATGGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906390931 1:45415433-45415455 AGCGAAAGCACAAAGATTATGGG - Intronic
907203726 1:52750798-52750820 AGAGACAGAAAGGAGATTATTGG - Intronic
907263019 1:53236239-53236261 AGAGACAGCACAGAGGCTGTTGG - Intronic
907691041 1:56666645-56666667 AGAGAAAGCACAGTCCTTATGGG + Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910467146 1:87512204-87512226 ATAGAAAGCACAGTGCTAATAGG - Intergenic
910476836 1:87616518-87616540 TGGGAGAGCAGAGTGATTATAGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912584471 1:110749936-110749958 AGAGACAGAACAGTGCTACTCGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913253139 1:116929097-116929119 TGAGACAGCAAAGTAATTAGAGG - Intronic
915749616 1:158193794-158193816 AGAGCCAGCACACTGATCAGGGG - Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917745567 1:178003346-178003368 AGTGAAAGCACAGTGAATAAAGG - Intergenic
917852915 1:179080728-179080750 ACATACACCACAGTGCTTATTGG - Intergenic
917970978 1:180207517-180207539 AGAGAGAGGACAGAGAATATAGG + Intergenic
918688792 1:187453742-187453764 ATAGAGAGAACAGTGTTTATTGG - Intergenic
919503798 1:198372143-198372165 AGAAACTGCCCAGTGATTAAAGG - Intergenic
919779848 1:201214677-201214699 AGAGACATCACAGTGACTCAGGG + Intronic
921249719 1:213285532-213285554 GGAGACAGCACAGTGTGTAATGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922800854 1:228364226-228364248 AGAAGCAGCACAGGGACTATGGG - Intronic
922830163 1:228548719-228548741 AGAGACAACACGGTGATCTTAGG - Intergenic
923018826 1:230147400-230147422 AAGGACAGCAAAGTGAATATAGG - Intronic
923371467 1:233318469-233318491 AGACACAGAACAATGATTATGGG - Intergenic
923760007 1:236833553-236833575 AGAGATAGCAGAGTGGTTAAGGG - Intronic
1063629673 10:7722089-7722111 AAAGAAAGCACAGAGATTACGGG + Intronic
1064288683 10:14014046-14014068 GAAGACAGCGCAGTGAGTATCGG + Intronic
1064684913 10:17850575-17850597 AGAAACAGCATAATGATAATGGG + Intronic
1064773146 10:18746603-18746625 ATAGACAGCACAGTGAAGACAGG + Intergenic
1064773163 10:18746742-18746764 ATAGACAGCACAGTGAAGACAGG + Intergenic
1064927921 10:20590481-20590503 AGAGATAGCCCACTGATGATTGG - Intergenic
1066532963 10:36360541-36360563 AGAGACTGAAAAGTGATTGTTGG - Intergenic
1066622645 10:37374576-37374598 AGAAACAGCACAGGGACTGTGGG + Intronic
1069111713 10:64455597-64455619 AGAGAGAGCATATTGAGTATTGG + Intergenic
1069626067 10:69868361-69868383 GGAGACAGCACATAAATTATAGG + Intronic
1071498262 10:86184093-86184115 ATAAACAGCACAGTGAGAATTGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072825575 10:98602991-98603013 AAAGACAACACACAGATTATTGG + Intronic
1073766075 10:106684396-106684418 AGGGAAAGCACAGTGTTTAATGG - Intronic
1073989722 10:109248737-109248759 AGAGCCAGCACATTGACTTTAGG - Intergenic
1074020513 10:109577784-109577806 GAAGACAGCAAAGTGATGATGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1076138427 10:128060855-128060877 AGAGACAGCACTGTGATTTCTGG + Intronic
1076138428 10:128060879-128060901 AGAGACAGCACTGTGATTCCTGG + Intronic
1077928049 11:6702061-6702083 AGAGAAGGTACAGTGATTAGAGG + Intergenic
1078019335 11:7642228-7642250 AGAGGAAGCACAGTGACTGTAGG + Intronic
1078780683 11:14436364-14436386 AGAGGCAGAACAGGGATTATTGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079794449 11:24782293-24782315 AGATACAGCACAGTCTATATTGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082303387 11:50539572-50539594 AGAGACTGCATAGTGATATTTGG - Intergenic
