ID: 1022232116

View in Genome Browser
Species Human (GRCh38)
Location 7:28424066-28424088
Sequence CAGAGAAGACAGAAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1792
Summary {0: 1, 1: 1, 2: 7, 3: 208, 4: 1575}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022232116_1022232119 -10 Left 1022232116 7:28424066-28424088 CCCTCCTTCTTCTGTCTTCTCTG 0: 1
1: 1
2: 7
3: 208
4: 1575
Right 1022232119 7:28424079-28424101 GTCTTCTCTGTGACTTCACATGG 0: 1
1: 2
2: 13
3: 98
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022232116 Original CRISPR CAGAGAAGACAGAAGAAGGA GGG (reversed) Intronic
900253942 1:1687079-1687101 AAAAGAAGAAAGAAGATGGATGG + Intronic
900420602 1:2554438-2554460 CAGAGAAGGGAGAAAAGGGACGG + Intergenic
900510057 1:3054563-3054585 CAGAGAAGACAGGTCAAAGAGGG + Intergenic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900698426 1:4027511-4027533 CAGAGAAGAAAGTACAAGAATGG + Intergenic
900706617 1:4084683-4084705 CAGAGAAGAGATCAGAACGAAGG + Intergenic
900738650 1:4316871-4316893 TAGAGAACACAGAAAATGGAGGG + Intergenic
900825969 1:4927236-4927258 CAAAGGAGACACAAAAAGGAAGG + Intergenic
900877391 1:5352962-5352984 CAGAGAAGCCAGAAGACACAAGG + Intergenic
901002816 1:6157096-6157118 CAGGGAAGGAAGAAGAAGGGTGG - Intronic
901175909 1:7298900-7298922 AAGGGAAGAGAGAGGAAGGAAGG - Intronic
901783931 1:11612178-11612200 CAGAGGAGAGAGAAGAAGACAGG + Intergenic
901855987 1:12044240-12044262 CAGAGAGGACTGATGAAGGATGG + Intergenic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
902362798 1:15951290-15951312 GAAAGGAGAGAGAAGAAGGAAGG + Intronic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
902894368 1:19468707-19468729 CAGAGGAGCCAGAAGAGTGAGGG - Intronic
903038862 1:20513367-20513389 AAGAGAAGAGGGAGGAAGGAGGG + Intergenic
903269564 1:22178795-22178817 CAGAGAAGGAAGGAGAAGGAAGG - Intergenic
903298054 1:22358347-22358369 GAGAGAGGACTGAAGAAAGATGG + Intergenic
903682869 1:25108758-25108780 AAGAGAAGAAAGGAAAAGGAAGG + Intergenic
903682885 1:25108841-25108863 AAGAGAAGAAAGGAAAAGGAAGG + Intergenic
904146238 1:28394326-28394348 CAGAGCAGAGAGAGAAAGGAAGG + Intronic
904193542 1:28766415-28766437 CAGTGAAGACAGACTTAGGAGGG - Intronic
904273459 1:29365262-29365284 GAAAGAAGACAAAAGAAAGAAGG - Intergenic
904273472 1:29365333-29365355 GAAAGAAGACAAAAGAAAGAAGG - Intergenic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
904767811 1:32863840-32863862 GAAACAGGACAGAAGAAGGAAGG + Exonic
904919604 1:33996740-33996762 CAGAAAAGAAAAAGGAAGGAAGG + Intronic
905071616 1:35230780-35230802 CAGAGAAGGCAGAACAAAAAGGG + Intergenic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905362645 1:37431086-37431108 CAGAGTGGATAGGAGAAGGAGGG + Intergenic
905618617 1:39420567-39420589 CAGGGAACACTGAAAAAGGAAGG - Intronic
905836541 1:41127797-41127819 CACAGGAGAAGGAAGAAGGAAGG - Intronic
905867961 1:41386547-41386569 GAGAGAAGAGAGAAGACGGGAGG - Intergenic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
905898084 1:41561994-41562016 CAAGGAAGAAAGAAGAGGGAAGG + Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906270387 1:44473140-44473162 CAGTCAAGACGGGAGAAGGAAGG - Intronic
906488944 1:46252627-46252649 TAGGGAACACAGAAGAAGAATGG + Intronic
906747637 1:48232815-48232837 AAGAGAAGAGAAAAGAGGGAGGG + Intronic
906945808 1:50293203-50293225 AAAAGAAGGCAGAGGAAGGAAGG + Intergenic
907333288 1:53685077-53685099 CACAGAAGAAAGAAGAGGGTGGG + Intronic
907455203 1:54571261-54571283 GAGAGAAGAAAGAAACAGGAAGG - Intronic
907528649 1:55070657-55070679 CAAAGAAGAGAAAAGAAGGCAGG + Intronic
907659884 1:56382186-56382208 CAGAGAAGAAGAAAGAGGGAGGG + Intergenic
907665540 1:56431184-56431206 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
907676960 1:56526840-56526862 CAGAGATGACACCAGAAGCAGGG + Intronic
907756421 1:57315080-57315102 CAGAAAGGACAGAAGAAGTGGGG - Intronic
907770104 1:57452992-57453014 AAGAAAAGAAAAAAGAAGGAGGG + Intronic
908742953 1:67347656-67347678 CAGAGCAGAAAGAAAATGGAAGG + Intronic
909027117 1:70494842-70494864 GAGAGAAGACTGTAGAAAGAAGG + Intergenic
909178975 1:72396409-72396431 CAGAGAAGGGAGAAAAAGCAGGG + Intergenic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
909438792 1:75674361-75674383 CAGAGGAGACAAAAGAAAAAAGG + Intergenic
909507750 1:76413130-76413152 CAGAGGAAATAGGAGAAGGAAGG - Intronic
909525660 1:76619853-76619875 CAGAGGAGGGAGAAGAAGGAGGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909698960 1:78499205-78499227 GAGAGAACAGAGAAGAAAGAGGG - Intronic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
910137134 1:83985374-83985396 CAAAGCAGCCAGAAGAAGGTGGG - Intronic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910280871 1:85500093-85500115 AAGAAAAGAAAGAGGAAGGAGGG - Intronic
910410005 1:86932722-86932744 GGGAGGAGACAGAAGAAGGCAGG + Intronic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910523275 1:88148434-88148456 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
910548642 1:88450372-88450394 GAGAGAAGACAGATGAATTAGGG - Intergenic
910623889 1:89285650-89285672 CATGGAAGAAAGAAGAAGCAGGG + Intergenic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911580011 1:99623250-99623272 AAGAAAAGAAAGAAAAAGGAAGG + Intergenic
911703439 1:100982851-100982873 CAGAGAAGACAGGATAGGTAGGG - Intergenic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
911821774 1:102432881-102432903 CAAAAAAGACATAAGAAGTACGG + Intergenic
912014379 1:105014360-105014382 CAGAGAAGGTAGAAAAAGAAGGG - Intergenic
912198664 1:107430097-107430119 GAGAGAAGACAAAAAAAGCAGGG - Intronic
912207444 1:107524090-107524112 AAAAGAAGACAGAAGGGGGAAGG - Intergenic
912331279 1:108822253-108822275 TAGAGCAGACAGAAAATGGAGGG - Intronic
912425702 1:109587967-109587989 CAGAGAGGAGAGAAAAAAGATGG - Intronic
912443729 1:109717524-109717546 AAGAGAAGAGAGTAGAAAGAAGG - Exonic
912507911 1:110168950-110168972 CAGAGAAGATAGAAAAAGGAAGG - Intronic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912724269 1:112044719-112044741 CAGAGAAGACGGAGGAACAAGGG + Intergenic
912897665 1:113610288-113610310 AAAAGAAGACAGAAGAGGAAGGG - Intronic
913082967 1:115406759-115406781 AAGAGAAGTCAGCAGTAGGAGGG - Intergenic
913115174 1:115690411-115690433 CAGAGAACTCAGGAGAGGGAAGG + Intronic
913133559 1:115864660-115864682 AAGAAAAGAAAGAAAAAGGAAGG + Intergenic
913319943 1:117581185-117581207 CAGGGAAGACTGGAGAATGAAGG + Intergenic
913409741 1:118537904-118537926 GAAAGAAGAAAGGAGAAGGAAGG + Intergenic
913528634 1:119716522-119716544 GAGAGAACATTGAAGAAGGATGG + Intronic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
914331516 1:146675041-146675063 AAGAGAAGAAAGAGAAAGGAGGG - Intergenic
914344387 1:146785942-146785964 CAGAGAAGACTGGAGCAGGAAGG - Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914394590 1:147252886-147252908 CAGAGAAGACTGTACAGGGAAGG - Intronic
914427423 1:147590453-147590475 GAGAGAAGAGAGAAGAAGCCAGG - Intronic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914704789 1:150161731-150161753 CAGGGGAGCCAGAAGATGGAGGG + Intronic
915167441 1:153956239-153956261 CAGGGAAGCCTGGAGAAGGAGGG + Intronic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
915702283 1:157807281-157807303 AAGAGAAGATGAAAGAAGGAAGG - Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
915915789 1:159940004-159940026 CAAAGAAGGAAGAAGAGGGAAGG + Intronic
915930028 1:160054661-160054683 CAGAGCTGACACAGGAAGGAGGG - Intronic
916055262 1:161064879-161064901 GAGAAAAGAGAGAGGAAGGAAGG + Intronic
916348371 1:163820478-163820500 CAGATAAGCCAGAGGGAGGAAGG + Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916766695 1:167867670-167867692 TAGCTAAGACAGAAGAAAGAGGG + Intronic
916820664 1:168395089-168395111 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
917031355 1:170695797-170695819 GAGAAAAGAGAAAAGAAGGATGG - Intronic
917469574 1:175314924-175314946 AAAAGAGGAGAGAAGAAGGAGGG + Intergenic
917483451 1:175433120-175433142 GAGAGAAGACAGAAGGAGCCTGG + Intronic
917656832 1:177134996-177135018 CATTGAGGACAGGAGAAGGAAGG - Intronic
917681938 1:177376299-177376321 CAGAGAAGACATAATTAAGATGG + Intergenic
918149132 1:181783012-181783034 CGGAGGAGACAGAACGAGGAAGG - Intronic
918212420 1:182362874-182362896 CAGAGAAGATAGAAATAGCAGGG - Intergenic
918215155 1:182386936-182386958 CAGAGAAGACCATAGAAAGATGG + Intronic
918293679 1:183134740-183134762 CAGAGAAGATATGAGAGGGAAGG + Exonic
918621669 1:186612697-186612719 CTGAGAAGAGAGAAAAGGGATGG + Intergenic
918657504 1:187046481-187046503 CAAAGCAGGCAGAAGAAGGTAGG - Intergenic
918681517 1:187361130-187361152 TAGAGAGGACAGAAGAATGTTGG + Intergenic
918682021 1:187367595-187367617 CAGAGGAGAGAGAGGCAGGAAGG + Intergenic
918876119 1:190046220-190046242 GACAGAAGAGAAAAGAAGGAAGG + Intergenic
919237750 1:194868216-194868238 CAGAGAAAAAAAAAAAAGGAAGG + Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919688333 1:200505534-200505556 AAGAGAAGAGAGAGAAAGGAAGG + Intergenic
919724348 1:200872545-200872567 CAGAGAAGACAGCAGCCGGTGGG + Intergenic
919813075 1:201421152-201421174 CAAAGAACACAGAAGCAAGATGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920087101 1:203425490-203425512 CAGAGAAGACAGACGTGGGGAGG - Intergenic
920248390 1:204605584-204605606 CAGAGAGGAGAGAAGAAGTGGGG - Intergenic
920557441 1:206914377-206914399 GAGAAAAGAGAGAGGAAGGAAGG - Intronic
920734847 1:208523974-208523996 GAGAGAAGAGAAAAGAAGAAGGG - Intergenic
920790935 1:209090856-209090878 CAGAGAAGACAGGAGAGGTGAGG + Intergenic
920808405 1:209257049-209257071 CAGAGCAGACAGCAGACGGGAGG + Intergenic
920962695 1:210678234-210678256 CTAAGATGACAGAACAAGGATGG - Intergenic
921200598 1:212801864-212801886 GAGAGAACAAAGATGAAGGAGGG - Intronic
921285043 1:213601932-213601954 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
921569427 1:216760702-216760724 CAGAGGGATCAGAAGAAGGAGGG + Intronic
921598744 1:217084155-217084177 CAGGAAAGAAAGAGGAAGGAAGG + Intronic
921787219 1:219245070-219245092 GAAAGAAGAAAGAGGAAGGAAGG - Intergenic
921828280 1:219698850-219698872 AAGAGAAGAGAGAGTAAGGAAGG + Intronic
922156915 1:223047764-223047786 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
922494580 1:226046640-226046662 CAAAGCAGACAGAGGAAGGTGGG - Intergenic
922628408 1:227077542-227077564 GAGACAAGAAAGAAGGAGGATGG - Intronic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
922716997 1:227882959-227882981 CAGAGAAGAGGGGAGAAGGCAGG + Intergenic
923268504 1:232334698-232334720 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
923286911 1:232505081-232505103 ATGAAAAGACTGAAGAAGGAAGG + Intronic
923327019 1:232888938-232888960 AAGAAAATAAAGAAGAAGGAAGG - Intergenic
923477654 1:234350207-234350229 CAAAGAAGAAAGAAGAAAGAAGG + Intergenic
923566566 1:235080877-235080899 AAGAAAAGAAAGAAAAAGGAGGG + Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
923930755 1:238693097-238693119 CAGAGAAGAAAGTAGAGGCAGGG + Intergenic
923986176 1:239385597-239385619 AAGAAAAGAAAGAAAAAGGAAGG - Intergenic
924089205 1:240485534-240485556 CAGAGAAGAAAGAACATGGAGGG - Intergenic
924160010 1:241221145-241221167 AAAAGAAAACAAAAGAAGGAAGG + Intronic
924215966 1:241822884-241822906 CATAGAATGGAGAAGAAGGATGG - Intergenic
924389202 1:243533632-243533654 CAGAGAAGGCAGAATAAAAATGG + Intronic
924555082 1:245111574-245111596 AAGAGAAGACAGACAAAGAAAGG - Intronic
924568137 1:245214868-245214890 CATAGAAGACAGAATATGGTAGG + Intronic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063262402 10:4404962-4404984 CACAGAGGACAGAGCAAGGAAGG + Intergenic
1063545820 10:6980509-6980531 AAAAGAGGAAAGAAGAAGGAGGG - Intergenic
1063605746 10:7521448-7521470 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1064405261 10:15056626-15056648 AAGAAAAGAAAGAAAAAGGAAGG - Intronic
1064709311 10:18107470-18107492 AAGAGCAGACTGAAGAGGGATGG - Intergenic
1064835884 10:19529523-19529545 CAGAGAAGACAGAAAAAAACAGG + Intronic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065228296 10:23570144-23570166 GGGAGAAGGCAGAAAAAGGAGGG - Intergenic
1065277549 10:24100066-24100088 TAGTGAAGACAGGAGAGGGAGGG - Intronic
1065325407 10:24546180-24546202 CGGAGGAGGCAGGAGAAGGAGGG - Exonic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065421969 10:25555023-25555045 AAAAGAAGAGAAAAGAAGGAAGG + Intronic
1065667680 10:28080129-28080151 AAGAGAAAAGAAAAGAAGGAAGG + Intronic
1065750439 10:28881273-28881295 GAAAGAAGGCAGAAGAAGGAAGG + Exonic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1066312493 10:34211428-34211450 GAGAGAAGGCAGAAGAAAAAGGG + Intronic
1067034873 10:42906719-42906741 CAGACAAGAGAGAAGAATAAAGG + Intergenic
1067128278 10:43539032-43539054 AAGAGAAGAGAAGAGAAGGAGGG - Intergenic
1067202480 10:44185350-44185372 GAGAAAAGAAGGAAGAAGGAAGG + Intergenic
1067293516 10:44961032-44961054 CAGAGGAGAAAGAGGAAGGGAGG + Intronic
1067554372 10:47257995-47258017 CACAGAAGAAAGAGGAAGGCTGG + Intergenic
1067667730 10:48292426-48292448 GAGAGAAGGCAAAAGAAGAATGG + Intergenic
1067711500 10:48654833-48654855 AAGAAAAGAGAGAGGAAGGAAGG - Intronic
1067711524 10:48655064-48655086 AAGAGAAGAGAAGAGAAGGAGGG - Intronic
1067907065 10:50303509-50303531 AAAGGAAGACAGAAAAAGGAAGG + Intergenic
1068238103 10:54264441-54264463 CATAGAACTCAGAAGATGGATGG + Intronic
1068247691 10:54394020-54394042 AAAAGAAGAAAGAAAAAGGAAGG + Intronic
1068309674 10:55262123-55262145 AAGAAAAGAAAGATGAAGGAAGG + Intronic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068648877 10:59499701-59499723 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1068716078 10:60190173-60190195 AAGAGAAGAAAGGAGAAGAAAGG + Intronic
1068890008 10:62139003-62139025 AAGAGAAGGCAGAAAAAGAATGG - Intergenic
1069281689 10:66662583-66662605 CAGAAAGGACAGAGGAAGGAAGG - Intronic
1069957443 10:72060693-72060715 GAGAGAGGACAGGAGAAAGAGGG + Exonic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1070223510 10:74475800-74475822 AAGAGAAGAGAGAAAAAGGAGGG + Intronic
1070343970 10:75523783-75523805 CAGGGAAGAAGGGAGAAGGATGG - Intronic
1070463672 10:76696027-76696049 CAGAGAAGGCAGAAAAAGAGTGG - Intergenic
1070637091 10:78137705-78137727 AAGAGGAGAAAGAGGAAGGAAGG - Intergenic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070730072 10:78820969-78820991 AAGACAAGACAGTAGAGGGAGGG - Intergenic
1071140974 10:82509129-82509151 GACAGAAGACAGAGGAGGGAGGG - Intronic
1071268965 10:83989755-83989777 GAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1071393574 10:85199579-85199601 CAGAAAAGAAGAAAGAAGGAAGG + Intergenic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1071877815 10:89861500-89861522 AGAAGAAGAAAGAAGAAGGAGGG - Intergenic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072519525 10:96218784-96218806 TAGATAAGACAGAAAGAGGAGGG - Intronic
1072828172 10:98629493-98629515 CAAAAAACACAAAAGAAGGATGG - Intronic
1072843777 10:98805100-98805122 GAGATAAGAGAGTAGAAGGATGG + Intronic
