ID: 1022226438

View in Genome Browser
Species Human (GRCh38)
Location 7:28368438-28368460
Sequence GTCTGAAGTGCTCTGTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022226438 Original CRISPR GTCTGAAGTGCTCTGTGGTC TGG Intronic
900422977 1:2563578-2563600 GTCTGAAGGGCCCTCTGGGCTGG - Exonic
901407833 1:9061724-9061746 GTTTGAAGTCCTTTGGGGTCAGG + Intronic
901469226 1:9444012-9444034 GACAGAAGTGCCCTGGGGTCAGG + Intergenic
902245594 1:15118541-15118563 GTCTGAAGGGCACTGTGCTGGGG - Intergenic
904786170 1:32984695-32984717 TTCTGATTTGCTGTGTGGTCTGG + Intergenic
905510720 1:38517619-38517641 GTCTTAAGTACTCTGTGGTAAGG - Intergenic
906808759 1:48805194-48805216 GTGAGAAGTGCTCTGGGGTTTGG + Intronic
908203490 1:61821409-61821431 TCCTGAAGTGCTTAGTGGTCAGG + Intronic
911985669 1:104618635-104618657 GTATGAAGAGCTATGTGATCTGG + Intergenic
915776858 1:158499785-158499807 CTCTGAAGTACTCTGTGGGTGGG + Intergenic
919421266 1:197373035-197373057 GTTTAAAGTGATCTGTGCTCGGG + Intronic
921645165 1:217606236-217606258 GGCCTATGTGCTCTGTGGTCAGG + Intronic
1063407202 10:5807958-5807980 GTCTAAATTGCTCTGTAATCGGG - Intronic
1063651749 10:7945134-7945156 GTCTGAAGTGCACTGGCCTCTGG + Intronic
1063661735 10:8038921-8038943 GTCTGAAGTCCACTGTGCTGAGG + Intergenic
1064960572 10:20959609-20959631 CTGTTAAGTGCTCTGAGGTCTGG - Intronic
1065428642 10:25631468-25631490 GACTGCAGAGCTCTGGGGTCAGG - Intergenic
1066080396 10:31926048-31926070 GACAGCAGTGGTCTGTGGTCTGG + Intronic
1070161926 10:73872113-73872135 GTGTGAAGTGCTCTGGGAACAGG - Intronic
1072807736 10:98435303-98435325 GTTTGAAGTGCACTTTGGGCTGG - Exonic
1075032383 10:119032391-119032413 ATCTGCAGTTCTCTCTGGTCTGG - Exonic
1076342242 10:129757362-129757384 CTCGGAACTGCTCTGTGCTCCGG + Intronic
1077550983 11:3200224-3200246 GTCTGATGCTCTCTGTGATCTGG + Intergenic
1079348121 11:19670570-19670592 GTCTGAAGTCCTCAGAGGACAGG + Intronic
1081924527 11:46813797-46813819 GTCTGGAGTGCTGTGTACTCTGG - Intronic
1083262176 11:61529099-61529121 GTCTGTTGTGGTCAGTGGTCTGG - Intronic
1083525354 11:63360115-63360137 GGCAGTAGTGCTCTGTGGTGTGG + Intronic
1084374279 11:68765106-68765128 CTATGAAGTGCTCTGTAGTGAGG - Intronic
1094617336 12:32047555-32047577 GTCAACAGTGCTCAGTGGTCAGG + Intergenic
1094640614 12:32271482-32271504 ATCTCAAGTGCTATCTGGTCTGG - Intronic
1094709904 12:32951546-32951568 GTGTGAATTGCTCTATGCTCTGG + Intergenic
1095119764 12:38403569-38403591 GGCTGAAGTGAGCTGTGATCAGG - Intergenic
1095585712 12:43847206-43847228 CTCTGAAGGTTTCTGTGGTCTGG + Intronic
1097498401 12:60373040-60373062 GTCTGTACAGCTCTGTGGTTGGG - Intergenic
1099421818 12:82471264-82471286 GTCTGCATTCCTGTGTGGTCAGG + Intronic
1100239347 12:92695402-92695424 AGGTAAAGTGCTCTGTGGTCAGG + Intergenic
1100807459 12:98301641-98301663 GTCTAGAGTGCTCTGTAGGCAGG + Intergenic
1100941029 12:99723067-99723089 ATCTGCAGGGCTCTGTGGTTGGG - Intronic