1082623600 11:55455960-55455982 AGAGACAGTAAGGTTATTATAGG - Intergenic
1082665583 11:55971751-55971773 AGAGCCAGTAATGTGATTATGGG - Intergenic
1083276212 11:61598450-61598472 GGAGACAGCACATAGATTCTGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083742624 11:64718893-64718915 CAAGACAGCACAGTGGTTAGAGG + Intronic
1084233432 11:67769984-67770006 AGTGACAGAACAGTTCTTATTGG - Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086239455 11:84671796-84671818 ACAGACTGAAAAGTGATTATGGG + Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1086877108 11:92110675-92110697 AAATAAAGCACAGTGGTTATAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089321566 11:117630054-117630076 AGAGACAGCACAGTGAGGCAAGG + Intronic
1089718759 11:120391523-120391545 AGAGACAGAACAGCATTTATAGG - Intronic
1090177760 11:124666334-124666356 AGAGATACCACAGAGAATATTGG - Intronic
1090455095 11:126842220-126842242 AGAGACAGCACATTGATATCAGG + Intronic
1091088725 11:132749014-132749036 AGAAACATCACAGTGTGTATTGG - Intronic
1092647754 12:10596315-10596337 AGTGATAGCACAATTATTATTGG + Intergenic
1092915332 12:13184339-13184361 GGAGACAGAAAAGTGAATATTGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1094478637 12:30862273-30862295 AGTGAGAGCACAAAGATTATAGG - Intergenic
1094587794 12:31793979-31794001 AGGGTCTGCACAGAGATTATGGG - Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095718914 12:45378787-45378809 AGCAGCAACACAGTGATTATGGG + Intronic
1095869641 12:47012210-47012232 AGAGACAGGACAGATATTATTGG + Intergenic
1095902394 12:47341499-47341521 AGTGAGAGCACAAAGATTATAGG + Intergenic
1096440913 12:51643457-51643479 AGATACATCAAAGTGGTTATGGG - Intronic
1097216781 12:57420252-57420274 AGAGAGAGGACAGTAATTAGAGG - Intronic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1097427385 12:59463602-59463624 AGAGACAGCAGAGACAGTATTGG + Intergenic
1098171529 12:67751843-67751865 AGAGACAGCAGAAAGATTAAAGG + Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101611574 12:106297564-106297586 AGTTACAGAACACTGATTATGGG - Intronic
1101699359 12:107157463-107157485 AGAGAGAGAAGAGTGATTCTTGG + Intergenic
1103145744 12:118594479-118594501 AGAGACAGAACATAGATTAGTGG + Intergenic
1105387675 13:19946940-19946962 AGAGGCAGCACACTGATAACAGG - Intergenic
1106881399 13:34135459-34135481 AGAGACATCATAGTTATTAGTGG + Intergenic
1107616787 13:42177210-42177232 GAAGTCAGCACAGTGATTATTGG - Intronic
1108429020 13:50335297-50335319 AGTGTCTGCACAGTCATTATGGG - Intronic
1109605356 13:64687340-64687362 AGTGACAGCCCAGTGAAAATGGG + Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112053920 13:95672017-95672039 GGAGAAAGGACAGTAATTATGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113417703 13:110141630-110141652 AGAGACAGCACATTACTTAGAGG + Intergenic
1114392729 14:22327761-22327783 AGAGACACGACAGTAATTATAGG - Intergenic
1115286348 14:31717206-31717228 AGAGACAGCAAAGTGAATTCAGG - Intronic
1115930085 14:38481842-38481864 AGGCACAGCAAAATGATTATGGG + Intergenic
1115986600 14:39108808-39108830 AGTGAGAGCACAAAGATTATAGG - Intronic
1116045607 14:39739699-39739721 AGAAAGAGCAAAGTGATGATGGG + Intergenic
1116072066 14:40059670-40059692 TGAGTCAGCACAGTGAGTGTGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119855795 14:77899722-77899744 AGAGAAACCACAGAGCTTATGGG + Intronic