1072957152 10:99897334-99897356 CAGTGAAGACAGGACAAGAAAGG + Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073137793 10:101229374-101229396 CAGAGAAGAGAGAAGAGAGAGGG - Exonic
1073261759 10:102195910-102195932 AAGAAAAGAAAGAAAAAGGAAGG - Intergenic
1073407337 10:103309425-103309447 CAGAAGAGAGAGAATAAGGAGGG - Intronic
1073616728 10:105003976-105003998 GAGAGAAGAGAAAAAAAGGAGGG - Intronic
1073785687 10:106886599-106886621 CAGGAAAGAAGGAAGAAGGATGG + Intronic
1073907661 10:108302728-108302750 AAGAAAAGAGAGAGGAAGGAAGG + Intergenic
1074129249 10:110558669-110558691 AAGGGAAGAAAAAAGAAGGAAGG + Intergenic
1074296374 10:112193148-112193170 CAGAGAAGACAAAAGTAGAAGGG + Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074410877 10:113227415-113227437 TAGAAAGGACAGAAGAAGCAGGG + Intergenic
1074596792 10:114875361-114875383 AAGTGAAGAAAGAAGAAGCAAGG + Intronic
1074641488 10:115388263-115388285 CACAGAAGACATAAGGAGTAAGG - Intronic
1074765935 10:116700106-116700128 CAGAGAAGATAAAACAAGGCAGG + Intronic
1074872925 10:117591310-117591332 CAGAGAAGACAAGGGAAAGAAGG - Intergenic
1075165736 10:120066768-120066790 CAAAGCAGGCAGAAGAAGGTCGG - Intergenic
1075192782 10:120326326-120326348 CAGAGAGTAGAAAAGAAGGAAGG - Intergenic
1075336393 10:121612073-121612095 AAGAAAAGAAAGAAAAAGGAAGG - Intergenic
1075883966 10:125880810-125880832 CAGACAAGATGGAAGAAGAAGGG - Exonic
1076181398 10:128411707-128411729 CAGAAAAGGCAGAAAAGGGAGGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076444972 10:130508041-130508063 CAGAAAAGACAGATGGATGAGGG - Intergenic
1076588923 10:131570150-131570172 CAGAGATGAAAGGAGGAGGAGGG + Intergenic
1076775359 10:132693224-132693246 CAGAGAAGGCAGATAAAGAATGG + Intronic
1077124922 11:929019-929041 CAGAGAAGACCTCACAAGGAAGG + Intronic
1077736930 11:4801157-4801179 CAGAGAACTCAGAAGAAGACAGG - Intronic
1078061003 11:8043982-8044004 AAGAGCAGCCAGAAGAAGGGGGG - Intronic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078582026 11:12546163-12546185 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1078831113 11:14978019-14978041 CAGAAGAGACAGGAGAAGAAGGG + Intronic
1078917046 11:15788087-15788109 CAGTGAAGACAGAAAAAGTAAGG + Intergenic
1078923878 11:15857155-15857177 AAGAGACGGCAGAAGACGGATGG - Intergenic
1078932863 11:15926316-15926338 CAAAGCAGACAGAAGAAGGTGGG + Intergenic
1079112604 11:17613287-17613309 GAAAGAAGAGAGAAGAAAGAAGG - Intronic
1079113239 11:17619475-17619497 CAAAGAAGGCAAAAAAAGGAAGG - Intronic
1079281474 11:19090700-19090722 CAGAGATGACAGAACCAGAATGG - Intergenic
1079320507 11:19447948-19447970 CAGAGGAGAGAGAGGAAGGTGGG - Intronic
1079352415 11:19703013-19703035 AAGAGAAGGAAAAAGAAGGAAGG - Intronic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1079414766 11:20223421-20223443 CAGAGAAGAAAGATGTAGGAAGG - Intergenic
1079524954 11:21374976-21374998 CAGAGAAGAAGGAAGAAGGCAGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079645198 11:22854632-22854654 TAGAGAATGCAGAAGAAGAATGG + Intronic
1079736700 11:24006329-24006351 CAGGAAAGAGAGAACAAGGAAGG + Intergenic
1079791972 11:24749570-24749592 CAAAGCAGGCAGAAGAAGGTAGG + Intronic
1079826790 11:25205928-25205950 CATATAAGACAGAGGCAGGAGGG + Intergenic
1079848012 11:25494737-25494759 CATCCAACACAGAAGAAGGATGG + Intergenic
1079923555 11:26462481-26462503 CAGAGAACACTGAAAAATGATGG - Intronic
1079962162 11:26937998-26938020 AAAAGAAGACAGAAAAAGGAGGG - Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080048932 11:27838586-27838608 GAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1080050200 11:27851808-27851830 AAGGGAAGAAAGAAAAAGGAAGG - Intergenic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080295296 11:30720322-30720344 GAAAGAAGAAGGAAGAAGGAAGG - Intergenic
1080566159 11:33511321-33511343 CAGAGAAGCCAGTATAAGCAGGG - Intergenic
1081225341 11:40514648-40514670 CAAAGAAGACAATAGATGGAAGG - Intronic
1081229854 11:40572537-40572559 TGGAGAAGACTGAAAAAGGAAGG + Intronic
1081947833 11:47014338-47014360 CAGAAAAGAAAGAGAAAGGAAGG + Intronic
1082045517 11:47722985-47723007 CTGAAAAGACAAAAAAAGGAAGG - Exonic
1082611995 11:55311181-55311203 CAGAGAAGACTAAGGAAGGAGGG - Intergenic
1082621048 11:55422577-55422599 AAAAGAAGAAAGAAGAAGGAAGG - Intergenic
1082628372 11:55511826-55511848 GAGAGAAGAAAGAAGCAGGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082892737 11:58157547-58157569 AGGAAAAGACAGAGGAAGGAAGG + Intronic
1083027421 11:59562397-59562419 CAGAGAAATCACTAGAAGGAAGG + Intergenic
1083187253 11:61024899-61024921 CAGAGAAGTAAAAAGAAGCAAGG - Intergenic
1083224630 11:61276989-61277011 GATAGGAGACAGAGGAAGGAAGG + Intronic
1083311930 11:61788183-61788205 CAAAGGAGAGAGAAGAAGGGAGG - Exonic
1083478841 11:62930578-62930600 AGGAGAAGACAGGAGAGGGATGG + Intergenic
1083836326 11:65270943-65270965 GAAAGAGGACAGAAGGAGGAGGG - Intronic
1084506055 11:69569243-69569265 CAGAGAGGACAAAACAAAGATGG + Intergenic
1085031218 11:73271989-73272011 CAGAGAAGCCAGGAGAGGGCTGG + Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086092071 11:83014849-83014871 AAGAAAAGAAAGAGGAAGGAAGG + Intronic
1086096078 11:83051200-83051222 CAGAGGAGTCACAAGATGGAAGG + Intronic
1086206224 11:84261232-84261254 AGGAAAAGAGAGAAGAAGGATGG - Intronic
1086315995 11:85592976-85592998 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086612250 11:88771552-88771574 CAAAGCAGGCAGAAGAAGGTGGG - Intronic
1086624008 11:88923511-88923533 TAGAGTAGACAGTAGAATGATGG + Intronic
1086827636 11:91519098-91519120 GAAAGAAGAAAGAAGAAAGAAGG + Intergenic
1086947798 11:92860466-92860488 GAGAGAAGGCAGGAGAAGGAGGG + Intronic
1087139145 11:94748720-94748742 CAGAGAAGAGTGATAAAGGATGG - Intronic
1087161115 11:94949057-94949079 TAGAAAGGAGAGAAGAAGGAAGG + Intergenic
1087427360 11:98007156-98007178 AACAGAAGACTGAAGAAGAATGG - Intergenic
1087529878 11:99366461-99366483 CAGAAAAGACTGGGGAAGGAAGG + Intronic
1087622215 11:100555152-100555174 TTGAGAAAACAGCAGAAGGAAGG + Intergenic
1088141082 11:106617129-106617151 AAAAGAAGAAAGAAAAAGGAGGG - Intergenic
1088182905 11:107132285-107132307 CAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1088627756 11:111743941-111743963 CAGAGAAGAGTGAACAGGGAAGG + Intronic
1088675502 11:112188613-112188635 CAGAGATGATGGAAGGAGGAAGG - Intronic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1088973860 11:114797374-114797396 GAGAGAAAATAGAAGAAGGTGGG - Intergenic
1089075271 11:115733627-115733649 AAGAGAAGACAAAAGCAAGATGG - Intergenic
1089113926 11:116078765-116078787 CAGAAAAGAGGGAAGAGGGAAGG + Intergenic
1089225562 11:116917809-116917831 GAAAGAAGGAAGAAGAAGGAAGG + Intronic
1089350753 11:117820373-117820395 CTGAGAAGACAAAGGCAGGATGG + Intronic
1089410856 11:118241480-118241502 CTGAGAAGACTGAAGAAGTACGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089611319 11:119671103-119671125 GAGAGAAGAAAGGAGAAGCATGG + Intronic
1089950602 11:122522159-122522181 ATGAGGAGAAAGAAGAAGGAAGG + Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1090073285 11:123562234-123562256 CAGAAAAGAGAGAAGCAGGGAGG - Intronic
1090208243 11:124897321-124897343 AAGAGAAGACAGATGAGGGGTGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090851259 11:130572476-130572498 CAGAAAAGAGAGAATAGGGATGG - Intergenic
1090894009 11:130953089-130953111 AGGAAAAGACAGAAGGAGGAAGG - Intergenic
1091130295 11:133140667-133140689 AAAAGAAGAAAGAAGAAAGATGG + Intronic
1091491879 12:939769-939791 CAAAGAAGAGAGAAGAGGGCTGG + Intronic
1091800719 12:3323054-3323076 GAGAGGAGGGAGAAGAAGGAAGG + Intergenic
1092174066 12:6390946-6390968 GAGAAAAGGCAGAAGAAGGGGGG + Exonic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092334299 12:7615157-7615179 AAGAAAAGAGGGAAGAAGGAAGG + Intergenic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092864153 12:12745243-12745265 AGGAGAAGACTGAAGAAGGCCGG + Intronic
1093293931 12:17364548-17364570 AAGAGAAGGCTGAAAAAGGAAGG + Intergenic
1093356488 12:18173786-18173808 CAGAGAAGAAAGAAAAGGGGGGG - Intronic
1093359610 12:18207371-18207393 GAGAGAAGAAAGAAAAAGAAAGG + Intronic
1093479065 12:19585659-19585681 AAGAGAAGAAGGAAGAAGGAAGG + Intronic
1093534839 12:20210336-20210358 CAGAGAGGACAGGAGAAGAGAGG - Intergenic
1093568415 12:20636027-20636049 AAGAAAAGAAAGATGAAGGAAGG + Intronic
1093740429 12:22679384-22679406 CAAAGCAGGCAGAAGAAGGTAGG - Intronic
1093778967 12:23111911-23111933 GAAAGAAGAAAGAAGAAGGGAGG - Intergenic
1093837111 12:23846113-23846135 CTCAGAAGGCAGAAGAAGGTGGG - Exonic
1094038230 12:26093629-26093651 TAGAGAAGGCATAAAAAGGAGGG - Intergenic
1094472068 12:30812133-30812155 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
1094801007 12:34035996-34036018 AAGAGTAGACAAAAGAAGGCAGG - Intergenic
1095371499 12:41473032-41473054 CAGAAAAGACAAAAGAAGTTGGG + Intronic
1095581873 12:43809211-43809233 CAGAGAAGAAACAAGATGGATGG - Intergenic
1095604629 12:44052392-44052414 CAGAAAAGAAAGAACAAGGAGGG + Intronic
1095861460 12:46922520-46922542 CAGAGATGAAGGTAGAAGGAAGG - Intergenic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096077952 12:48816558-48816580 CAGAGATATGAGAAGAAGGAGGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096395481 12:51262927-51262949 AAGAGAAGGCAGAAGAAAGGGGG - Intronic
1096451957 12:51750461-51750483 AGGAGGAGACAGAACAAGGAAGG + Intronic
1096462513 12:51829775-51829797 AAGAGAGGAAAAAAGAAGGAAGG + Intergenic
1096463902 12:51837685-51837707 GAGACAAGACAGTGGAAGGAAGG - Intergenic
1096739647 12:53683252-53683274 CACAGAAGACAGAACATGAATGG - Intergenic
1096886138 12:54721263-54721285 AAAAGAAGAGAGGAGAAGGAGGG - Intergenic
1097132527 12:56823165-56823187 AAGAAAAGAAAGAAAAAGGAAGG - Intergenic
1097156366 12:57015132-57015154 GGGAGAAAAGAGAAGAAGGAAGG + Intronic
1097226725 12:57481084-57481106 CAGAGAAGGCAAAAAAAGGGTGG - Intronic
1097245618 12:57606089-57606111 CAGAGAAGAGAGGAGATGGAAGG + Intronic
1097342525 12:58454933-58454955 GAGAAAAGAAAGAAGAAAGATGG - Intergenic
1097473042 12:60019347-60019369 TAAAGAAGAAAGAAGAAGAAAGG - Intergenic
1097969406 12:65616321-65616343 AAGAGAAGAGAAGAGAAGGAAGG - Intergenic
1098175378 12:67784808-67784830 AAGAGAAGGGAGAAGAAGTAAGG + Intergenic
1098330619 12:69348600-69348622 GAGAGAAGGAAGAAGAAGAAGGG + Intronic
1098460799 12:70731050-70731072 CAGAGAGGAAGGAAGGAGGAAGG + Intronic
1098580042 12:72088827-72088849 AAGAGAAGGTAGAAGAAGGGAGG - Intronic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1099393544 12:82110074-82110096 GAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1099536205 12:83848179-83848201 AGGAGAAGACAGAAGTAGGGAGG - Intergenic
1099830877 12:87840972-87840994 AAGAGAAAACAGAAAAAGCAAGG - Intergenic
1099862985 12:88243146-88243168 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1099923212 12:88984780-88984802 GAAAGAAGACATAAGAAGGGTGG + Intergenic
1100040510 12:90311821-90311843 CAGAGAATAAAGAAGACAGAGGG + Intergenic
1100081410 12:90855691-90855713 CAGACAACAAAAAAGAAGGAAGG + Intergenic
1100102826 12:91130224-91130246 GAAAGAAGAAAAAAGAAGGAAGG - Intergenic
1100123545 12:91396117-91396139 GAGAGAAGAATGAAGAAGGAAGG - Intergenic
1100742873 12:97614679-97614701 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1100899847 12:99225642-99225664 CACAGGAGACAGATGAAGGCCGG - Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101481318 12:105100428-105100450 GAAAGAAGAAAGAGGAAGGAAGG - Intergenic
1101510265 12:105386656-105386678 AAGAGAAGAGAAAGGAAGGAAGG - Intronic
1101562806 12:105875146-105875168 GAGATAAGTGAGAAGAAGGATGG + Intergenic
1101612995 12:106309205-106309227 GAGAGAAGACAGAAGAAAAGGGG - Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1102318725 12:111912411-111912433 CAGAGAAGGCAGATAAAGGATGG - Intergenic
1102548563 12:113674274-113674296 CAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1102556048 12:113727291-113727313 GAGAGAGGAAAGAGGAAGGAAGG - Intergenic
1102570320 12:113823386-113823408 GAGAAATGACAGAGGAAGGAGGG + Intronic
1102833580 12:116031601-116031623 GAGAGAAGAGAAGAGAAGGAGGG + Intronic
1103123447 12:118400063-118400085 CAGAGAGGAGTGAAGAAGAAGGG + Intronic
1103171700 12:118825889-118825911 AAGGAAAGAGAGAAGAAGGAAGG + Intergenic
1103185443 12:118953164-118953186 CAGAGGACTCAGAATAAGGAAGG + Intergenic
1103295615 12:119884023-119884045 GAGAGAGGAAAGAGGAAGGAAGG + Intergenic
1103366969 12:120390572-120390594 GAGGGAAGAGGGAAGAAGGAGGG + Intergenic
1103438160 12:120942877-120942899 AAGAAAAGAAAGAAGAAAGAGGG + Intergenic
1103622920 12:122199980-122200002 CAGAGGAGACAGCAAAAGAAAGG - Intronic
1104051223 12:125195139-125195161 CGGAGAAGACAAAGGCAGGAAGG - Intronic
1104186312 12:126435439-126435461 CAGAAAAGAAAAAAGAAAGAGGG - Intergenic
1104261049 12:127182326-127182348 CAGAGGAGAAAGATGAAGGCTGG + Intergenic
1104301726 12:127570603-127570625 AAGAGAGGAAAGAAGGAGGAAGG + Intergenic
1104353454 12:128065059-128065081 GAGAAAGGACAGAAGAAAGACGG + Intergenic
1104657122 12:130581614-130581636 CAAAGAGAACAGAGGAAGGAAGG - Intronic
1104766977 12:131336417-131336439 CAGAGAGGACCGAGGAAGGTTGG - Intergenic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105564647 13:21532608-21532630 CAGAGAAGAAACAACTAGGATGG + Intronic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1105579815 13:21684788-21684810 CAGAGAAGACTTGAGAAAGAAGG - Intronic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106371420 13:29137609-29137631 AAAAGAAGAAAGAAGAAAGAAGG - Intronic
1106422740 13:29596665-29596687 CCTATAAGATAGAAGAAGGATGG - Intergenic
1106721191 13:32436386-32436408 TAGAAAAGACAGAAGAAGATTGG - Exonic
1106810321 13:33352627-33352649 AAGAGAAGCCAGATGAAAGACGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107109615 13:36682497-36682519 CAGATGAGACAGAGGATGGATGG + Intronic
1107132040 13:36907197-36907219 TAGAGAAGAAAGTAGAATGAAGG + Intronic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107272581 13:38637810-38637832 CAAAGTATACAGAAGAAGCATGG + Intergenic
1107330509 13:39295073-39295095 AAGAGAAGGCAGAAGAGGCATGG - Intergenic
1107703464 13:43073950-43073972 CAAAAAAAAAAGAAGAAGGATGG - Intronic
1107724581 13:43285843-43285865 CAAAGAAGAAAGAAGAAGAGGGG - Intronic
1107847181 13:44527586-44527608 CAGAGAAGGCAGAAAAAGAGTGG + Intronic
1108041123 13:46340089-46340111 GAGAGAAGAGAGAAGATGCAGGG - Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1108243936 13:48496743-48496765 AAGAGAGGACAGGAGAGGGAGGG + Intronic
1108703682 13:52965715-52965737 GAGAGAAGACAGAGAAAGAAGGG - Intergenic
1108818956 13:54322080-54322102 CAAAGGAGGCAGAAGAAGGTGGG + Intergenic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1108950245 13:56083614-56083636 CCGAGAAAATAGCAGAAGGAGGG + Intergenic
1109018126 13:57046924-57046946 TGGAGAAGACTGAAGAAGAAAGG - Intergenic
1109239557 13:59868718-59868740 CTGAGGAGAGGGAAGAAGGAAGG - Intronic
1109576478 13:64265229-64265251 CAGTCAAGACAGAAGCAGTATGG + Intergenic
1109793931 13:67285469-67285491 CTGAGAAGAAATAAGAAGGGAGG + Intergenic
1109900823 13:68767161-68767183 CACAGAAGCCAGAAGAGCGAAGG - Intergenic
1110273377 13:73616127-73616149 CAGATCAGGCTGAAGAAGGATGG + Intergenic
1110809361 13:79794555-79794577 TAGATATTACAGAAGAAGGAAGG + Intergenic
1110964038 13:81668750-81668772 AAGAGAGGAAGGAAGAAGGATGG - Intergenic
1110999697 13:82164361-82164383 CCAAGAAGACACCAGAAGGAAGG - Intergenic
1111323215 13:86657713-86657735 CAGTAAAGACAGAAAAGGGAGGG - Intergenic
1111342610 13:86907463-86907485 CAGAGAAGACATCAGCAGGCAGG - Intergenic
1111343338 13:86916334-86916356 CAGAGAAGACTGAAAGAGTAGGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111811657 13:93099097-93099119 CACAGAAGAAAGAAGATGGCCGG - Intergenic
1112207229 13:97336925-97336947 AGGAGTGGACAGAAGAAGGAGGG - Intronic
1112253626 13:97807313-97807335 CAGAAATGACAGAATCAGGATGG + Intergenic
1112416240 13:99205679-99205701 GAGAGAAGATAGAAGATAGAAGG + Intronic
1112563922 13:100536315-100536337 AAGAGAACAGAGAGGAAGGAGGG - Intronic
1112639059 13:101252258-101252280 CAGAGAACAGAGAGGAAGAAGGG - Intronic
1112726087 13:102306398-102306420 GAGAGAAGGCAGATGATGGAGGG + Intronic
1112791170 13:103003612-103003634 CTGAGAAGACAGAACAAAAATGG + Intergenic
1113238754 13:108313351-108313373 CAGAGAAGACAGTGAAAGAATGG + Intergenic
1113539814 13:111097609-111097631 TGGAGAAGACAGAAAAGGGATGG + Intergenic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114128583 14:19761190-19761212 AAAAGAAAACAAAAGAAGGAAGG - Intronic
1114400167 14:22402730-22402752 TAAAGAAGGGAGAAGAAGGATGG + Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114559230 14:23578634-23578656 AAGAGAAGAGAGAAGAGGGTGGG + Exonic
1114565240 14:23627029-23627051 CTCAGAAGAAACAAGAAGGATGG + Intergenic
1114928299 14:27433548-27433570 CAGAGAATACAGAAAAAAAAGGG + Intergenic
1114989438 14:28269156-28269178 AAGAAAAGAAAGAAGAAGAAAGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115206224 14:30908488-30908510 CAGCTAAGACTGAAGAATGAAGG - Intronic
1115239097 14:31237028-31237050 GAGAGAGGAAAGAAAAAGGAAGG + Intergenic
1115263455 14:31476425-31476447 GAAAGAAGAAAGAGGAAGGAAGG - Intergenic
1115811295 14:37111266-37111288 GGGAGAAGACAGAAGACGGTTGG - Intronic
1115878402 14:37887803-37887825 CAGTGAAGACACAAGAAACAGGG - Intronic
1115913701 14:38285875-38285897 GAGAGAAGAGAGAGAAAGGAAGG + Intergenic
1116133289 14:40889145-40889167 CACAGAAAAAAGAAGAAGGAAGG + Intergenic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1116230065 14:42204658-42204680 CAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1116377411 14:44221195-44221217 AATAGTAGAAAGAAGAAGGAAGG + Intergenic
1116542469 14:46114739-46114761 AAAAGAAGAAAGAAGAAAGAAGG - Intergenic
1116636181 14:47399186-47399208 AAGATAAGACATAAGAAAGAAGG + Intronic
1116725000 14:48552571-48552593 CAGAGGAGACAAAAGAAAAAAGG - Intergenic
1116863743 14:50014952-50014974 GAAAGAAGAAAGAGGAAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1117243169 14:53856047-53856069 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117915399 14:60672772-60672794 CACAGATGACAGCAAAAGGATGG - Intergenic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118174157 14:63421300-63421322 CAGAGAAGGCAGCACAAGGAAGG + Intronic
1118317503 14:64734265-64734287 AAGAGAAGAGAAAAGAAAGAGGG - Intronic
1118676331 14:68188411-68188433 AAGAGGAGAAAGAAGAAAGATGG - Intronic
1118816673 14:69318970-69318992 CAGGAAAGACGGAAGATGGAAGG - Intronic
1119243437 14:73082254-73082276 AAAAAAAGACAGAAGGAGGAGGG - Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119644165 14:76336578-76336600 CAGGAAAGACAATAGAAGGAAGG - Intronic
1119770238 14:77216090-77216112 TAGAAAAGAGAGAGGAAGGAAGG + Intronic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120391048 14:83909216-83909238 GAGAGAAGCCAGAAGAATTATGG + Intergenic
1120484773 14:85099294-85099316 AAGAGAAGAGAGGAGAAAGATGG + Intergenic
1120554750 14:85915974-85915996 CAGAGAAGAGAGATAAAGAAAGG - Intergenic
1120871383 14:89340082-89340104 GAGAGGAAAGAGAAGAAGGAAGG + Intronic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121416943 14:93786345-93786367 CAGAGAAGAGAGCAGAAGATGGG + Intronic
1121497956 14:94410158-94410180 CAGGGAAGACAATAAAAGGAGGG - Intergenic
1121502532 14:94449602-94449624 GAGAGAAGAAAGAAAAGGGAAGG - Intronic
1121553673 14:94820550-94820572 CACTGAAGAGAGAAGAATGAAGG + Intergenic
1121950043 14:98163687-98163709 TAGAGAAGAAAGTAGGAGGATGG - Intergenic
1121991871 14:98565826-98565848 CATGGAAGACAGTGGAAGGAAGG - Intergenic
1122092962 14:99352172-99352194 CAGAGATGAGAGAGGAGGGACGG + Intergenic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1122487880 14:102093967-102093989 CAAAAAAGAAAAAAGAAGGAAGG + Intronic
1122515421 14:102305011-102305033 CGGAAAAGAAAGAAGCAGGAAGG + Exonic
1122765870 14:104069471-104069493 CAGAGAAAACAGCTGAGGGAGGG - Intergenic
1123131738 14:105992308-105992330 GAAAGAAGAAGGAAGAAGGAAGG - Intergenic
1123196772 14:106624525-106624547 CAGATGAGGCACAAGAAGGAAGG - Intergenic
1123453522 15:20392012-20392034 AACAGAAGGCAGAAAAAGGAAGG - Intergenic
1123571523 15:21615434-21615456 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1123608142 15:22058025-22058047 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1124444872 15:29721680-29721702 AAGAGAAGACAGAAAAATGAGGG + Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124599440 15:31119915-31119937 TAGAGAAGGCAGAAAAAGAAGGG + Intronic
1124601949 15:31140585-31140607 AAGAGAAGAAGCAAGAAGGATGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125339554 15:38661148-38661170 AAGAAAAGAAAAAAGAAGGAAGG - Intergenic
1125810071 15:42531619-42531641 CAGAAAACAAAAAAGAAGGAGGG - Exonic
1126076095 15:44911254-44911276 AAAAGAAGAGAGAGGAAGGAAGG + Intergenic
1126145012 15:45465903-45465925 CAAAACAGGCAGAAGAAGGAGGG + Intergenic
1126389832 15:48135357-48135379 CACAAAAGACTGGAGAAGGATGG + Exonic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127117017 15:55738878-55738900 AGGAAAAGACAGAGGAAGGAAGG + Intronic
1127556076 15:60088975-60088997 CAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1128349271 15:66878180-66878202 CAGAGAGAAGAGGAGAAGGAGGG + Intergenic
1128491688 15:68152921-68152943 CAGAGATGACAGAGGTAGAAGGG - Intronic
1128518526 15:68359977-68359999 CTGAGCAGACAGAGGAAGGTGGG + Intronic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1128701938 15:69811103-69811125 CAGAGGAGGCAGGGGAAGGAAGG - Intergenic
1128773136 15:70298160-70298182 AAGAAAAGAAAGAAGATGGAGGG - Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129044994 15:72726018-72726040 AAGAAAAGAGAGAAAAAGGAAGG - Intronic
1129098415 15:73234344-73234366 CAGAGAAGACAACAGATTGAGGG - Intronic
1129107993 15:73322447-73322469 AAAAGAAGAAAGAAGAGGGAAGG + Exonic
1129139264 15:73582405-73582427 CAGTCAAGACAGAAGCAAGAAGG + Intronic
1129248953 15:74297726-74297748 CAGGAAAGAAAGAAGAGGGAAGG + Intronic
1129648483 15:77461062-77461084 CAGAAAAGCCAGAAGAGTGAAGG + Intronic
1129905248 15:79182627-79182649 AAGAAAAGACAGAAAGAGGAAGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130149503 15:81300338-81300360 CACAGGAGATAGAAGATGGAAGG - Exonic
1130209532 15:81910503-81910525 CCGAGAAGAGAGCAGAAGGGAGG + Intergenic
1130258614 15:82337494-82337516 CAGAGAAGAGAGAAGCCCGAGGG + Intergenic
1130270071 15:82441590-82441612 CAGAGAAGAGAGAAGCCCGAGGG - Intergenic
1130333015 15:82935780-82935802 CAGAGGAGACAGAAGTGGGTGGG - Intronic
1130395443 15:83497043-83497065 CAGAGAAGACAGATGTTAGAGGG - Intronic
1130596309 15:85252466-85252488 CAGAGAAGAGAGAAGCCCGAGGG - Intergenic
1130662832 15:85844051-85844073 CAGAGAAGACAGCATAAGGGAGG + Intergenic
1130766650 15:86877846-86877868 GTGAGAAGAGAGAAGAAGGTTGG - Intronic
1130795138 15:87199864-87199886 AAAAGAAGAAAGAGGAAGGAAGG + Intergenic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131074368 15:89486090-89486112 TAGAGAAGTCATGAGAAGGATGG + Intronic
1131299668 15:91186000-91186022 GACAGAAGAGAGAAGAAGCAGGG - Intronic
1131312679 15:91305033-91305055 CAGAAAAGACAGACAAATGACGG + Intergenic
1131353202 15:91720363-91720385 AGGAGAAGACAGAAGAAAGTGGG + Intergenic
1131531196 15:93193557-93193579 CAGAGCAGAAGGAAGAAGAAAGG - Intergenic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1131696220 15:94880762-94880784 AAGAAAAGACAGAAGAAAAAAGG - Intergenic
1131761202 15:95624410-95624432 CAGTTGAGACAGAAGAAGTAAGG + Intergenic
1131775457 15:95792079-95792101 GAGAAAAGACAGAGGAAGAAAGG - Intergenic
1131792069 15:95975800-95975822 CAGAAAAGAGGGAAGGAGGAAGG + Intergenic
1131828531 15:96339636-96339658 CAGAGAAAAAGAAAGAAGGAAGG + Exonic
1131963356 15:97811467-97811489 CATAGAAGCCAGAAAAAGCAAGG - Intergenic
1131979780 15:97983567-97983589 CAGAGAGGACTGAAGAGGAAGGG - Intergenic
1132050554 15:98604590-98604612 GAGAGAAGGCAGCAGAAGGAGGG + Intergenic
1132195610 15:99912537-99912559 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1132337196 15:101055594-101055616 AGGAGCAGACAGAATAAGGACGG + Intronic
1202980377 15_KI270727v1_random:349823-349845 AAAAGAAAACAAAAGAAGGAGGG - Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1133194425 16:4158836-4158858 AGGAGAAGAAAGAGGAAGGAAGG + Intergenic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133534781 16:6691353-6691375 CAGAGAAGAGTGAAGAATGATGG - Intronic
1133630331 16:7614350-7614372 CTGATAAGACAGAAGAGGGGAGG - Intronic
1133668121 16:7990740-7990762 GAGATAAGAGAGTAGAAGGATGG - Intergenic
1133904250 16:10006811-10006833 CACAGAAGAGAGTAGAAGGATGG - Intronic
1133907295 16:10033921-10033943 CCAAGAAGGCAGGAGAAGGAAGG - Intronic
1133929468 16:10220503-10220525 CAGAGAAGAAGGAAGAGAGAAGG + Intergenic
1134136594 16:11680462-11680484 CTGAGAGCACAGAATAAGGAAGG + Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134215895 16:12316733-12316755 CAGAGAAGCCAGGGGCAGGAAGG - Intronic
1134571050 16:15291546-15291568 CAGATAAAATAGAAGAAGGTTGG + Intergenic
1134731327 16:16464530-16464552 CAGATAAAATAGAAGAAGGTTGG - Intergenic
1134834300 16:17348114-17348136 CAGAGAAGAAAGGAGAGGGGTGG + Intronic
1134891030 16:17841988-17842010 GAGATGAGACAGAAGAGGGATGG + Intergenic
1134936100 16:18247336-18247358 CAGATAAAATAGAAGAAGGTTGG + Intergenic
1135160926 16:20095696-20095718 GAGAGAAGAGAGCAGAAGCAGGG + Intergenic
1135187636 16:20328872-20328894 TGGAGAAGCCAGAAGAGGGATGG - Intergenic
1135207867 16:20498568-20498590 CTGAGAAGAGACAAGAGGGATGG + Intergenic
1135211032 16:20525132-20525154 CTGAGAAGAGACAAGAGGGATGG - Intergenic
1135247395 16:20868796-20868818 AAGAAAAGGCAGAAGAAAGAAGG + Intronic
1135521513 16:23182187-23182209 AGGAAAAGAAAGAAGAAGGAAGG + Intergenic
1135678606 16:24438349-24438371 GAGAGAAGACTTAAGAGGGAGGG + Intergenic
1136083686 16:27869231-27869253 TGGAGAGAACAGAAGAAGGAGGG + Intronic
1136367125 16:29814019-29814041 CAGAGAGGAGAGGGGAAGGAAGG - Intronic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136539116 16:30918804-30918826 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1136539118 16:30918822-30918844 AGAAGAAGAAAGAAGAAGGAAGG - Intergenic
1136590164 16:31213867-31213889 CAGAAAAGACAGAAAATTGAAGG - Intergenic
1136618964 16:31415385-31415407 CAGAGAGGACATCAGAGGGAAGG - Intronic
1136648570 16:31645362-31645384 CAGAGGAGACTGAAGAATGAGGG + Intergenic
1136922739 16:34345578-34345600 CTGAGCAGACAGGAGTAGGAGGG + Intergenic
1136981834 16:35066228-35066250 CTGAGCAGACAGGAGTAGGAGGG - Intergenic
1137043871 16:35638835-35638857 CTGAGAAGACATAAGAAAAATGG + Intergenic
1137218731 16:46426858-46426880 AAGAAAAGAAAGAAAAAGGAAGG - Intergenic
1137362328 16:47829999-47830021 AGGAGAACACTGAAGAAGGATGG + Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137847160 16:51701990-51702012 AAGAGAGGAAAGAAGAAAGAAGG + Intergenic
1137943466 16:52711660-52711682 AAGAGAAGAGAAAGGAAGGAAGG + Intergenic
1138210288 16:55157540-55157562 GAAAGAAGCAAGAAGAAGGAAGG + Intergenic
1138210292 16:55157570-55157592 GAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1138470672 16:57233343-57233365 CAGAGATGAGAGAAGACTGAGGG - Intronic
1138748843 16:59394785-59394807 TAAAGCAGACAGAAGAAGGTGGG + Intergenic
1139054946 16:63171649-63171671 AAGAAAAGAAAGAAGAAAGAAGG + Intergenic
1139127989 16:64104635-64104657 CAGAGAGGAGGGGAGAAGGAAGG - Intergenic
1139131191 16:64148226-64148248 AAGAAAAGAAAGAAAAAGGAAGG - Intergenic
1139236578 16:65345825-65345847 CCTTGAAGACAGAAGAAGCATGG - Intergenic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1139760353 16:69180082-69180104 AAAAGAAGAAAGAGGAAGGAAGG - Intronic
1139870760 16:70107212-70107234 TAGAGGAGGAAGAAGAAGGAGGG + Intergenic
1139989610 16:70929407-70929429 CAGAGAAGACTGGAGCAGGAAGG + Intronic
1140002038 16:71035859-71035881 AAGAGAAGAAAGAGAAAGGAGGG + Intronic
1140328210 16:74026661-74026683 CAGAGAGGGCTGAGGAAGGAAGG + Intergenic
1140363597 16:74364882-74364904 CAGAGAACAAAGAAGATGGGGGG + Intergenic
1140480254 16:75258559-75258581 CAAAGCAGACAGCAGAGGGATGG + Intronic
1140602347 16:76492419-76492441 AAGAAAATACAAAAGAAGGATGG + Intronic
1140693126 16:77503862-77503884 CAGAGAAGAGGGAGGAGGGAAGG + Intergenic
1140945540 16:79764947-79764969 TGGAGGAGACAGAAGATGGATGG - Intergenic
1141082020 16:81061092-81061114 GAGAGAAGAAAGAGAAAGGATGG + Exonic
1141130820 16:81435297-81435319 CAAAGAAGAGAGAAGAAGGCAGG - Intergenic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141237648 16:82233568-82233590 TAGAGAAGACAGAAAGTGGAAGG - Intergenic
1141394390 16:83691751-83691773 GAAAGAAGACAGGAGATGGAAGG - Intronic
1141416906 16:83882756-83882778 AAGAGAAGACAGAGCAATGATGG + Intergenic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1142135018 16:88447948-88447970 AAAAAAAGAGAGAAGAAGGAAGG + Intergenic
1142718152 17:1758750-1758772 CAGAGAAGGCAGAAAAGGTAAGG + Intergenic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143021316 17:3918299-3918321 GAGGGAGGAAAGAAGAAGGAGGG + Intergenic
1143123263 17:4623545-4623567 AAGAAAAGAAAGAAGAAAGAAGG - Intergenic
1143364381 17:6396317-6396339 CAGAGAAGGAAGAAGGAGAAAGG + Intronic
1143699216 17:8645538-8645560 AAGATAATCCAGAAGAAGGATGG - Intergenic
1143706620 17:8702350-8702372 CAAAGAAGAAAGAAAGAGGAAGG - Intergenic
1143743254 17:8969706-8969728 CAGAGAGGACAGAGAGAGGAAGG - Intergenic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1143974752 17:10821600-10821622 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1143981936 17:10877575-10877597 CAGAAAAGAGAGAAGAATTAGGG + Intergenic
1143984031 17:10895721-10895743 CAGAGAAGGCAAGAGAAGAAAGG - Intergenic
1144008931 17:11126876-11126898 AAGAGAGGAAGGAAGAAGGAAGG + Intergenic
1144044300 17:11440995-11441017 ATGAGAAGAGAGAGGAAGGAAGG + Intronic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144278080 17:13695942-13695964 TAGAGAAGGCAGAAGAAGAGTGG - Intergenic
1144352926 17:14415976-14415998 CAGAGAAAAAGAAAGAAGGAAGG - Intergenic
1144423375 17:15118143-15118165 AAGAGAAGGCAGAGGAAGTAGGG - Intergenic
1144442164 17:15293275-15293297 CTGAGAAGATGGAAGAAGGAAGG - Intergenic
1144453378 17:15399487-15399509 CAGAGAAAACAGAAGATGCTTGG + Intergenic
1144628225 17:16856424-16856446 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145159817 17:20566991-20567013 CAGAAAAGACAGACGGAGCAAGG + Intergenic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1146011429 17:29197530-29197552 CAGACAACAAAGAAGATGGAGGG + Intergenic
1146741258 17:35285736-35285758 CAGAGCAGGCTGGAGAAGGATGG - Intergenic
1146942182 17:36850926-36850948 CAGAGAAGACCCAGAAAGGAAGG + Intergenic
1147341860 17:39757055-39757077 CACAGAAGACGGAAAATGGAGGG + Intergenic
1147414466 17:40278580-40278602 CACAGTGGACAGGAGAAGGAAGG - Exonic
1147559368 17:41499568-41499590 GAGAGAGGAGAGAAGAAGGTTGG + Intergenic
1147606214 17:41775234-41775256 CACAACAGACAGAAGAAGGCTGG + Intronic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1147955734 17:44133298-44133320 CAGAGGAGTCAGGGGAAGGAGGG - Intergenic
1148180709 17:45602580-45602602 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1148226856 17:45905025-45905047 AAGACAAGACAGAAAACGGATGG - Intronic
1148268194 17:46243346-46243368 AAGAAAAGAAAGAAGAAGGAAGG + Intergenic
1148336400 17:46844822-46844844 GAAAGAAGAAAGAGGAAGGAAGG - Intronic
1148387351 17:47243863-47243885 GAGAGAAGAAAGAGAAAGGAAGG - Intergenic
1148514630 17:48204947-48204969 AAGAAAAGAAAGAGGAAGGAGGG - Intronic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148789050 17:50162964-50162986 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1148789058 17:50162994-50163016 GAGAGAAGGAAGAAGAAGGAGGG + Intergenic
1149080203 17:52647077-52647099 TAGAGAAGACAAAATAAGGGAGG - Intergenic
1149107114 17:52982680-52982702 GAGGGAAGAAGGAAGAAGGAAGG - Intergenic
1149662465 17:58341996-58342018 AAGAAAAGAAAGAAAAAGGAAGG + Intergenic
1149987741 17:61360527-61360549 GTGAGAAGCCAGAAGAAGCAAGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150235957 17:63592902-63592924 AAGAGAAAAGAGAAAAAGGAGGG - Exonic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150637999 17:66929756-66929778 AAGAGGAGAGAGAGGAAGGAGGG + Intergenic
1150764775 17:67994068-67994090 CCGAGAAGGAAGAAGAGGGAAGG + Intergenic
1151045984 17:70919865-70919887 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
1151052641 17:70995863-70995885 GAGGGAAGATGGAAGAAGGAAGG - Intergenic
1151484526 17:74390059-74390081 AAGAGAAGAGAGACGAAGGAAGG - Intergenic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1152246145 17:79185529-79185551 CAGAGAAGACAAAAGAGGGATGG - Intronic
1152368866 17:79872571-79872593 GAGAGAAGAGAGGAGAGGGAAGG - Intergenic
1152416989 17:80169116-80169138 CAGAGAAGATGGAACAGGGAAGG + Intergenic
1152818785 17:82425052-82425074 CAGAGAAGGCTGGAGAAGGCTGG + Intronic
1152818804 17:82425127-82425149 CAGAGAAGGCTGGAGAAGGCTGG + Intronic
1153060658 18:991569-991591 CAGGGAAGGAGGAAGAAGGAAGG - Intergenic
1153098645 18:1438668-1438690 TGGAGAAGCCAGAAGAAGGATGG + Intergenic
1153119049 18:1699248-1699270 CAGAGAAGGCAGAAAACGGTGGG - Intergenic
1153276131 18:3369438-3369460 AAGAAAAGAAAGAAGAAAGAAGG + Intergenic
1153495868 18:5698974-5698996 AAAAGAAGACAGAGAAAGGATGG - Intergenic
1153568203 18:6441863-6441885 AAGGAAAGAAAGAAGAAGGAAGG - Intergenic
1153716546 18:7855470-7855492 CAAAGAAGGAAGAAGAAAGAAGG + Intronic
1153847807 18:9065522-9065544 AATAGAAGACAAAAGGAGGAAGG - Intergenic
1154334936 18:13457558-13457580 CAGAAAGGACAGGAGAAGGTTGG + Intronic
1155329834 18:24703874-24703896 GAAAGAAGAGAGAAGAAAGAAGG - Intergenic
1155405582 18:25483407-25483429 TAGAAAGGACGGAAGAAGGAAGG - Intergenic
1155509319 18:26561387-26561409 CAGAGATGACAGCACATGGACGG - Intronic
1155679569 18:28473411-28473433 TAGAGAAGACAGAAAAATGTGGG + Intergenic
1155692588 18:28644084-28644106 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1155724457 18:29062284-29062306 CAGAGAAGAAAAGGGAAGGAAGG - Intergenic
1156352188 18:36311105-36311127 CAAAGAAGAAAGGAGATGGATGG + Intronic
1156440464 18:37182039-37182061 TGGAGAAGACACAACAAGGAAGG - Intronic
1156501034 18:37558501-37558523 CAGAGAAGACAGAAAAGGAGAGG + Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1156749080 18:40428593-40428615 CAGTGATGACAGAAGATGGTAGG + Intergenic
1156843805 18:41639477-41639499 GAAAGAAGAAAGAAGAGGGAGGG + Intergenic
1156908683 18:42385064-42385086 GAGGGAAGAAAGAGGAAGGAAGG - Intergenic
1157071252 18:44411295-44411317 AAGAAAAGAAAGAAGAAGAAAGG + Intergenic
1157180809 18:45496458-45496480 CAAAGCAGGCAGAAGAAGGTGGG + Intronic
1157319749 18:46624812-46624834 GAGAAAAGACAGAAGAAGAAAGG - Intronic
1157388136 18:47277503-47277525 TAGAGCAGACAGAAGAAACAAGG - Intergenic
1157611158 18:48956643-48956665 AAAAGAAGACAGTACAAGGAAGG + Intergenic
1157778378 18:50416422-50416444 CAGAGAAGTCAGAAAAAGAAGGG - Intergenic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158296241 18:55999949-55999971 CACAGAAGAGAGAAGAGGCAAGG - Intergenic
1158305735 18:56103382-56103404 GAGAGAGGTCAGAGGAAGGAGGG + Intergenic
1158309654 18:56144594-56144616 CCTAGAAGACAGGAGAAGAATGG - Intergenic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158581549 18:58688693-58688715 GAGATAAGAGACAAGAAGGATGG - Intronic
1158632860 18:59131574-59131596 CAAAGCAGAATGAAGAAGGATGG + Intergenic
1158924489 18:62240235-62240257 TAGAAACGACTGAAGAAGGAAGG - Intronic
1159450348 18:68593590-68593612 AAAAGAAGAAAGAAGAAGAAAGG - Intergenic
1159625646 18:70691072-70691094 CAGAGAAGACAGAACAATACTGG + Intergenic
1159686487 18:71427682-71427704 CACAGAAGAGAGAAGCTGGAAGG + Intergenic
1159798697 18:72870489-72870511 CAAAGAGGACAGAAGAGGGCAGG - Intergenic
1159817295 18:73091164-73091186 CAGAGAATAAAGAAGAAAAAAGG - Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1160018115 18:75159305-75159327 CTGAGGCGGCAGAAGAAGGAGGG + Intergenic
1160064817 18:75564837-75564859 AAGAGAACACAGAAGAAACAAGG - Intergenic
1160092236 18:75838412-75838434 CACAGAAGAAAGACGAAGGTTGG - Intergenic
1160269903 18:77374038-77374060 CAGAGAAAAAGAAAGAAGGAAGG + Intergenic
1160322427 18:77908476-77908498 TAGAGAAGACAGAACAAGTAAGG + Intergenic
1160469961 18:79121856-79121878 TAGAGAAGACAGAATAAAGAGGG - Intronic
1160616336 18:80132583-80132605 AAGAGAAAAGAGAGGAAGGAAGG - Intronic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161529415 19:4778424-4778446 AAGAAAAGAAAAAAGAAGGAAGG - Intergenic
1161800922 19:6416397-6416419 CAGAGAGGACCCTAGAAGGAAGG + Exonic
1161814324 19:6490303-6490325 GAGAGAAGAGGGAGGAAGGAAGG - Intergenic
1161989220 19:7674834-7674856 AAAAGAAGAAAGAAGAAAGAAGG - Intergenic
1162248038 19:9419250-9419272 AAGAAAAGACAGAAGTAGAAAGG - Exonic
1162280116 19:9689589-9689611 CAGAGAAGACAGAACAGGTAAGG + Intergenic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162581623 19:11534802-11534824 GAAAGAAGAAAGAAGAAAGAAGG + Intergenic
1162615076 19:11793089-11793111 GAAAGAAGAGAGAGGAAGGAAGG + Intergenic
1162877808 19:13633867-13633889 GAAAAGAGACAGAAGAAGGAAGG - Intergenic
1162984082 19:14258229-14258251 AAAAGAAGAAAGAAGAAGAAAGG - Intergenic
1163010489 19:14422471-14422493 TAAAGAAGAAAGAGGAAGGAAGG + Intergenic
1163043098 19:14617214-14617236 AAGAGAAAAGAAAAGAAGGAAGG - Intergenic
1163130723 19:15271173-15271195 AGGTGAAGACAGGAGAAGGAAGG - Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163204904 19:15795212-15795234 CAGAGAAGAAGGAAGGGGGAGGG - Intergenic
1163214775 19:15868366-15868388 GAGAGAAGAAAGAAAAAGAAAGG + Intergenic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1163703193 19:18797121-18797143 CAGGGAGGAGGGAAGAAGGAAGG - Intergenic
1163845663 19:19637030-19637052 CTGAGAAGACAGAAGTTTGAAGG + Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1164787421 19:30944639-30944661 CAAAGAAAAGAAAAGAAGGAAGG + Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165423996 19:35735752-35735774 CAGCGAAGGCAAAAGAAGAATGG - Intronic
1166139899 19:40800036-40800058 AACCAAAGACAGAAGAAGGAGGG - Exonic
1166184655 19:41132087-41132109 AAGAGAAGAGAGAAGAAGAAAGG + Intergenic
1166458463 19:42965056-42965078 CAGAGAAGACATTGGAAGTAGGG - Intronic
1166475410 19:43120311-43120333 CAGAGGAGACATTAGAAGTAGGG - Intronic
1166871828 19:45875924-45875946 AAGAAAAGAGGGAAGAAGGAAGG - Intergenic
1166935490 19:46329995-46330017 GAGTGAAGAGAGAGGAAGGAAGG + Intronic
1167200157 19:48059563-48059585 CAAAGCAGACAGAAGAAGGTGGG + Intronic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167276067 19:48540383-48540405 CAGAGGAGACAGCACAAGTAAGG - Intergenic
1167641494 19:50685100-50685122 CAGAGAAGAAGGAAGCGGGAAGG + Intronic
1167684129 19:50944947-50944969 AAGAAAAGAGAGAGGAAGGAAGG - Intronic
1167720209 19:51174174-51174196 CATAGAGGACTGAAGAGGGAAGG + Intergenic
1168009354 19:53518138-53518160 CACAGAAGGCAGAAGAAGGTGGG + Intergenic
1168087660 19:54060265-54060287 AACAGAACACAGAAGAGGGAGGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168356953 19:55706615-55706637 CAGGAAAGAGAGAAAAAGGAGGG + Intronic
925208955 2:2031356-2031378 CAGAGCAGATTGTAGAAGGAGGG + Intronic
925209181 2:2032512-2032534 CAGAGAAGATTCTAGAAGGAGGG + Intronic
925209195 2:2032576-2032598 CAGAGAAGATTCTAGAAGGAGGG + Intronic
925408304 2:3623486-3623508 CAGAGAAGAGAAAAGAAAAAAGG - Intronic
925496256 2:4452712-4452734 GAGAGAAGAAAGAAAAAAGAAGG - Intergenic
925592396 2:5523267-5523289 GAGAAAAGAGAGAAGTAGGAAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925732927 2:6935091-6935113 CAGAGAAGAAGGAAGAGGGATGG - Intronic
925740095 2:6997751-6997773 CATAGAAGCCGGAAGTAGGACGG + Intronic
926188897 2:10712557-10712579 CAGAGAGCACAGATGAAGGGCGG + Intergenic
926262515 2:11279087-11279109 CAAAAAAGACAGAAAAAGAATGG + Intronic
926354878 2:12032471-12032493 CAGAGATGAAAGAAAAGGGAGGG + Intergenic
926421195 2:12701581-12701603 CAGAGAAGAGCAAAGAAGAAGGG - Intergenic
926566147 2:14476615-14476637 GAGAGCAGACAGAGGAAGAAAGG - Intergenic
926805895 2:16710725-16710747 AAGAGTAGAAAGAAGAATGATGG + Intergenic
926897439 2:17709711-17709733 CAGAGAATAAAGAAAAAGAAGGG + Intronic
926957831 2:18320966-18320988 GAGAGAACACAAAAGAAGCATGG - Intronic
927169533 2:20357337-20357359 GATAGAAGGCAGAAGAAGGCCGG + Intergenic
927225350 2:20759716-20759738 CAGAGAAGACATAACAGGGAGGG - Intronic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927392978 2:22616314-22616336 CAGAGCAGATTGGAGAAGGATGG + Intergenic
927438836 2:23094781-23094803 CAGATAAGAGAGAGGAAAGAAGG + Intergenic
927454573 2:23238410-23238432 CAGATAAGAAAGAGCAAGGAAGG - Intergenic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
928081302 2:28314963-28314985 AAGAAAAGAGAAAAGAAGGAAGG + Intronic
928177515 2:29044980-29045002 GATAGATGACAGAAGATGGATGG - Intronic
928194503 2:29205583-29205605 ACCAGAAGCCAGAAGAAGGAGGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928773894 2:34735649-34735671 CAAAGAAGAAGGAAGAAGAAAGG + Intergenic
928903904 2:36351392-36351414 CAGAGAAGACAGATTCAGAAAGG + Intergenic
928963664 2:36955560-36955582 GAGAAGAGACAGAAGAAGGGAGG - Intronic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929113914 2:38428488-38428510 AAGAAAAAATAGAAGAAGGAGGG - Intergenic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929609277 2:43257917-43257939 CAGAGAAGCCAGTGGGAGGAAGG + Intronic
929675374 2:43921604-43921626 CAGAGAAGACATGGAAAGGATGG + Intronic
929680913 2:43992790-43992812 AACAGATGAAAGAAGAAGGAGGG + Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
929885746 2:45876301-45876323 CAGAGAAGCCAGATGACAGAGGG - Intronic
929960690 2:46494076-46494098 CAGAGAGGGGAGGAGAAGGAGGG + Intronic
930152693 2:48074762-48074784 CAGAGGAGAAAGAGAAAGGATGG - Intergenic
930225685 2:48790198-48790220 CACAGCAGATGGAAGAAGGAAGG + Intergenic
930354058 2:50294916-50294938 CAGACGAGACAGAATAAAGAGGG + Intronic
930877427 2:56234635-56234657 CAGAGAAGAAAAAAAAAGGTAGG - Intronic
930878729 2:56248448-56248470 CAGAGAAGACAGCACAGGAAGGG - Intronic
931665750 2:64608885-64608907 AAAAAAAGACAGAAGAAGGAAGG + Intergenic
931866773 2:66421343-66421365 CCAAGAAGACAGAAGTAGGATGG + Intergenic
932501928 2:72190022-72190044 GAAAAAAGAGAGAAGAAGGAAGG - Intronic
932578814 2:72980120-72980142 GAGAGAAGAGAGAAGAGGGGAGG - Intronic
932857629 2:75253873-75253895 TAGAAAAGACAGAAGAAGGTTGG - Intergenic
932995171 2:76843195-76843217 CAGAGAAGAGAGAGGAAACAAGG + Intronic
933109529 2:78379395-78379417 AAGAGAAGAGAAGAGAAGGAAGG + Intergenic
933120896 2:78536807-78536829 AAGAGAAGAGAAAGGAAGGAAGG + Intergenic
933799669 2:85950652-85950674 CAGAGAAGCCAGGAGAGGAAGGG - Intergenic
933801369 2:85962814-85962836 GAGAGAAGAAAGAAAAAGAAAGG - Intergenic
933855708 2:86412256-86412278 GGGAGAAGAAGGAAGAAGGAGGG - Intergenic
933882652 2:86686128-86686150 CAGAGAAGGCAGAAAAAGAGTGG - Intronic
934982281 2:98852931-98852953 AAAAGGAGAGAGAAGAAGGAAGG + Intronic
935231179 2:101098056-101098078 CAGAGAAGGCAGAAAAAGAAAGG + Intronic
935248156 2:101237257-101237279 AAAAGAAGAAGGAAGAAGGAAGG + Intronic
935867577 2:107407590-107407612 CAGAGGTGACAGAGGAAGAAAGG - Intergenic
935903567 2:107818368-107818390 AGGAGAAGAAAGGAGAAGGAAGG - Intergenic
935921042 2:108015436-108015458 AAGAGAATACAGTAGAAGGATGG + Intergenic
936231797 2:110708778-110708800 AATAGAAGACAGAAAAATGATGG - Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936263604 2:110982430-110982452 AAGGGATGACAGAAGAAGAAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
936660559 2:114538260-114538282 CAGAGAAGAAAGAAGAGGAAAGG + Intronic
936731666 2:115388502-115388524 CAGTGGAGATAGAAGAGGGATGG + Intronic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936914148 2:117622956-117622978 GAGAGGAGAGAGAGGAAGGAAGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937132761 2:119525331-119525353 AGGAGGAGAGAGAAGAAGGAAGG - Intergenic
937227251 2:120377064-120377086 CAGAGAGAACAGAAGAGGAAAGG - Intergenic
937868298 2:126770141-126770163 AAGAGAAGGCAGAGGAGGGATGG - Intergenic
938029826 2:127982525-127982547 CAGTGAAGACGGAAGAAGCCTGG + Intronic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938055779 2:128213617-128213639 GGGAGAAGACAGAAGACGGCTGG + Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938372752 2:130782841-130782863 CAGAGAAGGCAGAAAAGAGAAGG + Intergenic
938411053 2:131064798-131064820 CAGATAAGAGAGAGGAAGGGAGG + Intronic
938872464 2:135494322-135494344 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
938919589 2:135982780-135982802 CAGAGAAGATGTAAGATGGAAGG + Intronic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
939030221 2:137065619-137065641 CAGAGAGGACAGAGGAAGAGAGG - Intronic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939197268 2:138988516-138988538 CAAAAAAGAAAGAAGAAAGAAGG - Intergenic
939361423 2:141177177-141177199 CATAGGAGTCACAAGAAGGAAGG + Intronic
940164055 2:150748393-150748415 AAAAGAAGAAAGAGGAAGGAAGG - Intergenic
940728079 2:157358185-157358207 CAGAGAAGTGAGAAAAAGGATGG + Intergenic
940742955 2:157532821-157532843 CAGAAAAGGAAGAGGAAGGAAGG - Exonic
940940273 2:159551624-159551646 CAGAGAAGACAGAGGATTAAGGG + Intronic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941451601 2:165666653-165666675 AAGAAAAGAGAGAGGAAGGAAGG + Intronic
942013655 2:171789607-171789629 CCGAAAAGACAAAGGAAGGAAGG + Intronic
942013750 2:171790343-171790365 CTGAAAAGACAAAGGAAGGAAGG - Intronic
942415384 2:175753201-175753223 AAGAGGAGAAAGAAGAAGAAGGG - Intergenic
942543023 2:177034460-177034482 GAGGGAAGAGAGAAGACGGAAGG + Intergenic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
942879791 2:180845352-180845374 GAAAAAAGACAGAAGAAAGAGGG + Intergenic
943003417 2:182358986-182359008 AAGAAAGGACAGAGGAAGGAAGG - Intronic
943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG + Intronic
943046252 2:182865914-182865936 AAAAGAAGAAAGAAGAAGAAGGG + Intronic
943252415 2:185544287-185544309 CAAAGAAGATAGAATAATGATGG + Intergenic
943375867 2:187075991-187076013 AAAAGAAGACAGAAGACAGAAGG + Intergenic
943807370 2:192138688-192138710 GATTGAAGACAGAACAAGGAAGG + Intronic
944046699 2:195419951-195419973 CAGAGGAGACAGGATAATGATGG - Intergenic
944096879 2:195977446-195977468 CAGAGGAGACAAAAGAAAAAGGG + Intronic
944121070 2:196241461-196241483 GAGAGAGGACAGAGGAGGGACGG - Intronic
944156026 2:196608829-196608851 CTTATAAGACAGAAGAAAGAGGG - Intergenic
944358063 2:198816915-198816937 CTAAGAAGAAAGAATAAGGAAGG - Intergenic
944364277 2:198898264-198898286 AAGAAAAGAGAGAAGAAGGAAGG + Intergenic
944374533 2:199026576-199026598 CCCTGAACACAGAAGAAGGAGGG - Intergenic
944392944 2:199238056-199238078 CAAAAAAGACAGAAAAAGAAAGG - Intergenic
944536316 2:200713803-200713825 CAGAGAGGACCAAAGGAGGAAGG - Intergenic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
944803483 2:203259021-203259043 CAGAGAAGACAAAATAATTAAGG - Intronic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945397443 2:209337419-209337441 GAAAAAAGAAAGAAGAAGGAAGG - Intergenic
945892264 2:215442615-215442637 CACTGAAGCCAGAACAAGGAGGG - Intergenic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946135124 2:217639666-217639688 GAGAGAGGAAAGGAGAAGGAAGG + Intronic
946165912 2:217863770-217863792 CAGTCAGGACAGGAGAAGGAAGG + Intronic
946189601 2:218001479-218001501 CAGGGGTGACACAAGAAGGATGG - Intronic
946226299 2:218265759-218265781 CAGTGAAGACCCAGGAAGGAAGG + Intronic
946252380 2:218421521-218421543 CAGGGAAGACAGGAGAAGTGAGG + Intronic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
946566762 2:220974126-220974148 GAAAGAAAACAAAAGAAGGAGGG + Intergenic
946718797 2:222582230-222582252 CAGAGAAGTCAAAAGAAAGGAGG + Intronic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
947219354 2:227777930-227777952 GAGGGAAGAGAAAAGAAGGAAGG - Intergenic
947322445 2:228937009-228937031 TAGAGAAGAAACAATAAGGATGG + Intronic
947382141 2:229554928-229554950 AAGAGAAGAGAGAAAAGGGAAGG + Intronic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
947502169 2:230679107-230679129 CAAAGAATAAAGAAGAAGGTAGG + Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947654678 2:231816873-231816895 CAGAGGAGATGGAAAAAGGATGG - Intergenic
947871001 2:233437971-233437993 AAGAGAAGACAGCAGAAAGGTGG + Intronic
947909527 2:233791995-233792017 AAGAGCAGACGGATGAAGGAAGG - Intronic
948038459 2:234879233-234879255 GAGAGGAGACAGGAGAAGGGTGG + Intergenic
948101527 2:235377981-235378003 GAGAGAAGAGAGAAGGACGAGGG - Intergenic
948219811 2:236260628-236260650 CAGAGAAGCATGGAGAAGGAGGG + Intronic
948331654 2:237171766-237171788 CAGAGAAGAAAGTAAAAGCAGGG - Intergenic
948436519 2:237957367-237957389 GAGAGAGGAAGGAAGAAGGAAGG - Intergenic
948960871 2:241335805-241335827 CAGAGAAGTCAGAAAGGGGAAGG - Intronic
1168826996 20:820489-820511 AAGAGAAGAAAGAAAAAGAAAGG - Intergenic
1169043339 20:2515020-2515042 AGAAGAAGAAAGAAGAAGGAAGG + Intronic
1169321497 20:4636630-4636652 AAGAGAAGAGAAAAGAAGGGAGG + Intergenic
1169431143 20:5537616-5537638 AAGAGAAGAAAGATGAAAGAAGG + Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1169732094 20:8797487-8797509 CAGTAAAGAAAGACGAAGGATGG - Intronic
1170079302 20:12454076-12454098 CAGAGAAGAGAGATCCAGGAGGG - Intergenic
1170130693 20:13016187-13016209 AAGAGAAGTCAGAAAAGGGAAGG + Intronic
1170140337 20:13119640-13119662 AAGAGAAGACAGAGAAAGGTGGG - Intronic
1170227438 20:14007368-14007390 CAGAGAAGAGGAGAGAAGGAAGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170626246 20:18032351-18032373 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
1170751355 20:19149364-19149386 CAGAGAAGGCAGAAAAAGAGTGG + Intergenic
1171136747 20:22701531-22701553 GAGACAAGAAAGAGGAAGGAAGG - Intergenic
1171173166 20:23033570-23033592 CAGAGAGGACAGCAGAAGAGAGG + Intergenic
1171415718 20:24979306-24979328 CAGAGAAGATGGAAGGAGCAAGG + Intronic
1171465684 20:25326144-25326166 AAGAGAAGAGAGAGGAAGGAAGG + Intronic
1171985615 20:31658906-31658928 CAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172896728 20:38305256-38305278 CACAGAAGACAGAAGAGCTAGGG + Intronic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173239048 20:41277078-41277100 CAGACAAGACAGCATGAGGAAGG + Intronic
1173350060 20:42236713-42236735 TAGAGGAGACAGAAGAAGTTTGG - Intronic
1173363692 20:42366550-42366572 CAGATGGGACAGAAGAAGAACGG - Intronic
1173722579 20:45272519-45272541 CAGAGGAGACAGAACCAGGTTGG - Intergenic
1174013428 20:47469188-47469210 CAGAGAAAACAACAGAGGGAGGG + Intergenic
1174178435 20:48659314-48659336 GAAAGAAGAGAGAGGAAGGAAGG + Intronic
1174191352 20:48742879-48742901 CAGAGAAGCCAAAGGAATGAGGG + Intronic
1174218214 20:48933287-48933309 CAACGATGACAGAAGGAGGACGG - Intronic
1174288397 20:49488860-49488882 TAGAGCAGGCAGAAGAAGGTGGG + Intergenic
1174396425 20:50249887-50249909 TAGAGAAGCCGGAAGCAGGAGGG - Intergenic
1174809841 20:53636287-53636309 GAGAGAGGAAAGAAGAAGGAAGG + Intergenic
1175196501 20:57247286-57247308 CAAAGAAGACAGAAGAAATTGGG - Intronic
1175432467 20:58915657-58915679 CTAAAAAGACAGAAGAAGGAAGG - Intergenic
1175889337 20:62309485-62309507 CAGGGAAGATGGAAGAAGGCTGG + Intronic
1176160386 20:63644609-63644631 CACAGCAGGCAGGAGAAGGATGG - Intronic
1176546506 21:8204488-8204510 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176554400 21:8248679-8248701 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176565457 21:8387535-8387557 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176573322 21:8431703-8431725 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1176916490 21:14631932-14631954 AAGAGAAGTAGGAAGAAGGAAGG + Intronic
1176920605 21:14683603-14683625 AAGAGAGGAGAGAAGAAGGAAGG + Intergenic
1176936814 21:14876864-14876886 CAAAGAAGAAGGAAGAAGAAGGG - Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1177753890 21:25321401-25321423 AAGAGAAGAAAGGAGAAGAAAGG + Intergenic
1177763077 21:25424845-25424867 CAGAGAAGCCTGAAGAAGCTGGG + Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1177833473 21:26166292-26166314 CACAGAAGACAGAAGGTGGCAGG - Intronic
1178016137 21:28347669-28347691 GAGAAAGGACAGAGGAAGGAAGG - Intergenic
1178070343 21:28958430-28958452 CAGAGCAGACAAATGTAGGAAGG + Exonic
1178071564 21:28973900-28973922 CAAAGATGTCAGAATAAGGATGG + Intronic
1178145030 21:29729303-29729325 CAGAAAAGTCAAAAAAAGGAAGG + Intronic
1178259475 21:31085600-31085622 CAGAGAAAAAGAAAGAAGGAAGG + Intergenic
1178369808 21:32018027-32018049 CAGAGAAGACAGCAGATGCGCGG - Intronic
1178505271 21:33157458-33157480 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
1178562921 21:33655968-33655990 GAGAGAAGGAAGAAAAAGGAAGG + Intronic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1178778756 21:35578899-35578921 GAGAGAAGAGAGAGGAAGGGAGG + Intronic
1178791575 21:35705119-35705141 GAGAGAGGAAGGAAGAAGGAAGG + Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179227815 21:39471089-39471111 CAGAATGGACAGAAGAAGAAAGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1179669294 21:42934584-42934606 CAGCTAAGACAGAAGAAAGATGG + Intergenic
1179730989 21:43367377-43367399 CAGAGAAGCCAGAAGAGGCAAGG + Intergenic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1179812003 21:43877829-43877851 CAGTGGAGACAGAAGATAGAGGG - Intronic
1180009771 21:45041587-45041609 CTCAGAAGACAGAAGAAGACGGG + Intergenic
1180150743 21:45946019-45946041 TACAGAAGGCAGAAGCAGGAGGG - Intergenic
1180223119 21:46372466-46372488 CCCAGAACACAGAAGCAGGAGGG - Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180729280 22:17969535-17969557 CAGGGAAGAAGGAAGAAGGAAGG - Intronic
1180798613 22:18620595-18620617 CAGAGAATGGAGTAGAAGGAAGG + Intergenic
1180886044 22:19244649-19244671 CAGAGAAGACAGAACAGCCAAGG + Intronic
1181223103 22:21374669-21374691 CAGAGAATGGAGTAGAAGGAAGG - Intergenic
1181255635 22:21560965-21560987 CAGAGAATGGAGTAGAAGGAAGG + Intronic
1181671925 22:24429608-24429630 CAGAGAGCACAGCAGCAGGAAGG - Intronic
1181975500 22:26726467-26726489 CAAAGAACACAGACAAAGGAGGG + Intergenic
1181999052 22:26905182-26905204 TAGAGAAGAGAGGAGAAAGACGG + Intergenic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182043655 22:27257952-27257974 GAATGAAGACAGGAGAAGGAGGG - Intergenic
1182083206 22:27543604-27543626 CAGGGAAGAAAGAGGAAGGGAGG - Intergenic
1182342317 22:29633377-29633399 CAGAGGAGACAGAATTAAGAGGG - Intronic
1182741729 22:32572561-32572583 GAGAGAAGAGAAGAGAAGGAAGG - Intronic
1183033203 22:35120894-35120916 CAGTGAGGAGAGCAGAAGGAGGG + Intergenic
1183048619 22:35242018-35242040 CAGAGAAGACAGTATAAAAAAGG - Intergenic
1183728264 22:39601532-39601554 CAGAGGAGAGAGAAAAAGGCTGG + Intronic
1183860946 22:40669486-40669508 CAGAGAAGACCCAAGACAGAGGG + Intergenic
1183879718 22:40817316-40817338 CAAAGGAGACAAACGAAGGATGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184226275 22:43130371-43130393 GAGAGAAGACATAAGGAGGCAGG - Intergenic
1184846208 22:47089063-47089085 CAGAGAAGCAAGAAAGAGGAGGG + Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1184992912 22:48182760-48182782 CAGAGAAGACGCAGGAACGACGG + Intergenic
1185039141 22:48495557-48495579 CAGGGAAGGGAGAACAAGGATGG - Intronic
1185220213 22:49625687-49625709 CAGAGAAGGCAGAAAAAGAATGG + Intronic
1185354270 22:50357404-50357426 AAGAAAAGAAAGAAGAGGGATGG - Intronic
1203251369 22_KI270733v1_random:120750-120772 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1203259415 22_KI270733v1_random:165824-165846 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
949195188 3:1296904-1296926 TAGAGGGGATAGAAGAAGGAAGG - Intronic
949541738 3:5037911-5037933 CAGAGAAGTCAAAAAAAAGAAGG + Intergenic
949798522 3:7877897-7877919 CAGAGAAGAAACAAGAGGGCTGG + Intergenic
949881600 3:8665284-8665306 GAGAGAAGAAAGGAGAAGCAAGG + Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
950823140 3:15784576-15784598 CACAGAAGGCAGAAGAAGAATGG + Intronic
951035161 3:17925046-17925068 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
951158842 3:19390418-19390440 CAGAGAAGAATAAAGAAGGTAGG - Intronic
951431946 3:22618394-22618416 AAGAGGAAAGAGAAGAAGGAAGG + Intergenic
952042793 3:29280671-29280693 AAGAGAGGACGAAAGAAGGAAGG - Intergenic
952145572 3:30528295-30528317 CTGAGATGAGAGAAGAAGCATGG - Intergenic
952433297 3:33247125-33247147 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
952441482 3:33334758-33334780 TTAAGACGACAGAAGAAGGAAGG + Intronic
952559486 3:34573970-34573992 GAAAGAAGAAAGAAGGAGGAAGG - Intergenic
952559488 3:34573977-34573999 CGAAGAAGAAAGAAGAAAGAAGG - Intergenic
952748974 3:36809062-36809084 CAGAGAAGACTGAACAAAGAAGG + Intergenic
952832556 3:37577108-37577130 CAGGGAAGACAGAAAGATGAGGG + Intronic
953115985 3:39992924-39992946 GAAAGAAGACAGAACAAGAAGGG - Intronic
953557090 3:43954671-43954693 CAGAGAAGGCAGAAAAAGAGGGG + Intergenic
953557338 3:43956913-43956935 CAGAGAAGAATGAAGGAGCAGGG + Intergenic
953783976 3:45896770-45896792 AAGAGAGGGCACAAGAAGGAGGG - Intronic
953811920 3:46120093-46120115 GAGAGAAGGCTGAAGGAGGAAGG + Intergenic
953853326 3:46482467-46482489 CAAAAAAGAAAGGAGAAGGAAGG + Intronic
954220959 3:49153663-49153685 CAGGGATGACAGTAGAAGAAGGG + Intergenic
954363137 3:50133001-50133023 CAGAGAAGAAAGAAGAAACGAGG - Intergenic
954390739 3:50266893-50266915 AAGAGAAGCCAGAGGAAGGGAGG + Intergenic
954410475 3:50368418-50368440 CAGAGCTGACACAAGAATGAGGG + Intronic
954558177 3:51534642-51534664 CTGAGAAGTCAGAAGAGCGATGG - Intergenic
954596223 3:51827286-51827308 TAGAGAGGAGAGCAGAAGGATGG + Exonic
955035641 3:55264571-55264593 ATGAGGAGAGAGAAGAAGGAGGG + Intergenic
955086609 3:55708913-55708935 AAGAGAAGAGAGAAAAAGAAAGG + Intronic
955149425 3:56352366-56352388 CAAAGAAGACAAAAGAAGAATGG + Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955795727 3:62634886-62634908 CAGATAAGTGAGATGAAGGAAGG + Intronic
955929682 3:64044212-64044234 CATAGAATAAAGAACAAGGAAGG - Intergenic
956040313 3:65138560-65138582 AAGAGAAGAAAGAAAAGGGAAGG - Intergenic
956624108 3:71249779-71249801 GGGAGAAGACAGAAGAATAAAGG + Intronic
956734617 3:72228613-72228635 TAGAGAACAGGGAAGAAGGAAGG + Intergenic
956859291 3:73306612-73306634 CAGAGAAGACAGAGGACAGTGGG + Intergenic
956860550 3:73319540-73319562 CAGAAAAGACAGTAGAAGAAGGG + Intergenic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
956971532 3:74532008-74532030 CAGAAAAAACAGGAGAAGGAGGG + Intergenic
956971538 3:74532042-74532064 GAGAGAGGAAAGAGGAAGGAAGG + Intergenic
956972051 3:74537640-74537662 TAGGGAAGGCAGAGGAAGGATGG + Intergenic
957146591 3:76432834-76432856 GAGAGAAAAAAGAGGAAGGAAGG + Intronic
957495847 3:80990648-80990670 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
957532641 3:81460291-81460313 AAGAAAAGAAAAAAGAAGGAAGG - Intergenic
957537324 3:81523672-81523694 GAGATAAGAGAGTAGAAGGATGG - Intronic
957646129 3:82930935-82930957 CATGGAAGACAGAAGAAAGTGGG + Intergenic
957894427 3:86403095-86403117 GAGAGAAGAGACAAGAGGGAGGG - Intergenic
957944021 3:87038888-87038910 TGGAGAAGACAGAGGAATGATGG - Intergenic
957979830 3:87494464-87494486 AAGAGAAGAGAAAGGAAGGAAGG + Intergenic
958415622 3:93869486-93869508 CACAGAAGACAGGAGAGGCAAGG + Intergenic
958503853 3:94947338-94947360 CACAGAAGAAAGATGAAGGCTGG + Intergenic
958523547 3:95223169-95223191 CAGAGAAGAGAGAAAAATAAAGG - Intergenic
958548079 3:95582074-95582096 AAGAGAGGACAGAAGAAGAGAGG + Intergenic
958699933 3:97575877-97575899 TAGTGAAGATAGAAGAAAGAGGG + Intronic
958842205 3:99220251-99220273 AAGAAAGGAAAGAAGAAGGAAGG + Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
958869188 3:99537233-99537255 CAAAGAAGACAGAAAGTGGAGGG - Intergenic
958900907 3:99885733-99885755 CAGAGAGGAGGGAAGAAGAAGGG - Intronic
959089218 3:101884633-101884655 GAGAGAAGTAGGAAGAAGGATGG + Intergenic
959096153 3:101958346-101958368 TACAGAAGACAGAAGACAGAAGG + Intergenic
959465578 3:106682121-106682143 AAAAGAAGAGAGGAGAAGGAAGG + Intergenic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
959702675 3:109312779-109312801 CTGAGAAGACAGTAGGTGGATGG + Intronic
959933074 3:112003357-112003379 CAGAGAAGCAGGAAGAGGGAGGG + Intronic
960267830 3:115640974-115640996 AATAGAAGAAAGAAGAAGGAAGG - Intronic
960346402 3:116538741-116538763 CAGAGAGGCCAGAAGAGAGACGG - Intronic
960440408 3:117680118-117680140 GGGAGAAGACAGAAGAGGAAAGG + Intergenic
960476163 3:118131295-118131317 CAGAGAAGCCATAAGAAACAGGG - Intergenic
961142543 3:124567388-124567410 CACAGAAGGCAGAGGAGGGAAGG - Intronic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
961964256 3:130886533-130886555 CAGAGAAGACAAAAGAAATAAGG - Intronic
962346569 3:134623417-134623439 TAGAGAAGGCTGAAGCAGGAGGG - Intronic
962431873 3:135327618-135327640 CTGAGAGGACTGAAGCAGGAAGG - Intergenic
962507733 3:136065018-136065040 GGGAGAAGAGAGAATAAGGATGG + Intronic
962641226 3:137388836-137388858 AAAAGAAGACAGAAAGAGGAAGG - Intergenic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
962777432 3:138675626-138675648 CAGGGAAGCCAGAAGAAAGTGGG + Intronic
963275565 3:143326436-143326458 GAGAGAAGAGGGAGGAAGGAAGG - Intronic
963404691 3:144847486-144847508 CAGAGACAATGGAAGAAGGAAGG + Intergenic
963782542 3:149501339-149501361 CAGAGAGGAGAGATGAAGGGAGG - Intronic
963968618 3:151402999-151403021 AAGAAAAGAAAGAAAAAGGAAGG - Intronic
964036825 3:152209090-152209112 CAGAGATGAGAGAACAAAGATGG - Intergenic
964093345 3:152901515-152901537 GGGAGAAGACAGAAAAAGTAGGG + Intergenic
964554709 3:157923949-157923971 GAGGGTAGACAGTAGAAGGAGGG - Intergenic
965000622 3:162947996-162948018 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
965057929 3:163745527-163745549 AAAAGAAGACAGAAAAATGAGGG - Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965160299 3:165124432-165124454 CAGGGAAGAGGGAAGAAAGAGGG + Intergenic
965456474 3:168907443-168907465 AAGAGAAGAAGGAAGAAAGAGGG + Intergenic
965494269 3:169378324-169378346 CAAAAAAGAAAGAAAAAGGAAGG + Intronic
965565433 3:170111464-170111486 GAGAGAAGAAAAAAGAAGGGTGG + Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
965876688 3:173331691-173331713 CAGTGAAGAGAGAGGAAGCAAGG + Intergenic
965878690 3:173361041-173361063 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
965961746 3:174437551-174437573 GAGAGGGGAGAGAAGAAGGAGGG - Intergenic
966210918 3:177452482-177452504 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
966264451 3:178022303-178022325 AAGAAAAGACAGGAGAAGGAGGG - Intergenic
966456854 3:180127662-180127684 GACAGAAGAGAGAAGAAAGAAGG + Intergenic
966475382 3:180338909-180338931 CTGAGAAGGTAGTAGAAGGATGG - Intergenic
966543747 3:181120631-181120653 AAGAAAAGAGAGAGGAAGGAAGG - Intergenic
966640756 3:182187172-182187194 AAAAAAAGAAAGAAGAAGGAAGG + Intergenic
966681630 3:182647480-182647502 CAGAGAAGACTGAGGAGGCATGG + Intergenic
966763771 3:183440355-183440377 CAGAGAAGGCAGAAAAAGAGTGG - Intergenic
966827354 3:183976206-183976228 AAGAGAAGAAAGAAAAAGGAAGG - Intronic
966871550 3:184293175-184293197 CAGAGAAGACAGAGAAAGAGAGG + Intronic
966929149 3:184664495-184664517 CAGAAGTGACAGAAGAAGGCTGG + Intronic
966945177 3:184772814-184772836 AAGAGAAGAGAAAAGAAGGAAGG + Intergenic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967256470 3:187597747-187597769 CAAAGAAGAAAGGAAAAGGATGG - Intergenic
967433050 3:189410832-189410854 AAGAGAAGAGAAAAGAGGGAGGG - Intergenic
967526413 3:190499333-190499355 CACAGAAAACAGAAGAGGAAGGG - Intergenic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
967681223 3:192366179-192366201 AAGAGAGGAGAGAATAAGGAGGG + Intronic
967760765 3:193224045-193224067 CAGAGAACAAAGAAGATGAATGG - Intergenic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
967917395 3:194588883-194588905 CAGAGAAGAGTGGAGAATGAGGG - Intronic
967970447 3:194995143-194995165 CAAAGTAGAAAGAAGAAGAATGG + Intergenic
968212054 3:196856961-196856983 AAGAAAAGAAAGAGGAAGGAAGG + Intergenic
968339214 3:197941154-197941176 GAGAGGAGAGAGAGGAAGGAGGG - Intronic
968682533 4:1931062-1931084 AAGAGAGGACACAAGAAGGAAGG + Intronic
968858753 4:3149712-3149734 CAGAGAAGGGAGAAGACTGATGG - Intronic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969165882 4:5312014-5312036 GAGAGAAGAATGAAGAAGGATGG - Intronic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
969204065 4:5629147-5629169 CAGAGGAGACAAAACCAGGATGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969450645 4:7271147-7271169 CAGAGGAGATAGAAGCAGCAGGG - Intronic
969722058 4:8897613-8897635 CAGACAGGAGAGAAGGAGGAGGG - Intergenic
969726076 4:8919041-8919063 AAGAGAAGAAAGAGAAAGGAAGG - Intergenic
970206011 4:13656129-13656151 CAGTGAAGGAAGAACAAGGAAGG + Intergenic
970302514 4:14696407-14696429 CAGAGAAGACCAAAGGAGAAAGG + Intergenic
970365211 4:15351258-15351280 AGGAGAAAACAGAGGAAGGAAGG - Intronic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970589015 4:17542834-17542856 TAGAGATAACAGAAGAATGAAGG + Intergenic
970600134 4:17635445-17635467 CAAACAAGACAGAGGAAGAAAGG - Intronic
970676936 4:18461926-18461948 CAGAGCAGAGAGAAGAAAAATGG + Intergenic
970816893 4:20167382-20167404 AATAAAAGACAGAAGATGGATGG + Intergenic
970938699 4:21605979-21606001 AAGAGAAAACAACAGAAGGAAGG - Intronic
971006628 4:22381714-22381736 CTCAGAAGAAACAAGAAGGATGG + Intronic
971013027 4:22459988-22460010 CAGAGCAGAAAGTAGAAAGAGGG - Intronic
971148364 4:24004604-24004626 CAGATAAGACAGAAAATGAAGGG + Intergenic
971178095 4:24300952-24300974 CAGATGAGAGAGCAGAAGGATGG + Intergenic
971311567 4:25529917-25529939 AAGAGAGGAGAGAAGAAGGGAGG + Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972013155 4:34209498-34209520 CACAGAAGAAAGATGAAGGCTGG - Intergenic
972103269 4:35448000-35448022 AAGAAAAGAAGGAAGAAGGAAGG + Intergenic
972184359 4:36510869-36510891 AAGTGAAGACAGATGAATGAAGG - Intergenic
972191387 4:36595948-36595970 CAGACAAGACAGAATAGGGTAGG - Intergenic
972314394 4:37912447-37912469 CAGAGATGAGATAGGAAGGAAGG + Intronic
972580618 4:40392786-40392808 ATGAGAAGAGAGAACAAGGATGG + Intergenic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972770056 4:42189417-42189439 CAGAGAAAAGAGGATAAGGAGGG - Intergenic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
974078486 4:57189633-57189655 CATAGAAGAGAGTAGAAGGGGGG - Intergenic
974144543 4:57930641-57930663 ATGAGAAGACAGAAGGAGGCCGG + Intergenic
974345306 4:60672877-60672899 AAGAGAAGAGAAGAGAAGGAAGG + Intergenic
974800214 4:66807660-66807682 CTGACAAGACAGCAGAAGGAAGG + Intergenic
975026917 4:69560368-69560390 CAGAGGAGACAAAAGAAACAAGG + Intergenic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975454295 4:74572059-74572081 GAGAGATGACAAAAGAAGAAGGG + Intergenic
975858276 4:78648352-78648374 CAGAAAAGAAAGATGAAAGAAGG - Intergenic
975965992 4:79973075-79973097 CAAAGATAAAAGAAGAAGGAAGG + Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976143244 4:82015173-82015195 GAAAGAAGACAGAAGAAGAAAGG + Intronic
976499402 4:85770137-85770159 CAAAGAATACAGACCAAGGAAGG + Intronic
976960024 4:90958882-90958904 AAGTAGAGACAGAAGAAGGATGG - Intronic
977066551 4:92323700-92323722 CAGAGAAGAAGAAAGGAGGAAGG - Intronic
977287018 4:95120658-95120680 AAGAAAAGAAAGAAGAAGGAAGG - Intronic
977342888 4:95782264-95782286 CAGAGGAGTGAGAAGAAAGATGG - Intergenic
977437993 4:97024880-97024902 AAGAGAGGACAGAATAAAGAGGG - Intergenic
977734478 4:100396905-100396927 AAGAGAGGAGAGAAGAAGGCAGG - Exonic
977851451 4:101835095-101835117 AATAGAAGACAGAAAAAGGAAGG - Intronic
977858139 4:101920939-101920961 AAGAGAAGAATGAGGAAGGAGGG + Intronic
977961715 4:103092896-103092918 CAGAGAGGAAGGAAGAGGGACGG - Intronic
978247306 4:106589397-106589419 GACAGAAGAAAGAAGAAAGAGGG + Intergenic
978264736 4:106810242-106810264 GAGAGAAGAAAGAAGAAAGAAGG - Intergenic
978662234 4:111140722-111140744 TAGAGAACACAAAAGAAAGATGG + Intergenic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978952216 4:114574373-114574395 GAGAGAAGAGAGAGGAAGGGAGG - Intergenic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979407093 4:120326483-120326505 AAGAGAAGAAAAAAGAAGGAAGG + Intergenic
979450902 4:120870123-120870145 CGGAGGAGACAGAGGAAGGGAGG + Intronic
979549926 4:121979228-121979250 CAGAGAAAAAAGTAGAGGGAAGG + Intergenic
979865641 4:125749625-125749647 AAGAAAAGAAAGAAGAAAGAAGG - Intergenic
980054322 4:128065029-128065051 CAGTGAAGACTGGAGAATGAAGG - Intronic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980202296 4:129671355-129671377 AAGAGAAGAAAAAAGAAAGAGGG + Intergenic
980647608 4:135662736-135662758 CAGAAAACAAAGAAGAAGCAAGG - Intergenic
980790875 4:137618162-137618184 GAGAGAAGAGAAAAGAAGAAAGG - Intergenic
980888954 4:138793640-138793662 GAGGGAGGAAAGAAGAAGGAAGG + Intergenic
980971168 4:139568592-139568614 CAAAGAAGAAAGAAGCAGCAAGG + Intronic
980981417 4:139657527-139657549 AAGAAAAGAAAGAAGAACGAGGG + Intergenic
980996440 4:139784089-139784111 AAGAGAAGAAAAAAGAAGAAAGG + Intronic
981092129 4:140742839-140742861 GAGAAAAGAGAGAAGAAAGAAGG + Intronic
981221012 4:142234917-142234939 AAGAGAAGAGAGAAGAGGGTAGG + Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981581399 4:146251995-146252017 GAGAGAAGAGAAAAGAAGGGAGG + Intergenic
981863579 4:149386252-149386274 CAGTGGAGAGAGAAGAATGAGGG + Intergenic
982157481 4:152536154-152536176 CAGAGCGGAAAGAAGAGGGAGGG - Intergenic
982340005 4:154286657-154286679 CAGAGGAGACAAAAGAAAAAAGG + Intronic
982709333 4:158744474-158744496 GGGAGAAGAGAGAAGGAGGAAGG + Intergenic
982884903 4:160766363-160766385 AAGGGAGGAAAGAAGAAGGAAGG + Intergenic
982959609 4:161820727-161820749 CAAAGGAGCCAGAAGATGGAAGG + Intronic
983921474 4:173350303-173350325 CAGAGGTGAAAGAAAAAGGATGG + Intergenic
984113965 4:175655102-175655124 CAGAGTAGAAAGAAGATGTAAGG - Intronic
984237524 4:177178582-177178604 CAGAGAAGAGAAAAGGAGTAAGG - Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984444470 4:179817780-179817802 GGAAGAAGACAGAAGAAGCAGGG - Intergenic
984749181 4:183255217-183255239 CAGAAAAGCCAGAACAAGAAGGG - Intronic
984783894 4:183551264-183551286 AAGAAAAGAAAGAAAAAGGAAGG + Intergenic
984863729 4:184262968-184262990 CAGAAAAGTCAGAAGAATTAGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985363634 4:189202681-189202703 AAGAAAAGAGAGAGGAAGGAAGG + Intergenic
985723395 5:1502416-1502438 CAGAGAAGACGGCAGAATGAAGG + Intronic
985838856 5:2290783-2290805 GAGAGAAGAAAGAAAAAAGAAGG - Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
985977352 5:3430612-3430634 CACAGAAGATGGCAGAAGGAAGG - Intergenic
986143543 5:5054686-5054708 AAAAGAAGAAAGAAGAAGGAAGG + Intergenic
986240308 5:5954771-5954793 CAGAGAGGGAAGGAGAAGGAGGG - Intergenic
986446021 5:7822014-7822036 CGGAGAAAAGTGAAGAAGGAAGG + Intronic
986466756 5:8033891-8033913 CAGGCATGACAGAAGAAGTAAGG + Intergenic
986482001 5:8198865-8198887 CAGAGAAGATGGATGAAAGATGG + Intergenic
986986488 5:13506325-13506347 CAGAGGAGAGAGAATCAGGAGGG + Intergenic
987017667 5:13836863-13836885 GACACAAGACAGAAGAAGGAGGG + Intronic
987390950 5:17375163-17375185 CAGAGACTACAAAAGAAGGGTGG - Intergenic
987715172 5:21559203-21559225 AAAAGAAGACAGAGGAAAGAAGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
988059076 5:26143111-26143133 GAGAGAAGAAAGAGGAAAGAGGG + Intergenic
988142100 5:27256324-27256346 AAGAGAGGAAGGAAGAAGGAAGG + Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988209366 5:28183526-28183548 CAAAGCAGGCAGAAGAAGGTGGG - Intergenic
988213314 5:28237659-28237681 GAAAGAAGAAAGAAGAAAGAGGG - Intergenic
988345651 5:30035037-30035059 CTCAGAAGACAGAAGAAATATGG + Intergenic
988359992 5:30224433-30224455 AAGAAAGGAAAGAAGAAGGAAGG + Intergenic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989308787 5:39988441-39988463 CAGAGAAGAGAAAAGTAGTATGG + Intergenic
989490442 5:42046832-42046854 AAGAGAAGAAAGGAGAAGGGAGG + Intergenic
989657550 5:43760681-43760703 CAGAGGAGACAAAAGAAAAAAGG - Intergenic
990096469 5:52120453-52120475 GAAAGAAGAAAGAAAAAGGAAGG - Intergenic
990425998 5:55689701-55689723 TAGAGAAGCCTGAAGAAAGAGGG - Intronic
990804813 5:59647615-59647637 CAGATAAGACTGAAGAAGGATGG + Intronic
990878842 5:60517911-60517933 GAGAGAAGAGAGAAGAAGAGAGG + Intronic
991185499 5:63801623-63801645 AAGAGAAGAGAAGAGAAGGAAGG + Intergenic
991278666 5:64883574-64883596 CTAAGAAGAAAGGAGAAGGAAGG + Intronic
991471603 5:66975127-66975149 CAGAGAAGCCAGAAGATGCAAGG + Intronic
991515245 5:67427969-67427991 GAGAGAAGAGAGAGGAAGGAAGG - Intergenic
991679836 5:69127822-69127844 ATGAGAAGCCAGAAGCAGGAAGG - Intronic
991970044 5:72131774-72131796 CAGAGAAGACACTGGGAGGAAGG - Intronic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992240550 5:74765435-74765457 TAGAGAAGAATGAAGCAGGAAGG + Intronic
992301753 5:75389173-75389195 AAGAGAAGGGAAAAGAAGGAGGG + Intronic
992400869 5:76410170-76410192 AAGAGAAGATATGAGAAGGATGG + Intronic
992737895 5:79742188-79742210 CAAAGAAGAAAGAAGAAAAAAGG - Intronic
992741109 5:79774456-79774478 GAGAGAAGTCAGAAGAAGTGTGG + Intronic
992942423 5:81775220-81775242 CAGAGAAGGTAGAACCAGGAGGG + Intergenic
993085772 5:83361945-83361967 CAGAGAGGAGAGGGGAAGGAGGG - Intergenic
993134273 5:83937681-83937703 AAGAGAAGAGACGAGAAGGAAGG - Intergenic
993628085 5:90250196-90250218 AAGAGACGACAGAAAAAGGAAGG - Intergenic
993775723 5:91993278-91993300 GAGAAAAGAGAGAGGAAGGAAGG + Intergenic
993887735 5:93435955-93435977 TAAAGAAGACAGAAGCAGTAGGG - Intergenic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994307645 5:98226380-98226402 TAGGAAAGAAAGAAGAAGGAAGG + Intergenic
994355407 5:98788701-98788723 CAGGGAAGACACTTGAAGGAAGG + Intronic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
995015111 5:107301195-107301217 CAAAAAAGACAGAAGTTGGAGGG + Intergenic
995138622 5:108707357-108707379 CAGTGAGGACAGAACAAGAAGGG - Intergenic
995576758 5:113544766-113544788 CAGAGAAGGCAGACCAGGGAAGG - Intronic
995675918 5:114662284-114662306 CTGAGAAGCCAAAAGAAGAAAGG + Intergenic
996205594 5:120731614-120731636 CAGAAAAGACAGAAAATGCAAGG + Intergenic
996281042 5:121729243-121729265 AGGAGAAGACAGAAGGAGGCGGG - Intergenic
996349371 5:122521590-122521612 TATAGAAGGCAGAAGAAGGAAGG - Intergenic
996438731 5:123465086-123465108 CAAAAAAGATAGAAGGAGGATGG + Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
996552895 5:124748197-124748219 CAGCTAGGACAGAAGAGGGAGGG + Intronic
996809221 5:127495695-127495717 CACAGAAGACAGAAAAAGAGTGG + Intergenic
996923594 5:128797279-128797301 AAGAGAAAAAAGAAGAAGAAAGG - Intronic
997203860 5:132029872-132029894 AAGAAGAGAAAGAAGAAGGAAGG + Intergenic
997247041 5:132358493-132358515 CAGAGAAGACAACTGCAGGAGGG - Intergenic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997880801 5:137587734-137587756 TACAGGAGACAGAAGAAGGAAGG - Intronic
997952769 5:138254989-138255011 GAGAGAAGAGAAGAGAAGGAAGG + Intronic
998221895 5:140289513-140289535 TGGAGAAGAAAGAGGAAGGAGGG - Intronic
998379585 5:141714644-141714666 AGGAGAAGACAGGAGAAGCATGG - Intergenic
998401673 5:141851781-141851803 TGGAGAAGCCAGAAGAAAGAGGG - Intergenic
998495822 5:142588469-142588491 GAGAGAAGAGAGAAGAGGGAGGG - Intergenic
998547598 5:143044297-143044319 ATGAGAAGCCAGAAGAAGGAAGG - Intronic
998713832 5:144857770-144857792 CAGAGAAGAAGAAAGAAGAAAGG - Intergenic
998723163 5:144976784-144976806 CAGAGTAGACAGCAGCAGAATGG - Intergenic
998769855 5:145530571-145530593 TGGAGAAGAAAGAATAAGGAGGG + Intronic
998798090 5:145840123-145840145 AAGGGAAGTCAGAAGAAGGTCGG - Intergenic
998881222 5:146647302-146647324 CAAAGGAGACAGAAGAAACATGG - Intronic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998955046 5:147430190-147430212 GAGGGAAGAAAAAAGAAGGATGG + Intronic
998962775 5:147506584-147506606 AAGAGAAGACTGAAGAAGCTAGG + Intronic
999257532 5:150217904-150217926 GAGAGAAGACAGTAGCTGGAAGG + Intronic
999432640 5:151537341-151537363 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
999749928 5:154620255-154620277 AAAACAAGACAGAAGGAGGAAGG - Intergenic
1000332556 5:160217387-160217409 CAGAGAAAAGACAAGAAGAAGGG + Intronic
1000801349 5:165730383-165730405 CTGAGGAGACAGAAGAGGAAGGG - Intergenic
1000840629 5:166213395-166213417 CAAAGAAGGAAGAAAAAGGAAGG - Intergenic
1001102190 5:168823537-168823559 CTGAGAGGACAGTAGAGGGAAGG - Intronic
1001108390 5:168875212-168875234 GAGGGAAGAGAGAAGAAGGAAGG + Intronic
1001120069 5:168972707-168972729 TAGAGAAGACAGCAAGAGGAAGG - Intronic
1001184448 5:169555159-169555181 AAGGGAAGACTGAATAAGGAGGG - Intergenic
1001220459 5:169895905-169895927 CAGAAAATAGGGAAGAAGGAAGG - Intronic
1001310679 5:170608055-170608077 GAGTGAGGACAGAAGAAGGTAGG + Intronic
1001415017 5:171539610-171539632 CAAAGCAGACAGTAGAAGGAAGG - Intergenic
1001542927 5:172551740-172551762 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1001829578 5:174774218-174774240 CAGAGAAGGTGGAAGCAGGAAGG - Intergenic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002213993 5:177616260-177616282 CAGAAAAGACAGAAAAAGAAGGG - Intergenic
1002518382 5:179775707-179775729 CAGAGAAAACTGCAGAAGGTGGG - Exonic
1002519843 5:179786280-179786302 AAGAGAAGGAAGAAGAAGAAAGG + Intronic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1002801086 6:522131-522153 GAGAGGAGACACAAGCAGGAGGG + Intronic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1002918228 6:1546161-1546183 CAGAGCAGGAGGAAGAAGGAGGG + Intergenic
1003004267 6:2366418-2366440 AAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1003009819 6:2416211-2416233 AAGAGAGGAAAAAAGAAGGAAGG - Intergenic
1003009834 6:2416353-2416375 GAAAGAGGAAAGAAGAAGGAAGG - Intergenic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1003737777 6:8896859-8896881 AAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1003888998 6:10546836-10546858 CAGAGAAGGATGAAGAAGTATGG - Intronic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1004015425 6:11727900-11727922 GAGAGGGGAAAGAAGAAGGAAGG + Intronic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004167196 6:13267138-13267160 CAGAGAAGACTGGAAGAGGATGG - Exonic
1004522560 6:16375859-16375881 GAGAAAAGACAGAACAGGGAAGG + Intronic
1004790387 6:19019749-19019771 CAGAAAAGAGGGAGGAAGGAAGG + Intergenic
1004842845 6:19606613-19606635 CAGAGAGGGAAAAAGAAGGAAGG + Intergenic
1004859977 6:19793906-19793928 GAGGGAGGACAGAAGAAGGCAGG + Intergenic
1004883409 6:20030646-20030668 AAGAGGAGACAGGAGAAGTAGGG + Intergenic
1004950094 6:20659992-20660014 GAGAGAAGACAGTCCAAGGAAGG - Intronic
1005400349 6:25425916-25425938 TATGGAAGACAGTAGAAGGACGG + Intronic
1005427994 6:25723951-25723973 CAGAAATGACAGAATAAGGAAGG + Intergenic
1005583082 6:27251547-27251569 CAGGGAAGACCCGAGAAGGAGGG + Intronic
1005700681 6:28397709-28397731 AAGAGATGACAGTAGCAGGATGG - Intronic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1006183765 6:32169025-32169047 CAGACAAGACAGTAGGAGGTGGG + Exonic
1006308801 6:33242595-33242617 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
1006789698 6:36691838-36691860 CAGAAATGGCAGAAGCAGGATGG - Intergenic
1006823378 6:36916085-36916107 GGGAGAAGAGAGAAGGAGGAAGG - Intronic
1006929425 6:37678738-37678760 CTCAGAAGACAGCTGAAGGAAGG - Intronic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007235420 6:40387885-40387907 CAGACAAGACTGGAGATGGAAGG + Intergenic
1007345449 6:41225476-41225498 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1007422843 6:41729853-41729875 CACAGAACCCAGGAGAAGGACGG + Intronic
1007623935 6:43231875-43231897 GAAAGAAGAAAGAAGGAGGAAGG - Intergenic
1007777994 6:44234447-44234469 CAGTGAAGACAAAGGAAAGATGG - Intergenic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008016416 6:46525565-46525587 GAAAGAAGAGAGGAGAAGGAGGG + Intergenic
1008463783 6:51806789-51806811 CAGACAAGAAAGAGAAAGGAAGG + Intronic
1008543392 6:52564973-52564995 CAGAGAAGCATGAAGGAGGAGGG + Intronic
1009025852 6:57999517-57999539 CCGAGAAGAGACAAGATGGAAGG - Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009201410 6:60750984-60751006 CCGAGAAGAGACAAGATGGAAGG - Intergenic
1009308193 6:62118726-62118748 CATAGAAGAAAGATGAAGGCTGG - Intronic
1009866148 6:69399998-69400020 CAGAGAAAAAAAAAGAAGAATGG + Intergenic
1009901634 6:69813956-69813978 CAGAGCAGAGTGGAGAAGGATGG + Intergenic
1010029360 6:71257184-71257206 CAGAAAAGGCACAAAAAGGAAGG + Intergenic
1010749027 6:79597339-79597361 AAGAAAAGAAAGAGGAAGGATGG + Intergenic
1011092714 6:83624540-83624562 CAGAGAAGAAAGAGGAAAGAAGG - Intronic
1011823238 6:91276735-91276757 CAGAGAAGAAAGAGTAAAGAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012231200 6:96762698-96762720 CAGAGAAGACTGAGGCAGCAGGG + Intergenic
1012431600 6:99169984-99170006 CAGAGTAGATAGAATAAGGAGGG - Intergenic
1012521238 6:100123849-100123871 TAGAGATGACAGAAAAACGAGGG - Intergenic
1012652671 6:101776407-101776429 CAGAGAAGACAGACAAATAAGGG + Intronic
1012848900 6:104424097-104424119 GAGAGATGAGTGAAGAAGGAAGG + Intergenic
1013029091 6:106313119-106313141 CTGAGAAGGCAGAAGATAGAGGG + Intronic
1013751391 6:113410789-113410811 AAAAGAAGGGAGAAGAAGGAAGG + Intergenic
1013956727 6:115850899-115850921 CAGAGAAGAGAGAAGAGAGTAGG + Intergenic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1015097122 6:129429069-129429091 CAAAGAAGAGAGGTGAAGGATGG - Intronic
1015285499 6:131482148-131482170 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1015532269 6:134232493-134232515 AAGAAAAGAAAGAAGAGGGAGGG + Intronic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1015697595 6:135998877-135998899 GAGAGAGGAAAGAAGGAGGAGGG + Intronic
1015890486 6:137965314-137965336 GGGAGAAGAGAGAGGAAGGAAGG + Intergenic
1016129281 6:140445872-140445894 CAGAGAAGAGAAAGGAAGAAAGG - Intergenic
1016279720 6:142401692-142401714 GAGAGAGGAGAGAATAAGGAAGG + Intronic
1016361282 6:143269998-143270020 TAGTGAAGGAAGAAGAAGGAAGG + Intronic
1016445768 6:144130699-144130721 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1016538369 6:145134894-145134916 CAGAGAAGATAAAAGAAAAAAGG - Intergenic
1016544138 6:145201700-145201722 GAAAGAAGAAAGAAGAAGGAAGG - Intergenic
1016631710 6:146240654-146240676 CAGAGCAGGATGAAGAAGGATGG + Intronic
1016756759 6:147696128-147696150 CAAAGAGCACAGAAGAAGTAGGG - Intronic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017199004 6:151732152-151732174 CATAGAAGAGAAAAGAAGCATGG - Intronic
1017350665 6:153438186-153438208 CAGAACAGAAACAAGAAGGAAGG + Intergenic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017578922 6:155838866-155838888 AAGAGAAGAAAACAGAAGGAAGG + Intergenic
1017645443 6:156535680-156535702 GAGGGAAGACAGAAGAGAGAAGG + Intergenic
1017945810 6:159095550-159095572 CAAAGAACAGGGAAGAAGGACGG + Intergenic
1018069251 6:160147550-160147572 CACAGAAGCTAGAAGAAGTAGGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018561072 6:165101348-165101370 TAGAGAAGGAAAAAGAAGGAAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019818883 7:3224069-3224091 CAGAGAAGATATAAAAAGAAGGG - Intergenic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1020430599 7:8113020-8113042 CAGATAAGGCAGCAGCAGGAAGG - Intergenic
1020702874 7:11505476-11505498 AACAGAAGACAAAAGAAAGAAGG + Intronic
1020784186 7:12554336-12554358 AAGAGAAGGCAGAAAAATGAAGG - Intergenic
1020823186 7:12996128-12996150 AAGAAAAGAGAGAGGAAGGAAGG - Intergenic
1020918338 7:14227582-14227604 CACAGAAAATAGAAGAAGGAAGG + Intronic
1021163771 7:17308205-17308227 AAGAGAGAAAAGAAGAAGGATGG - Intronic
1021267515 7:18543377-18543399 CTCAGAAGACAGAAGCAGCAGGG - Intronic
1021296022 7:18906984-18907006 AAGAGAAAACACAAGATGGAAGG + Intronic
1021839804 7:24713397-24713419 AAAAGATGACAGAAGCAGGAAGG - Intronic
1022109260 7:27218278-27218300 CATAGAACACAAATGAAGGATGG + Intergenic
1022220041 7:28305316-28305338 CAGAGAAGAAGAAAGAAAGAAGG - Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022612183 7:31886893-31886915 AAGATAAAACAGAAGAAGGTAGG + Intronic
1022766797 7:33421929-33421951 CAGAAAATACAGAAAAGGGAAGG + Intronic
1023131029 7:37003377-37003399 AAGAAAAGAGAAAAGAAGGAGGG + Intronic
1023241154 7:38149093-38149115 GAAAAAAGAAAGAAGAAGGAAGG + Intergenic
1023314400 7:38920471-38920493 CAGATAAGTGAAAAGAAGGATGG + Intronic
1023472817 7:40543125-40543147 TAGAGATGCCAGAAAAAGGAAGG - Intronic
1023693124 7:42813266-42813288 CATAGATGAAAGAAAAAGGATGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023737854 7:43250549-43250571 AAGAGAGGACAGGGGAAGGAAGG + Intronic
1023871590 7:44266212-44266234 CTGAGAAGCCACAAGAAGGAGGG + Intronic
1023911998 7:44562912-44562934 CAAAGGATACAGAAGATGGAGGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024343577 7:48291106-48291128 CAAAGCAGAAAGAAAAAGGATGG - Intronic
1024359120 7:48449291-48449313 GAGAGAAGAAAAAGGAAGGAAGG - Intronic
1024407020 7:48993558-48993580 CACATAAGAAAGAAGAAGGAGGG - Intergenic
1024529495 7:50379547-50379569 CAGAGAGGAGAGAGGTAGGAAGG + Intronic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024682009 7:51700382-51700404 CAGAAAAGACAGAAAAAGAATGG + Intergenic
1024695074 7:51847527-51847549 CAGAGAGGAAAGAACAAAGAGGG - Intergenic
1024859893 7:53826275-53826297 AAGAGAAAAGAAAAGAAGGAGGG + Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1025288500 7:57689189-57689211 CCGAAGAGACAGAAGAAGGCAGG - Intergenic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026153653 7:67809242-67809264 CACAGAAGACAGCAGAGTGATGG + Intergenic
1026178614 7:68019247-68019269 CAGAGAAGACATAAGTAGCATGG + Intergenic
1026225504 7:68436616-68436638 GAGAGAAGAGAGGAGAAGAAAGG - Intergenic
1026410550 7:70117420-70117442 GAGACAAGACAGAAGAAAAAAGG + Intronic
1026509170 7:71013754-71013776 AAGAGAAAAGGGAAGAAGGAAGG + Intergenic
1026585243 7:71650723-71650745 AAGAAATGACAGTAGAAGGATGG + Intronic
1026636671 7:72088719-72088741 GAAAGAAGAAAGAAGAAGGAAGG + Intronic
1026638875 7:72106884-72106906 GAAAGAAGAAAGAAAAAGGAAGG + Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1026943666 7:74303010-74303032 CAGAGAAGACTGACCAAGTATGG + Intronic
1027121406 7:75524844-75524866 CAGAGGAGAAGGAAGAAGGAGGG - Intergenic
1027132997 7:75604666-75604688 TAGAAAAGAAGGAAGAAGGAAGG + Intronic
1027386341 7:77662927-77662949 AAGAAAAGAAAGAAAAAGGAAGG + Intergenic
1027547025 7:79540414-79540436 CAGAGAAGAGAGAAGAGAAAAGG - Intergenic
1027624136 7:80527305-80527327 AAGAAAAGAGAAAAGAAGGAGGG + Intronic
1027692855 7:81369928-81369950 CAAAGCAGGCAGAAGAAGGTAGG + Intergenic
1027787272 7:82596010-82596032 CAGGAAAGACAGAAGAGTGAAGG - Intergenic
1028002587 7:85518760-85518782 GAGAAAGGATAGAAGAAGGAAGG + Intergenic
1028714482 7:93948892-93948914 GAGAGAAAAAGGAAGAAGGAAGG + Intergenic
1028829362 7:95310608-95310630 CAGATAAGAAAGAAGAGGAAGGG + Intronic
1028921370 7:96314082-96314104 GAAAGAAGAAAGAAGAAGGAAGG + Intronic
1029049592 7:97670564-97670586 CAGAGAAGACAGCAGGTGCAAGG - Intergenic
1029092498 7:98058907-98058929 AAAAAAAGAAAGAAGAAGGAAGG + Intergenic
1029635169 7:101778711-101778733 GAGAAAAGAAAGAGGAAGGAAGG - Intergenic
1029642058 7:101827240-101827262 AAGAGAAGAGAAGAGAAGGAGGG - Intronic
1030364745 7:108632577-108632599 TAGAAAAGACAATAGAAGGAAGG + Intergenic
1030405593 7:109108212-109108234 GAGAGAAGAGAGAAAATGGATGG + Intergenic
1030523128 7:110622585-110622607 AAGCTAAGAGAGAAGAAGGAAGG + Intergenic
1030910712 7:115245674-115245696 CACACAAGACAGAAGAAACACGG + Intergenic
1030913166 7:115278362-115278384 CAAAGAACACTGAAGAAGGAGGG - Intergenic
1030942545 7:115671607-115671629 TTTAAAAGACAGAAGAAGGACGG - Intergenic
1031020287 7:116620451-116620473 AAGTGGAGACTGAAGAAGGAAGG + Intergenic
1031369661 7:120949443-120949465 AAAAGCAGCCAGAAGAAGGAAGG + Intergenic
1031386365 7:121156679-121156701 CAGAAATGATAGAAGGAGGATGG + Intronic
1031407500 7:121404309-121404331 GAGAGAAGAGAGAAGAAAGTGGG + Intergenic
1031452136 7:121935394-121935416 CAGCTCAGACAGAAGAAGAAGGG - Intronic
1031618079 7:123904480-123904502 CAGAGAAGACAGGAACATGATGG - Intergenic
1031973229 7:128078447-128078469 TTGAGAAGACAGCAGAAGCAAGG - Intronic
1032061004 7:128725373-128725395 CAAAAAAGAAAGAAAAAGGAAGG - Intronic
1032261689 7:130343119-130343141 AAAAGAAGAAAGAAGAAGGAAGG - Intergenic
1032519384 7:132532219-132532241 GTAAGAAGACAGAAAAAGGAAGG + Intronic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1032939268 7:136769580-136769602 CAGAGGAGACAGAAAAAAGTTGG + Intergenic
1033031684 7:137833094-137833116 CAGAGAAGACAGGAAAATGTGGG - Intronic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033603359 7:142906702-142906724 AAGAGAATAAAGAAGAATGATGG + Intergenic
1033653792 7:143360822-143360844 GAGAGAAGACAGAAGATGGTGGG + Intronic
1033669995 7:143482563-143482585 GAGAGAAGAATGAAGAAGGATGG - Intergenic
1034031689 7:147773699-147773721 GAGAGTACAAAGAAGAAGGAAGG - Intronic
1034563538 7:151896441-151896463 CAGAGGAGGCCGCAGAAGGAAGG + Intergenic
1034625164 7:152487154-152487176 AAGGGAAGAGAGAGGAAGGAAGG - Intergenic
1035073388 7:156160736-156160758 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035495947 7:159326309-159326331 AAGAGAAGACAGCAGAGGGCAGG + Intergenic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036090239 8:5657278-5657300 CAGAGAAGCCAGGTGAAGGAAGG - Intergenic
1036210995 8:6841399-6841421 CACAGCAGACAGAAGAGGGATGG - Intergenic
1036771575 8:11582044-11582066 CAAACAAAACAAAAGAAGGAAGG + Intergenic
1036778497 8:11629752-11629774 CAGAGAAGACAGAGGCGAGAAGG + Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1037083294 8:14814356-14814378 GAGAGGAGGTAGAAGAAGGAAGG + Intronic
1037325063 8:17680820-17680842 CTGAGCAGACACATGAAGGAAGG + Intronic
1037410650 8:18592418-18592440 AAGAGCAGAAAGAAGAAAGAGGG + Intronic
1037483239 8:19324630-19324652 CAGAGAAGAAAAAAGAAACAGGG - Intronic
1037585075 8:20270543-20270565 CAGAGTAGAAAGAAGCAGGAAGG + Intronic
1037590552 8:20308391-20308413 CAGAGAAGACAGAGGAGAGATGG - Intergenic
1037656152 8:20885953-20885975 CAGAGAGAAGAAAAGAAGGATGG + Intergenic
1037996665 8:23357364-23357386 CAGAAAAGACTGAAAAAGGCCGG - Intronic
1038379252 8:27076952-27076974 GAGAGAAGGAAGAACAAGGATGG + Intergenic
1038609739 8:29049354-29049376 CAGAGAAGGTAGAAGAAGAGAGG + Intronic
1038636353 8:29290768-29290790 AAGAAAAGAAAAAAGAAGGAGGG - Intergenic
1038679333 8:29652429-29652451 AAGAGAAGAAAGAGGAAGGAAGG + Intergenic
1038795247 8:30703835-30703857 GAAAGAAGTTAGAAGAAGGAAGG + Intronic
1039108091 8:34011420-34011442 CAGATAAGTCAGATCAAGGATGG - Intergenic
1039320155 8:36420744-36420766 CAGATAACACAAAAAAAGGAAGG - Intergenic
1039562347 8:38522779-38522801 GAAAGAAGAGAGAGGAAGGAAGG - Intronic
1039611872 8:38926015-38926037 CTGAGAGGACAGAAGTGGGAGGG - Intronic
1039741442 8:40386660-40386682 CAGAGAATAAAGGACAAGGAGGG - Intergenic
1039860811 8:41455580-41455602 AAGAAAAGAAAGAAGAAAGAAGG + Intergenic
1039946095 8:42129770-42129792 AAGAGAAGAGAAAAGAAGGAAGG - Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041744038 8:61186647-61186669 AAGAGAAGACAAAAGAAGGGAGG + Intronic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1041822058 8:62047888-62047910 AAGAGAAGAAAGGAGAAAGAAGG - Intergenic
1041989265 8:63966238-63966260 GAGGGAAGAAAGAAGAAAGAAGG - Intergenic
1042346885 8:67736579-67736601 CAGAGAAGAAAGTAGCAGAAAGG - Intronic
1042420991 8:68589420-68589442 GAGAGAAAATAAAAGAAGGAAGG + Intronic
1042482511 8:69319892-69319914 GAGAGAGGCCAGAAGAATGATGG + Intergenic
1043382589 8:79719577-79719599 AAAAGAAGAAAGAAAAAGGAAGG - Intergenic
1043519024 8:81024843-81024865 TAGAAAAGATGGAAGAAGGAGGG - Intronic
1043548041 8:81337249-81337271 AAGAGGAGGCGGAAGAAGGAAGG + Intergenic
1044054482 8:87551605-87551627 AAAAGAGGAAAGAAGAAGGAAGG + Intronic
1044462901 8:92466934-92466956 CACAGAAGAGAGAACAGGGAAGG + Intergenic
1044533778 8:93337200-93337222 GAGATAAGACAGAAGAATGTGGG + Intergenic
1044553640 8:93538753-93538775 GAGAGAAGAAAGAAGAAAAATGG - Intergenic
1044717558 8:95114236-95114258 AAGAGAAGAAAGGAGAAGGGTGG + Intronic
1044891762 8:96843391-96843413 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1045640734 8:104247573-104247595 CAGAGAGGAAGGAAGAAAGATGG + Intronic
1045707283 8:104940353-104940375 CAGAGAAGGCAGAAAAAGAGGGG - Intronic
1045731036 8:105241075-105241097 GTGAAAAGACAGAAGATGGAAGG - Intronic
1045840039 8:106569245-106569267 TTGAGAAGAAAGAAGAAGGGGGG - Intronic
1045975833 8:108129724-108129746 GAAAGAAGAAAGAGGAAGGAAGG + Intergenic
1046073938 8:109294454-109294476 CAGAGATGACAGATGAAGGCAGG + Intronic
1046463439 8:114571410-114571432 CAAAGCAGGCAGAAGAAGAAGGG + Intergenic
1046588401 8:116176002-116176024 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1046613141 8:116447168-116447190 CAGAGAAGGCAGTCAAAGGAAGG - Intergenic
1047039208 8:120974208-120974230 GAAAGGAGACAGAAAAAGGAAGG + Intergenic
1047112033 8:121801427-121801449 AAGATAAGACATAAGAAGGGAGG + Intergenic
1047281118 8:123446549-123446571 GAAAGAAGAGAGAAGAAAGAAGG - Intronic
1047540609 8:125762076-125762098 GAGAGAAGTCAGAAGAGGGATGG + Intergenic
1047549061 8:125850070-125850092 GAGAGAAAAAAGAGGAAGGAAGG - Intergenic
1047621907 8:126616533-126616555 CAAAGAAAAGAAAAGAAGGAAGG - Intergenic
1047762649 8:127965598-127965620 CAGAGTGGAGAGAACAAGGAAGG - Intergenic
1047830853 8:128628150-128628172 CAGAAAAGAGGGAAGGAGGATGG - Intergenic
1047881146 8:129194979-129195001 CTAAAAAGAGAGAAGAAGGAAGG - Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1049137312 8:140915211-140915233 TAGAAAAGACAGAACAGGGATGG + Intronic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1049341433 8:142114650-142114672 GAGAGAAGAAGGAAGAAGGGAGG + Intergenic
1050369859 9:4909685-4909707 AAGAGAGGAAAGATGAAGGAAGG - Intergenic
1050747374 9:8892036-8892058 CAGAGAAAAGAAAAGCAGGAAGG - Intronic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1050771470 9:9206663-9206685 CACAAAAGACAGATGAAGGCAGG - Intronic
1050846977 9:10233336-10233358 CAGAGAACACAAAACAATGAAGG - Intronic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1051047347 9:12890269-12890291 CAGAGGAGACAAAAGAAAAAAGG + Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051225563 9:14895452-14895474 CTCAGAAGAAACAAGAAGGATGG + Intronic
1051788422 9:20772096-20772118 CATAGAAGACAGAATCAGTAGGG + Intronic
1052077649 9:24163099-24163121 CAGAAAAGAAAGAAAAATGATGG - Intergenic
1052313870 9:27096532-27096554 CAGAGAACTCAGAAGAAGACAGG + Intergenic
1052420279 9:28234606-28234628 CAGAGGAGAAAGATGAAGGCTGG - Intronic
1052463065 9:28792230-28792252 AAGAGAAGAGAAAAGAAAGAAGG + Intergenic
1053146212 9:35713844-35713866 AAGAGAAAAAAGAAAAAGGAAGG + Intronic
1053216106 9:36271971-36271993 CAGAGAGAAAAGAACAAGGATGG - Intronic
1053423591 9:37996733-37996755 AAGAGACTACAGTAGAAGGAGGG - Intronic
1053455709 9:38231804-38231826 CAAAGAAGACACTCGAAGGAAGG - Intergenic
1053571847 9:39318088-39318110 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1053622375 9:39832922-39832944 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1053786212 9:41654605-41654627 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1053882764 9:42612258-42612280 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1053889905 9:42682044-42682066 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054093401 9:60876799-60876821 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054114884 9:61152719-61152741 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054125298 9:61300923-61300945 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054158839 9:61659593-61659615 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054174927 9:61868550-61868572 TAGAGAAGACAGTGGGAGGAGGG + Intergenic
1054221791 9:62419726-62419748 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054228923 9:62489447-62489469 AAAAGAAGACAGAAGAATGTGGG + Intergenic
1054478613 9:65590598-65590620 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054592872 9:67029815-67029837 AAAAGAAGACAGAAGAATGTGGG - Intergenic
1054662612 9:67712243-67712265 TAGAGAAGACAGTGGGAGGAGGG - Intergenic
1054795944 9:69302143-69302165 CAGAGCAGTAGGAAGAAGGATGG - Intergenic
1054984239 9:71243366-71243388 CGGAGATGACAGCAGATGGAAGG - Intronic
1055006219 9:71510475-71510497 CAGGAAAGACAGAAGAGTGAAGG + Intergenic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1055320781 9:75081595-75081617 CAGAGATGCCAGATGAAGGCTGG + Intronic
1055723311 9:79199771-79199793 CAGAGAAGACAGAGAATGGATGG + Intergenic
1056007474 9:82287439-82287461 TAGAGGAGACAGAAAAATGAAGG + Intergenic
1056035966 9:82605912-82605934 CAGAAAAGACAGTGGAATGAGGG - Intergenic
1056212661 9:84379671-84379693 GAAAGAAAAAAGAAGAAGGAAGG - Intergenic
1056513366 9:87327167-87327189 CAAAGAAGAAGGAAGAAGAAGGG + Intergenic
1056697628 9:88873370-88873392 GAAAGAAGAAAGAAGAAGAAAGG + Intergenic
1056755163 9:89377060-89377082 CAGAGAGGACAGAAAAGAGAGGG + Exonic
1056798927 9:89677981-89678003 CAGAGAACAATGAAGAAGAAAGG - Intergenic
1057093949 9:92287604-92287626 CACAGAAGTCAGAAGAGAGATGG + Intronic
1057307891 9:93922760-93922782 CAGAGAAGAAGGAAGAGGGAGGG + Intergenic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1057895085 9:98902944-98902966 CATAGAAGATAGAAGAAAGAAGG - Intergenic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058146620 9:101419145-101419167 GAGGGAAGAGGGAAGAAGGAAGG - Intergenic
1058388032 9:104461500-104461522 CAGGTAAGAGAGAAGAAGGAAGG + Intergenic
1058670663 9:107358182-107358204 CACAGAAAACACAGGAAGGAAGG - Intergenic
1058761542 9:108138543-108138565 GAGAGAGGAAAGCAGAAGGATGG - Intergenic
1058875868 9:109244362-109244384 GAGAGAAGAAAGAAAAAGAAGGG + Intronic
1058945736 9:109854233-109854255 AAGAGGAGACATAAGAAGAAGGG + Intronic
1059355317 9:113694726-113694748 CAGGAAAGACAGACAAAGGAAGG + Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059381046 9:113925598-113925620 CAGAGAAGGGAGAAAAAGAATGG - Intronic
1059669049 9:116476215-116476237 CTGAGAAGACAGAGCAAAGAAGG - Intronic
1059722763 9:116977351-116977373 AAGAGATGGCAGTAGAAGGAAGG - Intronic
1059845933 9:118276509-118276531 CAGAGAAGCTATCAGAAGGAAGG - Intergenic
1059877576 9:118652639-118652661 GAGAGAAGGAAGAAGAAGGGAGG + Intergenic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061006395 9:127930686-127930708 GAGAGAGGACAGGAGAGGGAAGG - Intronic
1061467278 9:130791556-130791578 CAAAGCAGGCAGAAGAAGGTGGG + Intronic
1061512959 9:131071992-131072014 TAAATAAGACAAAAGAAGGAGGG + Intronic
1061560083 9:131396300-131396322 AAGAAAAGAAAAAAGAAGGAAGG - Intronic
1062184142 9:135207664-135207686 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1203423950 Un_GL000195v1:20555-20577 GAAAGAAGAAAGAAGAAAGAAGG - Intergenic
1203467771 Un_GL000220v1:103901-103923 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1203475596 Un_GL000220v1:147877-147899 CAGAGAGGAAAGAAAAAAGAAGG - Intergenic
1185574897 X:1163614-1163636 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1185814482 X:3142347-3142369 AAGAGAAGAAAGAAGAAGAAAGG + Intergenic
1186020073 X:5245168-5245190 AAGTGAAGAAGGAAGAAGGAAGG - Intergenic
1186020088 X:5245269-5245291 GAAAAAAGAAAGAAGAAGGAAGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186059356 X:5687227-5687249 GAGAGAAGAAAGATGGAGGAAGG + Intergenic
1186136384 X:6526261-6526283 CAAAAAACAAAGAAGAAGGAAGG + Intergenic
1186185001 X:7012120-7012142 CAGAGAAGACATTAGAAGTAGGG - Intergenic
1186462689 X:9760928-9760950 AAGAGAGGAAGGAAGAAGGAAGG + Intronic
1186529357 X:10279647-10279669 GAGAAAAGACAAGAGAAGGAAGG - Intergenic
1186710763 X:12193840-12193862 AAGAAAAGAAAGAAAAAGGAAGG + Intronic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1186816857 X:13246571-13246593 AAGAGAAGAGAGGAGATGGAAGG + Intergenic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187264419 X:17718377-17718399 AAGAGAGGGAAGAAGAAGGAAGG + Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187708053 X:22026832-22026854 GAGGGAGGAAAGAAGAAGGAAGG - Intergenic
1187766557 X:22648989-22649011 GATAGAAGGCAGAAGAAAGATGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187840210 X:23479216-23479238 CAAAGCAGGCAGAAGAAGGTGGG + Intergenic
1188004937 X:25010776-25010798 AAGAGAAGAAGGAAGAAGGAGGG - Intronic
1188306754 X:28568599-28568621 CAGTGAAGACAGATGAATCAGGG - Intergenic
1188387182 X:29575512-29575534 CAAAGCAGGCAGAAGAAGGTGGG - Intronic
1188425361 X:30040778-30040800 AAGAGAGAAAAGAAGAAGGAAGG - Intergenic
1188468982 X:30515926-30515948 GAGAGAAGAGAGAAGCAAGAGGG - Intergenic
1188550241 X:31356355-31356377 GAGAAAGGACAGAAAAAGGAGGG - Intronic
1188626258 X:32288919-32288941 CTCAGAAGAAACAAGAAGGATGG + Intronic
1189698492 X:43691765-43691787 CAGACAAGGCAGTAGAAGAAAGG + Intronic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190568233 X:51753018-51753040 CAGAGAAGACAGGACACAGAGGG - Intergenic
1190994980 X:55598064-55598086 CAGAGAAAAAATAAGAAGAATGG - Intergenic
1191137781 X:57084094-57084116 CAGAGTAGACAAGTGAAGGAAGG + Intergenic
1192051094 X:67724569-67724591 CAGAGAGGAGAGGACAAGGAGGG + Exonic
1192064618 X:67868573-67868595 TATTGAAGACAGCAGAAGGATGG + Intergenic
1192137757 X:68620341-68620363 GAGAGGAGAGAAAAGAAGGAAGG - Intergenic
1192191019 X:68991176-68991198 GAAAGAAGAGAGAAGAAGAAAGG - Intergenic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1192888802 X:75366176-75366198 CACAGAAGAAACAAGAGGGATGG + Intergenic
1192917073 X:75664201-75664223 CCTAGAAGACAGCAGATGGATGG + Intergenic
1193188384 X:78539855-78539877 AGGAGAAGACAGAATAATGAAGG - Intergenic
1193202467 X:78708254-78708276 CAGAGAATACAGAAGACGTAAGG - Intergenic
1193367018 X:80646816-80646838 TAGAGAACACAGGAGAAAGAAGG - Intergenic
1193958883 X:87899159-87899181 CAGAGAAAGCAGAGGAAGAAGGG + Intergenic
1194139335 X:90190608-90190630 AAAAGAAGAAAGAAAAAGGAAGG + Intergenic
1194345642 X:92761275-92761297 CACAGAAGAAAGATGAAGGCTGG - Intergenic
1194597959 X:95882612-95882634 GAGAGAGGACAGTAGCAGGAGGG - Intergenic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1194946427 X:100074030-100074052 AAGAGAAGACATCAGAATGAAGG - Intergenic
1194967874 X:100309765-100309787 AAGACAAGACAGAAGAAAAAAGG + Intronic
1194973245 X:100367577-100367599 CTCACAAGACAGAAGATGGAAGG + Intronic
1195141191 X:101961800-101961822 CAGAGAAGCAGGAGGAAGGAAGG + Intergenic
1195234081 X:102879720-102879742 CAGAGAAGGGAGAAGAAGAGAGG - Intergenic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195504124 X:105637134-105637156 GAGAGGAGCTAGAAGAAGGAAGG + Intronic
1195512394 X:105732187-105732209 CAGAGAAGGCAGAAAAAGCATGG - Intronic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195732721 X:107982206-107982228 CGGAGAAGACAGATGAGGGGAGG - Intronic
1195746355 X:108122565-108122587 CAGAGGAGACAGAATAGGGTTGG + Intronic
1195861482 X:109388078-109388100 CAGAGCAGAGAGAAAAAGGTGGG + Intronic
1196000248 X:110775800-110775822 CAGAGAAGACAGAAAAAGAAAGG - Intronic
1196036115 X:111147057-111147079 GAGAGAGGAGAGGAGAAGGAGGG + Intronic
1196201934 X:112896490-112896512 CACAGAACAATGAAGAAGGAAGG + Intergenic
1196941227 X:120778086-120778108 AAGAGAAGAGAAGAGAAGGAAGG - Intergenic
1197561328 X:128025419-128025441 CAAAGAAGACAGAAAAATGTGGG - Intergenic
1197707727 X:129646548-129646570 CGGAGAGGGGAGAAGAAGGAAGG - Exonic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197872298 X:131071708-131071730 GAGAGAAGGAAGAAAAAGGAAGG - Intronic
1198069116 X:133130463-133130485 CAGCCAAGACAGATGAAGAAAGG + Intergenic
1198160917 X:134007324-134007346 GGGAGAAGAAAGAAGATGGATGG + Intergenic
1198384621 X:136116826-136116848 CAAACAAGACAGAATAGGGAGGG - Intergenic
1198709136 X:139482378-139482400 GAGATAAGAGAGTAGAAGGATGG - Intergenic
1198738603 X:139815819-139815841 TAAAGAGGACAGAAGAAGAATGG - Intronic
1199089309 X:143672259-143672281 CAAAGAAGAAAAAAGAAGCAAGG - Intergenic
1199598895 X:149528841-149528863 CACAGAGGAAAGAAGAAAGAAGG + Intronic
1199709593 X:150459792-150459814 AAGAGAAGAAAGGAGAAAGATGG + Intronic
1199713930 X:150492485-150492507 GAGAGAAGAGAAGAGAAGGATGG - Intronic
1199739522 X:150720309-150720331 CGGAGAAGGCAGAGGAAGTAGGG - Intronic
1200384245 X:155873899-155873921 CAAAGTAGGCAGAGGAAGGAAGG - Intergenic
1200653986 Y:5877926-5877948 CACAGAAGAAAGATGAAGGCTGG - Intergenic
1200803837 Y:7411740-7411762 CAGCAGAGACAGAAGAGGGAAGG - Intergenic
1201253891 Y:12088337-12088359 GAAAGAAGAGAGAGGAAGGAAGG - Intergenic
1201254391 Y:12092614-12092636 AAGAGAAAAGAAAAGAAGGAAGG + Intergenic
1201387729 Y:13461135-13461157 CAAAGAACAAAAAAGAAGGAAGG + Intronic
1201550410 Y:15211883-15211905 GAGGGAGGAAAGAAGAAGGAAGG + Intergenic
1201741302 Y:17326645-17326667 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1202081923 Y:21092498-21092520 CAGAAAAGCCTAAAGAAGGAAGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic