ID: 1022230547

View in Genome Browser
Species Human (GRCh38)
Location 7:28409171-28409193
Sequence TGCACCAGGGTCCGCGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022230535_1022230547 2 Left 1022230535 7:28409146-28409168 CCCGCCGCTGCCGCTCCCGGGCG 0: 1
1: 0
2: 4
3: 32
4: 374
Right 1022230547 7:28409171-28409193 TGCACCAGGGTCCGCGCGGGCGG No data
1022230536_1022230547 1 Left 1022230536 7:28409147-28409169 CCGCCGCTGCCGCTCCCGGGCGG 0: 1
1: 0
2: 6
3: 45
4: 372
Right 1022230547 7:28409171-28409193 TGCACCAGGGTCCGCGCGGGCGG No data
1022230534_1022230547 3 Left 1022230534 7:28409145-28409167 CCCCGCCGCTGCCGCTCCCGGGC 0: 1
1: 0
2: 3
3: 50
4: 464
Right 1022230547 7:28409171-28409193 TGCACCAGGGTCCGCGCGGGCGG No data
1022230539_1022230547 -2 Left 1022230539 7:28409150-28409172 CCGCTGCCGCTCCCGGGCGGGTG No data
Right 1022230547 7:28409171-28409193 TGCACCAGGGTCCGCGCGGGCGG No data
1022230540_1022230547 -8 Left 1022230540 7:28409156-28409178 CCGCTCCCGGGCGGGTGCACCAG 0: 1
1: 0
2: 1
3: 12
4: 95
Right 1022230547 7:28409171-28409193 TGCACCAGGGTCCGCGCGGGCGG No data
1022230532_1022230547 4 Left 1022230532 7:28409144-28409166 CCCCCGCCGCTGCCGCTCCCGGG No data
Right 1022230547 7:28409171-28409193 TGCACCAGGGTCCGCGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022230547 Original CRISPR TGCACCAGGGTCCGCGCGGG CGG Intronic