1102193456 12:111006890-111006912 CTCTTAAGTGCCCTGTGTTCAGG - Intergenic
1104459403 12:128942662-128942684 TGCTGATGTGCTGTGTGGTCTGG - Intronic
1104705685 12:130945098-130945120 ATCTAAAGTGCTGTGGGGTCAGG - Intergenic
1108041308 13:46341608-46341630 GCTTGAAGGGCTCTGTGCTCAGG - Intergenic
1112967416 13:105213394-105213416 ATCTGTAGTGCTCAGTGCTCAGG - Intergenic
1113668663 13:112160002-112160024 TTCTGAGCTGCTCTGTGGCCAGG - Intergenic
1114535003 14:23417222-23417244 GTTTGAAGAGCTCTGTGCTGAGG + Exonic
1115311585 14:31984327-31984349 TGCTGTAGTGCTCTGTGGTGGGG + Intergenic
1116612901 14:47101032-47101054 GCCTGAGGTGCTCTGTAGTGGGG + Intronic
1120939590 14:89934496-89934518 GTGTGAAGTGTTCAGTGCTCTGG + Intronic
1121200277 14:92111110-92111132 GCCTGAAAAGCTCTGTGATCTGG + Intergenic
1122126409 14:99580940-99580962 GTTGGAGGTGCTCTGTGATCAGG - Intronic
1124415152 15:29467555-29467577 GGCTGCAGTGCTTTGTGGTTGGG + Intronic
1125254346 15:37745437-37745459 ATCTGCAGTACTCTGTGGTGGGG - Intergenic
1125750910 15:42027662-42027684 CTCTGAAGGTCTGTGTGGTCGGG + Intronic
1127299757 15:57641519-57641541 CTTTGATGTGGTCTGTGGTCTGG + Intronic
1128545839 15:68566993-68567015 GTCTGAGGTTCTCTGTTCTCTGG + Intergenic
1129771105 15:78204126-78204148 GACTGAAGAGCTCTGAGTTCTGG + Intronic
1129873210 15:78954955-78954977 GTCTGGAGTGATGTGTGGGCTGG + Intergenic
1130579019 15:85118201-85118223 GTCTGCAGGGCTCTAAGGTCAGG + Intronic
1134127322 16:11625200-11625222 CTCTGAAGGTCACTGTGGTCCGG + Intronic
1135804229 16:25527606-25527628 GTCTCAAGTTCTCTGAGGTTCGG - Intergenic
1137360895 16:47814100-47814122 GTCTGGAGTGCCCTGTGGGGTGG - Intergenic
1138525085 16:57600509-57600531 GTGAGGAGTGCTCGGTGGTCAGG - Intergenic
1138580982 16:57940237-57940259 ATCTGAAGTGCTCTGGGGCCGGG + Exonic
1138760215 16:59534481-59534503 GTCGGGAGTGCTGTCTGGTCAGG - Intergenic
1141574172 16:84953577-84953599 GTCTGATTTCCACTGTGGTCAGG - Intergenic
1142497070 17:311506-311528 GTGTGACGTGCACTGTGGTTGGG - Intronic
1142566170 17:841601-841623 GTGTGAGATGCTCTGTGGTCGGG - Intronic
1144839577 17:18177592-18177614 CTCTGAAGTGCTCTCTGTTGAGG - Intronic
1146480733 17:33202960-33202982 GTTTGAAGTGCTGTGTGAGCAGG - Intronic
1147861190 17:43524562-43524584 GACTGAAGTGCTCTGTGGAGAGG - Exonic
1150506722 17:65706415-65706437 CTCTGAAGTTCACTGTGCTCTGG - Intronic
1152497722 17:80685912-80685934 GTCAGAAGAGCTCTGAGGACTGG - Intronic
1154236270 18:12609190-12609212 GTCTGTAATGGTCTGTGGCCCGG + Intronic
1158963847 18:62607104-62607126 GTGGGAAGGGCTCTGTGGACAGG + Intergenic
1159797244 18:72859693-72859715 GTCTGAAGTGGTCTGAGCTCAGG - Intronic
1160334969 18:78030977-78030999 GTCTCAAGTGCTGTGTGCCCTGG + Intergenic
1161009615 19:1954003-1954025 GTCTGCAGTGCTCCGAGGACCGG + Intronic
1163411411 19:17157198-17157220 TTCTGATGAGCTCTGTGGACAGG + Intronic
1165191785 19:34069759-34069781 GTCTGAAGTCCTGTGTTGTTTGG - Intergenic
1167727068 19:51223155-51223177 GGCTGCAGTGAACTGTGGTCAGG + Intergenic
