ID: 1022225180

View in Genome Browser
Species Human (GRCh38)
Location 7:28355386-28355408
Sequence GATTCTCTCTACTATGACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022225180 Original CRISPR GATTCTCTCTACTATGACTG CGG (reversed) Intronic
902131313 1:14263486-14263508 CATTCTCTCTAATATGACTCTGG + Intergenic
902199534 1:14823198-14823220 GATTCTCTCTCCTAGGAATTAGG - Intronic
903451928 1:23459521-23459543 GATTCTCTCTCCAAGGACTTTGG + Intronic
910731859 1:90406357-90406379 GAACCTTTCTACTAAGACTGTGG + Intergenic
911477477 1:98391238-98391260 GATCCTCTCTAGTAAAACTGTGG + Intergenic
915879196 1:159647740-159647762 AATTCTCTCTCCTATGAATCTGG + Intergenic
919447705 1:197729748-197729770 TATTCTCTCAAATATCACTGAGG + Intronic
923885001 1:238144989-238145011 TATTCTCTCTAATATCACTAAGG + Intergenic
924645558 1:245874150-245874172 GACTCTCTGTGCTATGGCTGGGG - Intronic
1065060404 10:21895233-21895255 GATCATCTCTAAGATGACTGAGG - Intronic
1069258148 10:66360480-66360502 GATTATCTCTACATTGACTTTGG - Intronic
1070421674 10:76243637-76243659 GTTTCTCTGTACTGTGGCTGTGG + Intronic
1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG + Intergenic
1075224221 10:120611460-120611482 GGTTTTCTCTAGTATGCCTGGGG - Intergenic
1075648864 10:124114629-124114651 GATCTTCTCTCCTATTACTGTGG - Intergenic
1076257463 10:129039498-129039520 GTTTCTCTCTACAATGACTAGGG + Intergenic
1084795808 11:71503543-71503565 GATACACTATGCTATGACTGGGG - Intronic
1085390061 11:76177695-76177717 GGTTCTCTCTCCAGTGACTGAGG + Intergenic
1087200935 11:95343946-95343968 GATTCTCAATATTATGACAGTGG + Intergenic
1090435307 11:126682181-126682203 GATTCTGTGTACTAGGTCTGTGG + Intronic
1090827477 11:130397891-130397913 AGTTCTCTCAAGTATGACTGTGG + Intergenic
1091231890 11:133993420-133993442 GATTGTCTCTGCAATGCCTGGGG - Intergenic
1092079409 12:5702365-5702387 GCTTGTTTTTACTATGACTGTGG - Intronic
1093053349 12:14530328-14530350 ATTTGTCTCTACTGTGACTGGGG - Intronic
1097577269 12:61410392-61410414 TTTTATCTCTTCTATGACTGAGG - Intergenic
1098628095 12:72697909-72697931 GATTCTCTTTATTATTGCTGTGG - Intergenic
1099618483 12:84970974-84970996 GATTCTCTCTACTTTACCTTTGG - Intergenic
1099927346 12:89033686-89033708 GATTCTGTCTACTCAGCCTGGGG - Intergenic
1100934156 12:99644310-99644332 CATTCTCTCTACAATGATTTAGG + Intronic
1113358146 13:109602600-109602622 GACCCTCTCTTCTTTGACTGGGG - Intergenic
1113731847 13:112647258-112647280 GATTCTCTCTGCTAAACCTGGGG - Exonic
1116355337 14:43921269-43921291 GATTCTCTCTTCTGTTACTTTGG - Intergenic
1118103382 14:62630433-62630455 GACTTTCTGTACTATGACTCTGG + Intergenic
1126471374 15:49014585-49014607 GATTCTGTCTTGAATGACTGTGG - Intronic
1128851410 15:70961076-70961098 GATTCTTTCTTCTCTTACTGTGG - Intronic
1129030669 15:72615526-72615548 GGGTCTCTCAACTCTGACTGGGG + Intergenic
1139693798 16:68658197-68658219 GCTTCTCTATAAAATGACTGGGG - Intronic
1140875826 16:79151854-79151876 AATTCTCTTTTCTTTGACTGGGG + Intronic
1146105573 17:30032930-30032952 GATTCTCTCCACTAGGAATTGGG - Intronic
1149940383 17:60858457-60858479 GAATCTCAATACCATGACTGTGG - Intronic
931620977 2:64209059-64209081 GATGATCTTTACTATGATTGTGG + Intergenic
932454474 2:71838897-71838919 AATATTCTCTACCATGACTGAGG + Intergenic
935412511 2:102780611-102780633 TATGGTCTCTACTATCACTGTGG + Intronic
935874990 2:107496813-107496835 GCTTCTCTGTACCTTGACTGTGG - Intergenic
940770776 2:157837365-157837387 GAAGCTCTCTTCTGTGACTGTGG - Intronic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1169235553 20:3927084-3927106 GATTCTCTGTTCTCTGGCTGTGG + Intronic
1170170900 20:13411329-13411351 GATTGTCTTTTCTATTACTGTGG + Intronic
1170930280 20:20763459-20763481 GATTCATTCTACTATTGCTGGGG - Intergenic
1175649043 20:60701066-60701088 GATTCTGTCTAATGTTACTGTGG - Intergenic
1176124164 20:63467928-63467950 GATTTTCTCTGCTCTCACTGTGG + Intronic