1119930871 14:78544906-78544928 AGAGACAGCAGGGAGATTCTGGG + Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1120458208 14:84759319-84759341 ACAGAAAGCATAATGATTATGGG + Intergenic
1122006058 14:98704760-98704782 CCAAGCAGCACAGTGATTATAGG + Intergenic
1122764320 14:104055001-104055023 AGAGACAGCAGAGTGACCAGAGG + Intergenic
1123829988 15:24125689-24125711 AGAGACATTACAGTTATTAGTGG - Intergenic
1123844896 15:24289630-24289652 AGAGACATTACAGTTATTAGTGG - Intergenic
1123856206 15:24414542-24414564 AGAGACAGTAAAGAGTTTATTGG - Intergenic
1123860049 15:24456309-24456331 AGAGACATTACAGTTATTAGTGG - Intergenic
1126215428 15:46147838-46147860 AGAGACAGAATAGTGATTACTGG - Intergenic
1126308950 15:47293848-47293870 AGAAACAGCACAGTGGTCACAGG - Intronic
1127603619 15:60563621-60563643 TGAGACAGCACAGTGCTTGGGGG + Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1128992289 15:72271339-72271361 AGAGACAGTTCAGAGATTACCGG + Intronic
1132777134 16:1600694-1600716 AGAGACATGACAGTGTGTATAGG + Intronic
1133676820 16:8081238-8081260 AGAGACAGCAAAGTGTATAATGG - Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1139267356 16:65652477-65652499 AGAGACAGAAGAGAGATTATGGG + Intergenic
1140787985 16:78362276-78362298 AGACACAGCAAGGTGATGATGGG + Intronic
1143953964 17:10654685-10654707 AGAGAAAGCAGAGTGAATACTGG - Intronic
1144319240 17:14097719-14097741 ATTGACAGTTCAGTGATTATGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1148955319 17:51348990-51349012 AGAGAAAGCACAGTAAACATTGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149570684 17:57670204-57670226 AGGGACAACACAGAAATTATTGG + Intronic
1150216275 17:63472180-63472202 AGAGATAGCACAAAGATTAGAGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1151168480 17:72225241-72225263 AGAGGTAGAACAGTGTTTATAGG + Intergenic
1152990201 18:356450-356472 TGAGAAAGCACAGTGTGTATTGG - Intronic
1153159864 18:2192019-2192041 AGAGCAAACATAGTGATTATGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1154403276 18:14063394-14063416 AGAGAAAGCACAGTGAAAAGGGG - Intronic
1155046069 18:22104317-22104339 AGATACAATACAGTGACTATAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156625579 18:38903603-38903625 TGAGAAAGTACAGGGATTATTGG + Intergenic
1158660090 18:59379328-59379350 AGAGGCAGCTCAGTGAAGATCGG + Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1161648586 19:5470000-5470022 TTAGACAGCTCAGTGACTATGGG - Intergenic
1163185550 19:15636616-15636638 GGAGAGAGCACAGTGATCATGGG - Intronic
1164655961 19:29922058-29922080 AGTGAGAGCACAAAGATTATAGG - Intergenic
1165974806 19:39666270-39666292 ACACACAGCACAGTGATCCTGGG + Intergenic
925035639 2:683215-683237 AGACACTGGACAGTGATTACTGG + Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926243370 2:11104753-11104775 AGAGACAGAAGAGTGTTTATTGG - Intergenic
926471211 2:13260495-13260517 AGAGCCAGCAGAGTATTTATGGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926686022 2:15698278-15698300 AGAGCTAGCACAGTGATGCTGGG - Intronic
927474109 2:23399203-23399225 AGTGACAGCACAAAGATTCTAGG - Intronic
927573616 2:24182032-24182054 GAAGTCAGCACAGGGATTATGGG + Intronic
927608464 2:24511030-24511052 AGAGACAGCAAATAGATTAGTGG - Intronic
928293443 2:30060606-30060628 AGGGAAAACACAGTGATTCTGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928793446 2:34987170-34987192 GGAAACAGCATAGTAATTATGGG - Intergenic
928884089 2:36128836-36128858 AGAGACAGCCACGTGATTGTAGG + Intergenic
