ID: 1022227670

View in Genome Browser
Species Human (GRCh38)
Location 7:28380436-28380458
Sequence TAGCACCATCGCAGCAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022227670_1022227672 16 Left 1022227670 7:28380436-28380458 CCAGGTCTGCTGCGATGGTGCTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1022227672 7:28380475-28380497 CAAAAGGAAGAATCCCACTGTGG 0: 1
1: 0
2: 2
3: 47
4: 429
1022227670_1022227673 17 Left 1022227670 7:28380436-28380458 CCAGGTCTGCTGCGATGGTGCTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1022227673 7:28380476-28380498 AAAAGGAAGAATCCCACTGTGGG 0: 1
1: 0
2: 1
3: 23
4: 313
1022227670_1022227671 0 Left 1022227670 7:28380436-28380458 CCAGGTCTGCTGCGATGGTGCTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1022227671 7:28380459-28380481 GATTGCTGCAAAGAAACAAAAGG 0: 1
1: 0
2: 4
3: 31
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022227670 Original CRISPR TAGCACCATCGCAGCAGACC TGG (reversed) Intronic
900000736 1:13553-13575 TAGCAGGATCCCTGCAGACCAGG - Intergenic
900020452 1:184072-184094 TAGCAGGATCCCTGCAGACCAGG - Intergenic
903174673 1:21573809-21573831 CAGCCCCCTCTCAGCAGACCCGG - Intronic
903607126 1:24583251-24583273 CAGCACCATCGCAGCATCCTTGG - Intronic
922575707 1:226659474-226659496 GAGCACCTGCACAGCAGACCTGG - Intronic
1070304459 10:75231768-75231790 TAACACCATCTCACCAAACCAGG - Intergenic
1082063615 11:47881310-47881332 TAGCACAAAGGGAGCAGACCCGG + Intergenic
1090561916 11:127941750-127941772 CACCACCAGCGCAGCAGTCCTGG - Intergenic
1090964058 11:131582840-131582862 TAATGCCATCGCAGCAGAGCTGG + Intronic
1091373834 12:13680-13702 TAGCAGGATCCCTGCAGACCAGG - Intergenic
1098590940 12:72211227-72211249 TAGCACCACTGCAACAGAGCTGG - Intronic
1100564982 12:95787092-95787114 CAGCACCATGGCAGCCGGCCTGG + Exonic
1102878626 12:116467081-116467103 GAGCTCCATCACAGCAGCCCTGG - Intergenic
1105306446 13:19172404-19172426 TGGCACCATCAGGGCAGACCAGG + Intergenic
1108430735 13:50351215-50351237 TAGCCCAATCTCAGCAGACCAGG - Intronic
1112393400 13:99005800-99005822 TAGCACCATTAAAGCAGGCCTGG + Intronic
1117059947 14:51951901-51951923 GAGAACCATCGCTGTAGACCAGG - Intronic
1124479749 15:30068160-30068182 CAGCACCTTCACAGCACACCTGG + Intergenic
1131762068 15:95635150-95635172 TCGCACCACCGCAACAGACTGGG + Intergenic
1132452773 15:101977392-101977414 TAGCAGGATCCCTGCAGACCAGG + Intergenic
1132454124 16:13234-13256 TAGCAGGATCCCTGCAGACCAGG - Intergenic
1141928239 16:87183241-87183263 TAGCACCATCGCCTCAGTGCAGG + Intronic
1149597293 17:57871962-57871984 TAGCACCTTTGCTGCAGAGCTGG + Intronic
1153879287 18:9406117-9406139 TAGGCCCATCTCAGCAGTCCAGG + Intergenic
1157932064 18:51834040-51834062 TGGCACCATCACAGCAGACATGG + Intergenic
1166878920 19:45914939-45914961 GAGCACCTTGGCAGCAGAGCTGG - Intergenic
1168494950 19:56840318-56840340 CGGCACCAACGCAGCAGCCCGGG + Intronic
936568986 2:113599864-113599886 TAGCAGGATCCCTGCAGACCAGG + Intergenic
938133714 2:128737134-128737156 GCGCCGCATCGCAGCAGACCCGG - Intergenic
943799460 2:192039684-192039706 TAGGACCATCTCAGGACACCAGG + Intronic
948591696 2:239054526-239054548 TGGAACCATCCCAGCAGGCCGGG + Intronic
1170545034 20:17428638-17428660 TCGCACTGTCCCAGCAGACCTGG + Intronic
1172222514 20:33283534-33283556 CAGCACCACCGCAGCACAGCTGG - Intronic
1178234837 21:30829488-30829510 TACCACCATAGCAGCCGCCCAGG + Exonic
1182150269 22:28022603-28022625 TAGCTCGATCCCAGCAGAGCAGG - Intronic
953485424 3:43289846-43289868 TAGCCACATGGCAGCAGACTAGG - Intronic
963017609 3:140840753-140840775 TCACACCAGCACAGCAGACCAGG + Intergenic
972882220 4:43438992-43439014 TTGCACCACCACAGCATACCAGG + Intergenic
978219003 4:106246153-106246175 TAGCACAATGGCAGCATAGCAGG - Intronic
980171444 4:129294774-129294796 CAGCACCATAGCAGCAGAACTGG - Intergenic
993954933 5:94220902-94220924 TTTAACCATCACAGCAGACCTGG + Intronic
996901216 5:128543497-128543519 TGACACCATCCCAGCAGACAGGG - Intronic
1001865003 5:175096240-175096262 TGCCACCACCGCAGCAGGCCTGG - Intergenic
1003329297 6:5116503-5116525 TAGCACCACGGCAGCAATCCCGG - Intronic
1003954334 6:11147980-11148002 TTGCACCATCGCTGCAGTGCAGG - Intergenic
1005479801 6:26244826-26244848 TAGCAGCATCTCTCCAGACCAGG + Intergenic
1014052697 6:116974286-116974308 TGGCACCATCCCATCAGAGCAGG - Intergenic
1022227670 7:28380436-28380458 TAGCACCATCGCAGCAGACCTGG - Intronic
1025865793 7:65379446-65379468 TCTCACCATGGCAGGAGACCTGG - Intronic
1033275632 7:139969712-139969734 TAGCCCGACCCCAGCAGACCTGG - Intronic
1035212231 7:157337054-157337076 CACCACCAGCGCAGCAGTCCTGG + Exonic
1036194212 8:6699744-6699766 TAGCCCCTTCCCAGCACACCAGG - Intergenic
1038624784 8:29180676-29180698 TACCACTATCTTAGCAGACCTGG + Intronic
1056026674 9:82504701-82504723 AAGCACCACAGGAGCAGACCAGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1058193299 9:101944495-101944517 TAGCACCATGCCAGCTGACAAGG - Intergenic
1195992466 X:110696263-110696285 TAGCACCAACGTCTCAGACCTGG + Intronic
1196537367 X:116863085-116863107 CAGCACAATCACAGCAGAGCAGG - Intergenic
1198754578 X:139969596-139969618 TACCACCAGCGCAGTAAACCTGG + Intergenic