1177395054 21:20523391-20523413 GCTTCTCTCTAGTAAGCCTGGGG + Intergenic
1179349509 21:40594840-40594862 GGTTCCCTCTACAAAGACTGAGG - Intronic
1181945123 22:26510651-26510673 GATTCTTTTTTCTATTACTGAGG + Exonic
949178549 3:1097660-1097682 TATTATCTCCACTATGAATGGGG - Intronic
949996043 3:9618390-9618412 GATTCCCTCAATTATGACTCAGG - Intergenic
950275173 3:11654788-11654810 GATTCTGTCTTCTCTCACTGGGG - Intronic
955026693 3:55174358-55174380 GATTCTCTCTACTAGGCTAGGGG + Intergenic
961435692 3:126915104-126915126 GCTTCTCTCCCCTCTGACTGTGG + Intronic
965620189 3:170635235-170635257 GTTTCTGTCTTCAATGACTGAGG + Intronic
973763660 4:54144021-54144043 GATTCTCTCAACTCTGCCTCCGG - Intronic
973794882 4:54415059-54415081 GAATCTCTCAGCTTTGACTGTGG - Intergenic
975108868 4:70601037-70601059 CATTCTCTCTCCGTTGACTGGGG + Intronic
976482429 4:85560324-85560346 GATTCTCTCTACAATGTATGAGG + Intronic
977059050 4:92233698-92233720 GATTCTCTCTTCCATGAATTGGG - Intergenic
979318260 4:119292792-119292814 GATTCGCTTTTCTCTGACTGTGG - Exonic
979439617 4:120735710-120735732 GATTCTCAAGACGATGACTGGGG + Intronic
979893256 4:126127097-126127119 GTTTCTCTTTATTATGACTATGG + Intergenic
986333687 5:6736918-6736940 GTTTCTCTCTGCTGAGACTGTGG + Intronic
988508159 5:31842338-31842360 GATTCTCTCGTCTGTAACTGGGG - Intronic
990882235 5:60552167-60552189 GCTTCTCTCATCTATGAATGAGG + Intergenic
995052864 5:107726151-107726173 GATTATCTCTACTATGAACCAGG - Intergenic
995232680 5:109786950-109786972 GATTCCCCCTACTATGGCAGAGG - Intronic
1001604913 5:172952695-172952717 GATTCTTTCTACCTTGACTGGGG + Intergenic
1004855130 6:19741891-19741913 GATTCTCTCTAGATTGAATGGGG + Intergenic
1005146652 6:22699186-22699208 GATTCCCTCTGTAATGACTGCGG + Intergenic
1010304344 6:74301454-74301476 CATTTTCTCTTCTATGTCTGTGG - Intergenic
1011167476 6:84465201-84465223 GCTTTCCTCCACTATGACTGTGG + Intergenic
1012124699 6:95413645-95413667 AATTCTCTCTATTATGTGTGTGG + Intergenic
1012859538 6:104543245-104543267 GCATCTATTTACTATGACTGGGG - Intergenic
1013360146 6:109386389-109386411 GAGGCTCTCCACTTTGACTGTGG + Intergenic
1014976674 6:127893637-127893659 CATTCTCCCTATTATCACTGTGG + Intronic
1017011385 6:150066048-150066070 AATTTTCTCTCCTATGACTGTGG - Exonic
1018481249 6:164192950-164192972 GAGTCTCACTGCTATCACTGAGG - Intergenic
1019152339 6:170016914-170016936 GCTTTTCTCTACAATTACTGAGG - Intergenic
1020393908 7:7691614-7691636 GATTCTCTATCCAGTGACTGAGG + Intronic
1022014260 7:26335506-26335528 GATCCTCCCTACTGTGTCTGGGG + Intronic
1022225180 7:28355386-28355408 GATTCTCTCTACTATGACTGCGG - Intronic
1022805960 7:33823008-33823030 GATTCTCACCACTAGGCCTGTGG - Intergenic
1023492744 7:40761920-40761942 GGTTCTTTCTGCTATGACAGCGG + Intronic
1028005524 7:85561568-85561590 GATTCTTTCTATTTTGAATGAGG - Intergenic
1030294432 7:107907556-107907578 GATTACCTCTCCTATTACTGTGG + Intronic
1030937095 7:115598104-115598126 GATTCTTCCTACCATGAGTGTGG - Intergenic
1038060093 8:23902983-23903005 GATTGTCTCTATTTTGACTGGGG + Intergenic
1042093876 8:65190505-65190527 GGTTATCCCTACTGTGACTGCGG - Intergenic
1043771924 8:84214045-84214067 AATTTTCTCTGCTATGGCTGTGG + Intronic
1047195761 8:122720055-122720077 ATTTCTTTTTACTATGACTGAGG - Intergenic
1056286866 9:85096184-85096206 GATTCTCTCTTCTATTACGCTGG + Intergenic
1058126381 9:101200052-101200074 GATTCTCTGTCCTCTGCCTGAGG + Intronic
1058826891 9:108783151-108783173 GATTCTCTCTATTGTGACTTTGG - Intergenic
1059436550 9:114280554-114280576 AAATCTGGCTACTATGACTGAGG - Intronic
1060960304 9:127676133-127676155 TATTAACTCTACAATGACTGGGG - Intronic
1187537637 X:20157757-20157779 CATTCTCTCTACTCTACCTGAGG - Intronic
1188125122 X:26357943-26357965 GGTTCTCTCTTCTCTGCCTGAGG + Intergenic
1190466687 X:50731512-50731534 GATCCTCTCTTCCATGAGTGGGG - Intronic