928901954 2:36328942-36328964 AGAGACAGAAAATTGATTAGCGG + Intergenic
930139767 2:47939623-47939645 AGTGACAGCACAAAGATTATAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931261783 2:60626149-60626171 AGAGACAGGAAACTGACTATTGG + Intergenic
931846090 2:66205466-66205488 AAAGACAGCACAGAAAATATTGG - Intergenic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934592203 2:95564638-95564660 AGAGACAGAATAGAGATCATTGG - Intergenic
934709254 2:96504238-96504260 AGAGGCTGCAAAGTGCTTATGGG - Intronic
934775149 2:96932583-96932605 AGACACAGAACAGTCATTTTAGG + Intronic
935209272 2:100924405-100924427 AGAGACAGCACAAAGATCAGTGG - Intronic
937664964 2:124476426-124476448 AGTGACATCACAGTGTTTGTGGG + Intronic
939186492 2:138867115-138867137 AGAACCAGCACAGTTATTATGGG + Intergenic
939461564 2:142503210-142503232 AGAGACAGCACAGTGGTGGCAGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047099 2:160688938-160688960 AGAGACAGCACAAGGATCAGGGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942392911 2:175514808-175514830 AGAGACAGGACATAGATTAGTGG - Intergenic
942477121 2:176339166-176339188 AGTGAGAGCACAAAGATTATGGG - Intergenic
942577134 2:177375587-177375609 AGAGACAGTGCCCTGATTATGGG + Intronic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
945312271 2:208328066-208328088 AGAGCCCCCACAGTGATAATTGG + Intronic
945889034 2:215409027-215409049 AGAGTCAGGGTAGTGATTATTGG + Intronic
947195910 2:227567566-227567588 AGAGAAAGTCCAGTGTTTATAGG + Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948146255 2:235710395-235710417 AGAGACGGCACAGTGACCACAGG - Intronic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170722653 20:18897567-18897589 GGAAACAGCACAGTGAGTCTAGG + Intergenic
1172438864 20:34951355-34951377 AGAGAAGGTAGAGTGATTATGGG + Intronic
1173362675 20:42358807-42358829 AGACACAGCACAGAGTTTAATGG + Intronic
1174244724 20:49169305-49169327 ACAGACATCACAGTGATGAATGG + Intronic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177059452 21:16352933-16352955 AGACACAGGAGAGTGGTTATGGG + Intergenic
1177692699 21:24531890-24531912 AGAGACAACACAGTAATTGTGGG + Intergenic
1178785079 21:35646160-35646182 AGTGACTGCTCAGTGACTATGGG + Intronic
1183006847 22:34910495-34910517 AGAGAGAGCACAGTATTTAATGG - Intergenic
1183780829 22:39997868-39997890 ACAGGCAGGACAGTGATTAAGGG - Intronic
949692046 3:6651812-6651834 AGAGAAACCACAGTGATCAAGGG - Intergenic
949962388 3:9323194-9323216 AGGGACAGCACAGGGAGTTTTGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951398612 3:22202749-22202771 AAAGACAGCACATTGAATGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951884837 3:27514147-27514169 AGAGACAGAAAAGAGATTATTGG - Intergenic
952231897 3:31440264-31440286 AAAGACCACACACTGATTATTGG + Intergenic
952597584 3:35037106-35037128 AGAGACAGAAAATAGATTATTGG - Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953358260 3:42272682-42272704 AGAAAAAGCACAGAGATCATGGG + Intergenic
953744633 3:45564902-45564924 GGAGACAGCAAAGTGATTGAAGG + Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957092393 3:75744478-75744500 AGAGACAGAGAAGTGAATATAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958176897 3:90007441-90007463 ACAGAAAGCACAGTGGTTACTGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960272775 3:115692763-115692785 AGAGACATCAGAGTCATTCTGGG - Intronic
