ID: 1022230898

View in Genome Browser
Species Human (GRCh38)
Location 7:28410862-28410884
Sequence GCGATTGCACGAGTGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022230898 Original CRISPR GCGATTGCACGAGTGTGTTG TGG (reversed) Intronic