1168388793 19:55988929-55988951 ATCTTAATTGTTCTGTGGTCAGG + Intergenic
926311753 2:11680397-11680419 GTGTGCAGAGCTCTGTGGTGGGG + Intronic
927460142 2:23291939-23291961 TTCTGAAGTGCATTTTGGTCTGG - Intergenic
927886353 2:26721107-26721129 TTCTGAAGGACTCTGAGGTCTGG - Intronic
931342098 2:61411774-61411796 ATTTGAAGGCCTCTGTGGTCAGG - Intronic
933813506 2:86048109-86048131 GTCTGTAGTGCTCTCTTGCCTGG - Intronic
935500242 2:103830611-103830633 GGCAGCAGTGCTCTGTGGTTGGG + Intergenic
937470014 2:122166601-122166623 GTCTGAATTGCTCATTGGCCTGG - Intergenic
938706394 2:133931516-133931538 GTGTGATGTGTTCAGTGGTCAGG - Intergenic
942124078 2:172805577-172805599 GGATGAAGTGGTCTGTGGGCAGG - Intronic
948095973 2:235334361-235334383 GCCTGCAGGGCTCTGTGGTGGGG - Intergenic
1170326811 20:15164836-15164858 GGCTGCAGTGAACTGTGGTCAGG + Intronic
1173622966 20:44450572-44450594 GTCTGTCCTGCTCTGTGGCCTGG + Intergenic
1173634921 20:44546939-44546961 GTTTGAAGTGCTATGTGATTTGG - Intronic
1177820210 21:26023081-26023103 ATCTGCAATGCCCTGTGGTCAGG + Intronic
1180089370 21:45525915-45525937 GTCTAAAGAGCTCTGTGCCCTGG - Exonic
1180670481 22:17548898-17548920 GTCAGAAAAGCTCTGTGGACAGG - Exonic
1182129331 22:27839467-27839489 GTCAGGCGGGCTCTGTGGTCTGG - Intergenic
1183697665 22:39432347-39432369 GGATGAAGTGCTCTATGGACTGG - Intronic
1183722792 22:39572167-39572189 GTCTGGAGAGATCTGTGCTCTGG + Intronic
1185048008 22:48538605-48538627 GTCTGCCGTGCTCTCTGCTCCGG + Intronic
1185132409 22:49046687-49046709 GCCTCAAGTGCTCTGTGCTCCGG + Intergenic
1185223181 22:49639383-49639405 GTCCGAGGTGTTCTGGGGTCGGG - Intronic
949879800 3:8652291-8652313 GTCTCAGGTGCTCTGTGATCAGG + Intronic
951048939 3:18072706-18072728 TTCTGAAGTGCACTGTCGGCTGG - Intronic
952108539 3:30096202-30096224 GTCAGAAGTGCTGATTGGTCGGG + Intergenic
953026211 3:39146689-39146711 GCCGGACGTGCTCTGGGGTCTGG + Exonic
956827076 3:73007292-73007314 GTTTGAAGTTCTTTGTGTTCAGG + Intronic
958473341 3:94549392-94549414 GGCAGTAGTGCTCTGTGGTGAGG - Intergenic
958752801 3:98212540-98212562 GTCTGAAGTGTTATGTGTTGTGG + Intergenic
961587906 3:127949366-127949388 ATTTGAAGTTCTCTGTGGGCTGG - Intronic
962358615 3:134716352-134716374 GGCTGAATTGCTCTGTGGTCTGG + Intronic
963638993 3:147836225-147836247 CTAAGTAGTGCTCTGTGGTCAGG + Intergenic
964816297 3:160720473-160720495 GGCAGTAGTGCTCTGTGGTGAGG - Intergenic
965761539 3:172082779-172082801 CTCTGAAGTGGTCTGTGCTGAGG + Intronic
966635955 3:182133972-182133994 TTCTGAACTGCTCTGCTGTCAGG - Intergenic
966974221 3:185070706-185070728 TTCTCAAGTGCTGTGTGCTCAGG + Intergenic
967879783 3:194293328-194293350 GTCTGATGTTCTCTGTGTTTGGG + Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
968818424 4:2833459-2833481 GTCTGAAGTGCTCTGGGTGCAGG + Intronic
969363701 4:6681592-6681614 TTCTGAAGTCATCTGTGCTCAGG - Intergenic
969898648 4:10328218-10328240 GTCTGAAGTACTCTGAGGAGAGG - Intergenic
972004217 4:34078422-34078444 GTTTGAATTCTTCTGTGGTCTGG - Intergenic
974175382 4:58315792-58315814 GTCTGTAGTGCCATCTGGTCAGG - Intergenic
978847249 4:113288213-113288235 ATATGAAGTTCCCTGTGGTCAGG + Intronic
982122740 4:152158172-152158194 GCCTGAAGGACTCTGGGGTCTGG + Intergenic
983014209 4:162590081-162590103 GTCTTATGCACTCTGTGGTCAGG - Intergenic
984466580 4:180107283-180107305 GTATGAAGTTCCCTGTGCTCCGG - Intergenic
985272695 4:188209154-188209176 TTCCGAAGTGCTCTGTGTTTAGG + Intergenic
986149993 5:5119916-5119938 GGCAGAAGTGTTCTGTGGTAGGG + Intergenic
986476529 5:8139569-8139591 CTCAGAAGTGCTCTGTAGCCTGG + Intergenic
986660928 5:10059294-10059316 GTCGGAAGTCCTCTGTGCTTGGG - Intergenic
989531871 5:42516813-42516835 GCCTCATGTCCTCTGTGGTCAGG + Intronic
995245950 5:109936032-109936054 TTCTGAAGTGCTCTGTTGCCAGG - Intergenic
998402698 5:141856197-141856219 GTGGGAACTGCTCTGGGGTCTGG - Intronic
998443063 5:142178244-142178266 GACTGAAGAGCTGTGTGGCCTGG - Intergenic
998565257 5:143210882-143210904 GTCTGAAGGGCACTGTTGACAGG + Intronic
999679618 5:154044476-154044498 ATCAGAAGTCCTCTGTGTTCAGG + Intronic
1000519047 5:162276424-162276446 GTCTAAGGTGCTCTGGTGTCTGG + Intergenic
1004936210 6:20510855-20510877 GGCTGCAGTGAGCTGTGGTCAGG + Intergenic
1005075670 6:21904013-21904035 GTCTAAAGTTCTGTCTGGTCTGG + Intergenic
1006381315 6:33699116-33699138 GTCTGAAATGTGCTGTGTTCTGG - Intronic
1011505117 6:88033310-88033332 GTCTGGAGTAGCCTGTGGTCTGG + Intergenic
1011750968 6:90454378-90454400 GTCAGAAGTGCTCTGAGGCCGGG - Intergenic
1014422252 6:121260696-121260718 GTCTGCATGGCTCTGTGGTTTGG - Intronic
1015472470 6:133621254-133621276 GGCTGCAGTGATCTGTGATCAGG - Intergenic
1016228501 6:141772166-141772188 GTCCCAAGTGCTCTTTAGTCAGG + Intergenic
1016842771 6:148541071-148541093 GTCTTAAGTGGTATGGGGTCAGG + Intronic
1016977271 6:149821692-149821714 GTCTGATCTACTCTGTGGCCAGG + Intronic
1018064798 6:160117401-160117423 GTCTCCTGGGCTCTGTGGTCAGG + Intergenic
1018201012 6:161395777-161395799 GTCAGGAGTGGCCTGTGGTCAGG + Intronic
1019121080 6:169804269-169804291 GTCTGAAGAGCTCTGTGGTGGGG - Intergenic
1019121097 6:169804427-169804449 GTTTGAAGAGCTCTGTGGTGTGG - Intergenic
1019121155 6:169805170-169805192 GTGTGAAGAGCTCTGTGGTGTGG - Intergenic
1019121213 6:169805818-169805840 GTGTGAAGAGCTCTGTGGTGTGG - Intergenic
1019121238 6:169806101-169806123 GTGTGAAGAGCTCTGTTGTGTGG - Intergenic
1019121245 6:169806205-169806227 GTGTGTAGAGCTCTGTGGTGTGG - Intergenic
1019121262 6:169806461-169806483 ATGTGAAGAGCTCTGTGGTGTGG - Intergenic
1019121283 6:169806738-169806760 GTGTGGAGAGCTCTGTGGTGTGG - Intergenic
1019121302 6:169806931-169806953 GTGTGAAGAGCTCTGTGGTGTGG - Intergenic
1019121340 6:169807531-169807553 GTGTCAAGAGCTCTGTGGTGTGG - Intergenic
1019121347 6:169807635-169807657 TTGTGGAGAGCTCTGTGGTCTGG - Intergenic
1020445102 7:8260865-8260887 ATCTGAACTGTTCTGTGGTTAGG - Intronic
1022226438 7:28368438-28368460 GTCTGAAGTGCTCTGTGGTCTGG + Intronic
1022522039 7:31014738-31014760 GGGTGAAGTCCACTGTGGTCTGG + Intergenic
1022904818 7:34845500-34845522 GTCTGAAATGCTCTGCTCTCCGG + Intronic
1025239863 7:57262224-57262246 GTTTAAAGTGTTCTGTGGCCAGG - Intergenic
1026905543 7:74060802-74060824 TTCAGCAGTGCTCTGTGGCCAGG + Intronic
1027333293 7:77122132-77122154 GGCTGAAGTGTTCTGAGGACTGG - Intergenic
1029782497 7:102749170-102749192 GGCTGAAGTGTTCTGAGGACTGG + Intronic
1031222820 7:118993670-118993692 ATGGGAAGTGATCTGTGGTCTGG + Intergenic
1032169580 7:129573555-129573577 CTTTTAAGTGCTCTGTGTTCAGG - Intergenic
1033126246 7:138709769-138709791 GTCTGAAGTGCTCTGGACTATGG - Exonic
1034503346 7:151466400-151466422 GACTGAAATGCTCCGTGGTCGGG - Exonic
1034672291 7:152867968-152867990 CCCTGACGTGCTCTCTGGTCTGG + Intergenic
1036710928 8:11078033-11078055 GTCGGAAGTGGTTTGGGGTCAGG - Intronic
1042468764 8:69159729-69159751 GACTGCAGTGCGCTGTGGTATGG - Intergenic
1045387752 8:101687838-101687860 GTCTGAGTTGCTGTTTGGTCTGG - Exonic
1046535742 8:115507562-115507584 GTCTGTGGTGCTCTGTGGTCCGG - Intronic
1046830816 8:118743876-118743898 GTCTGATGTGCTCTGTGCCATGG + Intergenic
1047550807 8:125870498-125870520 CTCTGAATTTGTCTGTGGTCCGG + Intergenic
1049515933 8:143055770-143055792 TGCTGATGTGCTGTGTGGTCTGG - Intronic
1050832851 9:10035994-10036016 ATCTGAAGTGATCATTGGTCAGG - Intronic
1052460186 9:28752996-28753018 TACTGAAGTGCTATGTGGCCTGG - Intergenic
1052679496 9:31671077-31671099 GTCTGGTGTGGTCTGTGGACTGG - Intergenic
1056033275 9:82576352-82576374 ATTTGAAGTGCTCTGTTGTTTGG - Intergenic
1056380477 9:86052952-86052974 GTGTGGAGTGCTGTGTGGTGTGG - Intronic
1056492038 9:87117826-87117848 GACTGATGTGCACTGTGCTCAGG - Intergenic
1057897116 9:98917933-98917955 CTCTAAACGGCTCTGTGGTCTGG - Intergenic
1058876469 9:109249212-109249234 GTCTAAATGGCTCTGTGTTCTGG + Intronic
1060295731 9:122341619-122341641 ATCTGTACTGCTGTGTGGTCTGG + Intergenic
1060403492 9:123361531-123361553 GTCTGAGCTGTTCTGGGGTCTGG + Intronic
1062118502 9:134821811-134821833 GCCTGAAGTCCTCGGTGGCCTGG + Intronic
1062338501 9:136083050-136083072 GTGTGAAGTGCTCGGTCGTCAGG - Intronic
1062641638 9:137521638-137521660 CGTTGAAGAGCTCTGTGGTCAGG + Exonic
1062696904 9:137880261-137880283 GTCTGGAATGCCCAGTGGTCTGG + Intronic
1187713516 X:22077918-22077940 GTTTCAAGTGATCTGTGATCTGG + Intronic
1192467139 X:71365541-71365563 GTCTGCAGTGACCTGTGATCGGG - Intergenic
1194287094 X:92023338-92023360 GTTTGTATTGCTTTGTGGTCGGG - Intronic
1194955646 X:100176450-100176472 GTGTAAAATGCTCTGTGGGCAGG - Intergenic
1197107287 X:122731746-122731768 GTCTGCAGAGCTCTGTGCTTCGG - Intergenic
1200604635 Y:5247899-5247921 GTTTGTATTGCTTTGTGGTCGGG - Intronic
1202337607 Y:23827676-23827698 GTCTGCAGTACTCAGTGCTCTGG - Intergenic
1202533159 Y:25842395-25842417 GTCTGCAGTACTCAGTGCTCTGG + Intergenic