960380990 3:116961435-116961457 AGTGTTAGCACAGAGATTATAGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
960600121 3:119448859-119448881 ACATACACCACAGTGATTAGCGG - Intronic
960650956 3:119949411-119949433 GGAAACAGCACTGTGGTTATAGG + Intronic
961552765 3:127678578-127678600 AGAGACAGTACAGAGATGAGTGG + Intronic
962774185 3:138643406-138643428 AGTGAGAGCACAAAGATTATAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963701282 3:148629986-148630008 AGGAAAAGCAAAGTGATTATGGG + Intergenic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
963828798 3:149984886-149984908 AGAGATAGCACAAAGATTATAGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964865727 3:161258264-161258286 AGAGACAGTAAAATGATTAGTGG - Intergenic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965692431 3:171371961-171371983 AGATACAGGACAGTGATGAGTGG + Intronic
966327264 3:178771218-178771240 AGAGTCAGGACAGAGATGATGGG - Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968096043 3:195931515-195931537 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096053 3:195931577-195931599 AGGCAGAGCACAGTGATGATGGG + Intergenic
968096064 3:195931639-195931661 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096075 3:195931701-195931723 AGGTAGAGCACAGTGATGATGGG + Intergenic
968096083 3:195931763-195931785 AGGCAGAGCACAGTGATGATAGG + Intergenic
969728698 4:8940566-8940588 AGAGACAGAGCAGTGATGCTGGG - Intergenic
969821717 4:9725784-9725806 AGCGACAGAACAGTTCTTATTGG + Intergenic
969951223 4:10837721-10837743 AGAGAAAGCACAGTGTTTAGGGG + Intergenic
970464998 4:16313683-16313705 AGACATAGCACAGTGATGAGTGG - Intergenic
970570104 4:17371763-17371785 AGTGACAAGACAGTGATTCTGGG - Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971124572 4:23739334-23739356 AGTGACACCAAAGTCATTATAGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973294912 4:48507794-48507816 CGAGACTGCACAGAGACTATTGG - Intronic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975685334 4:76915413-76915435 AGAGTGAGGAGAGTGATTATTGG + Intergenic
975713431 4:77183027-77183049 AAAGTCGGCACAGTGTTTATCGG - Intronic
976450121 4:85179512-85179534 AAAAACAGAACAGTGCTTATTGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977074663 4:92438409-92438431 AGATAAAGGACAGGGATTATGGG - Intronic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978656257 4:111069038-111069060 AGAGCCACCCCAGTGATTATTGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978747557 4:112210911-112210933 AGAGACAGAAAATAGATTATGGG + Intergenic
978858583 4:113422611-113422633 AGAAACAGGACAGGGATAATAGG - Intergenic
979282350 4:118881710-118881732 AGAGACGGCACATAGATCATAGG + Intronic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980189499 4:129505765-129505787 CTAGACAGGACAGTGTTTATGGG + Intergenic
980622098 4:135320795-135320817 AGAGACAGCAGAGTGATTACGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
984304224 4:177966498-177966520 ATATTCAGCATAGTGATTATAGG + Intronic
987410776 5:17612640-17612662 AGAAACAGCACCGTGGATATTGG - Intergenic
988334504 5:29888535-29888557 AGAGACAGCAAATTCATTTTGGG + Intergenic
988777991 5:34494479-34494501 AGAAACAGCACAGTGATCCAGGG + Intergenic
989564872 5:42892205-42892227 AGCGAGAGCACAAAGATTATAGG + Intergenic
991236361 5:64403620-64403642 AGAGACAGAACATAGATTAGTGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993580119 5:89651419-89651441 AGAGACAGAAAATAGATTATTGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
993949779 5:94159723-94159745 AAATACAGCAAAGTGATTATAGG - Intronic
994082572 5:95723791-95723813 AGAGACAGCACAGTGAAGCTGGG - Intronic
994919100 5:106018998-106019020 AGTGACAGAAGAGTGATTACAGG - Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995277850 5:110297658-110297680 CGAAACAGAACAGTGATTACAGG - Intronic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997349024 5:133216843-133216865 AGAGAAGGCACAGTGATGAAGGG - Intronic
999440443 5:151596594-151596616 AGAGACAGCATAGGCATTAGAGG - Intergenic
1000904633 5:166950047-166950069 AGAGACAGAACATTGATTATTGG + Intergenic
1002332999 5:178457968-178457990 ATAGAGACCACAGTGAATATGGG - Intronic
1006554375 6:34852965-34852987 AGAGACATCATAGTAATTATGGG - Intronic
1008090407 6:47288372-47288394 AGAGAAGGTACAGTGATTAGAGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010596402 6:77769199-77769221 AGAGAGAACATACTGATTATGGG + Intronic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1014234515 6:118939592-118939614 AGGGATAGCATAGAGATTATGGG + Intergenic
1014669467 6:124282945-124282967 AGAAACAGCACAGTGGTGAGAGG - Intronic
1015235522 6:130966577-130966599 AGAGTAACAACAGTGATTATGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016106434 6:140170172-140170194 AGAGATAGAACAGAGATAATGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017526353 6:155244504-155244526 GAAGACAGCACATTCATTATGGG - Intronic
1018737492 6:166698442-166698464 AGTGAGAGCAAAGTGAGTATAGG + Intronic
1018910709 6:168099766-168099788 AGAGACAGCCGAGTGGTCATTGG - Intergenic
1020317035 7:6913042-6913064 AGCGACAGAACAGTTCTTATTGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021879729 7:25083017-25083039 AGAGACTGTACAGGGCTTATGGG - Intergenic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022397685 7:30004926-30004948 AGAGACAGCATTGTACTTATAGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024519091 7:50286932-50286954 GGAGACAGCACAGAGATCAGTGG - Intergenic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1030362664 7:108611097-108611119 AGAGAAAGCACAAGGATTCTGGG - Intergenic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1030760855 7:113349198-113349220 AGTGACAGGACAGTGATGAGTGG - Intergenic
1031488012 7:122353072-122353094 GGAGGCAGCACAGGGATTATAGG + Intronic
1031657735 7:124379452-124379474 AGTGAGACCACAGTGATCATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1032855657 7:135831666-135831688 AGAGAGAGAACAGTGGTTACTGG - Intergenic
1032989481 7:137376318-137376340 AGAGAAAGAACAGTAATTTTAGG - Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1036146747 8:6261192-6261214 AGAGACAGCAGAGAAACTATAGG - Intergenic
1037198189 8:16217799-16217821 AGAGACAGAAAATTGATTATTGG - Intronic
1037515826 8:19630661-19630683 AGAGACAGCAAAATGATCAGTGG - Intronic
1038664013 8:29521765-29521787 AGAGACAGCTCTGTGGTTAACGG + Intergenic
1038721107 8:30036227-30036249 AAATACAGCACAGTGGTTAATGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1039941492 8:42095206-42095228 AAAGGCAGCACAGATATTATAGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1041807036 8:61862850-61862872 AGAAACCACACTGTGATTATTGG - Intergenic
1043052718 8:75403881-75403903 AGAGTCTGCACAGTGATGGTAGG + Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045588660 8:103567350-103567372 AGAGACAGAAAAGAGATTAGTGG - Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046357318 8:113105281-113105303 AGAGAAAGCCAAGTGATAATAGG - Intronic
1046516528 8:115269321-115269343 AGAGAAAGCAAATTGATAATGGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047404410 8:124573246-124573268 AGGGACAGCAGAGTGAAGATGGG - Intronic
1047524412 8:125620152-125620174 AGGGCCAGCACAGTCATTAGTGG - Intergenic
1047874329 8:129118928-129118950 AGAAGCAGCCCAGTGATTGTGGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048490247 8:134885476-134885498 AGAGCCAGCCCAGGGATCATAGG + Intergenic
1048708772 8:137184588-137184610 AGAGATAGATAAGTGATTATGGG + Intergenic
1049870324 8:144970114-144970136 AGAGGCCTCACAGTGATAATGGG + Intergenic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051871925 9:21747861-21747883 AGAGACATGACAGTGATCTTTGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053118061 9:35522954-35522976 AAGGTCAGCAGAGTGATTATTGG + Intronic
1053384930 9:37679554-37679576 AGAGACAGAAAAGAGATTAGCGG - Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056316639 9:85396711-85396733 ATAGGCAGCATAGTGATTAAGGG - Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057317580 9:93979618-93979640 TGGGACAGCAGAGTGAGTATGGG - Intergenic
1057552583 9:96063076-96063098 ACACACAGCAGAGGGATTATGGG - Intergenic
1058598592 9:106644537-106644559 AGAGACAGCACTGTGTTTAGGGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060168385 9:121440065-121440087 AGTGACATCACTGTGATAATAGG - Intergenic
1060585780 9:124784774-124784796 AGAGACAGCAAACAGATTAGTGG - Intronic
1061236771 9:129347772-129347794 AGAGACAGCACCGTGCTCTTGGG + Intergenic
1202630032 M:8851-8873 TGAGCGGGCACAGTGATTATAGG + Intergenic
1187019857 X:15369660-15369682 AGAGACAGAAAATAGATTATTGG + Intronic
1187052306 X:15707181-15707203 AGCCAGAACACAGTGATTATTGG - Intronic
1187132591 X:16517163-16517185 AGAGACAGCCCAATGATTGTGGG + Intergenic
1187205185 X:17175183-17175205 AAACACTGCCCAGTGATTATGGG + Intergenic
1187269650 X:17768290-17768312 AGTGACATCACACTAATTATGGG - Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1187683963 X:21798026-21798048 GAAGACAGCACAGTGGTTAGGGG + Intergenic
1187837224 X:23445112-23445134 AGAGAGAGCTCACTGCTTATTGG + Intergenic
1188071920 X:25727688-25727710 AGAGACAGCATAGTGATTATGGG - Intergenic
1188711338 X:33404296-33404318 AAAGAAAGCACAGTGCTTTTTGG + Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1191586911 X:62837537-62837559 AGAGACAGAATATAGATTATTGG + Intergenic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192626373 X:72733007-72733029 AGAGAATGCACAGTGATTTCCGG - Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192958903 X:76104971-76104993 GGAGACAGCACAGTGATTATGGG - Intergenic
1193298510 X:79860873-79860895 AGAGAAACAACACTGATTATTGG - Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1193998188 X:88392388-88392410 ACAGACAGAACAGTTCTTATTGG - Intergenic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194466540 X:94240735-94240757 AGAGACAGCAAAGTAATTATGGG - Intergenic
1194673942 X:96770519-96770541 GGAGACAAAACATTGATTATTGG + Intronic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195479358 X:105325227-105325249 AGAGACAGAAAAGAGATTAGTGG - Intronic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1195975182 X:110519252-110519274 AGAAACAGCACAGGAAATATAGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic