ID: 1022230898

View in Genome Browser
Species Human (GRCh38)
Location 7:28410862-28410884
Sequence GCGATTGCACGAGTGTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022230898 Original CRISPR GCGATTGCACGAGTGTGTTG TGG (reversed) Intronic
904197344 1:28795677-28795699 GAGATTGCAAAATTGTGTTGAGG - Intergenic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
924068891 1:240255048-240255070 ACGATTGCAGGAGTCTGTGGTGG + Intronic
1062826858 10:576297-576319 GTGAGTGCTCGAGTGTGATGTGG - Intronic
1073952838 10:108830425-108830447 TAGATTGCAGGAGTGGGTTGAGG + Intergenic
1077544374 11:3162906-3162928 GGGAGTGCACCAGTGTGCTGGGG - Intronic
1080344358 11:31307817-31307839 CTGAATGCACGAGTCTGTTGGGG + Exonic
1101073983 12:101109124-101109146 GCGTTTGCACAATTGGGTTGGGG + Intronic
1102422365 12:112814078-112814100 GAGTGTGCACGAGTGTGTAGGGG + Intronic
1104124872 12:125836990-125837012 TGGGTTGCACGAGTGTTTTGTGG - Intergenic
1107731252 13:43351276-43351298 GAGATTGCATGTGTGTTTTGGGG - Intronic
1113484286 13:110642900-110642922 GCGCTTGCACACGTGTGTTTCGG + Intronic
1132604025 16:786150-786172 GCGACTGCAGCAGTGTGTGGGGG + Exonic
1140245861 16:73248665-73248687 GCACGTGCACGTGTGTGTTGTGG + Intergenic
1141706494 16:85668103-85668125 GGGCTTGCATCAGTGTGTTGGGG - Intronic
1144757938 17:17691587-17691609 GAAAGTGCAGGAGTGTGTTGTGG + Intronic
1151227005 17:72655212-72655234 GCGTGTGCACGGGTGTGTGGAGG - Intronic
1153943380 18:9996051-9996073 GTGCATGCACGTGTGTGTTGGGG + Intergenic
1163754059 19:19096154-19096176 GCGATTGCATGAGGATGCTGAGG + Exonic
925986072 2:9216223-9216245 GCTGTTGCAAGAGTGTGTTGGGG + Intronic
936285894 2:111181135-111181157 GTGTTTGCACGAGTGTGTATGGG + Intergenic
936796496 2:116212253-116212275 GAGATTTCTCAAGTGTGTTGAGG + Intergenic
938155377 2:128934142-128934164 GGAATTGAACCAGTGTGTTGAGG - Intergenic
944246248 2:197533238-197533260 GGGAGTGCTTGAGTGTGTTGGGG + Intronic
946865900 2:224040280-224040302 GAGTGTGCACGTGTGTGTTGGGG + Intergenic
1173496368 20:43521616-43521638 GCAATTTCACTAGTGTGTAGAGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
957484356 3:80838679-80838701 ACGAATGTACTAGTGTGTTGGGG - Intergenic
971347834 4:25827597-25827619 GGGATTGCATTAGTTTGTTGGGG - Intronic
974622705 4:64381877-64381899 GCAAGTGCACGTGTGTGTGGGGG + Intronic
989750771 5:44890539-44890561 GAGATTGCTGGAGTGTTTTGAGG + Intergenic
999240565 5:150125015-150125037 GTGGTTGCAGGAGTGTGTTTAGG - Intronic
999330750 5:150672013-150672035 GCGCGTGCGCGTGTGTGTTGGGG - Intronic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1004513844 6:16305558-16305580 GCGATGTCACCAGGGTGTTGTGG - Exonic
1010318808 6:74482941-74482963 GGGAGTGCATGCGTGTGTTGCGG - Intergenic
1022230898 7:28410862-28410884 GCGATTGCACGAGTGTGTTGTGG - Intronic
1023752383 7:43385132-43385154 CCGATTGGAAGAGGGTGTTGAGG - Intronic
1036913893 8:12785867-12785889 ACGATTGCAGGTGTGTGTTATGG + Intergenic
1059791457 9:117645446-117645468 GCGATTGCACCTATGTGTAGTGG + Intergenic
1190826830 X:54025497-54025519 GCGAGTGAAGGGGTGTGTTGGGG - Intronic