ID: 1022233621

View in Genome Browser
Species Human (GRCh38)
Location 7:28439683-28439705
Sequence ATCTTAGGAGATAGGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022233621_1022233626 -3 Left 1022233621 7:28439683-28439705 CCACACTGCCTATCTCCTAAGAT 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1022233626 7:28439703-28439725 GATGGCACTTTCAAAGGTGAAGG No data
1022233621_1022233627 24 Left 1022233621 7:28439683-28439705 CCACACTGCCTATCTCCTAAGAT 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1022233627 7:28439730-28439752 TATTCCCAGATGCCTCAAATTGG No data
1022233621_1022233624 -9 Left 1022233621 7:28439683-28439705 CCACACTGCCTATCTCCTAAGAT 0: 1
1: 0
2: 0
3: 20
4: 178
Right 1022233624 7:28439697-28439719 TCCTAAGATGGCACTTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022233621 Original CRISPR ATCTTAGGAGATAGGCAGTG TGG (reversed) Intronic
900550449 1:3251963-3251985 ATCTTAGGAGGGAGGCGGCGTGG - Intronic
901939139 1:12648765-12648787 AACTTAGGACAGAGGCAGAGAGG - Intronic
903018236 1:20375675-20375697 ACCTTAGGAGAGAGGCAGCCAGG + Intergenic
907744146 1:57195867-57195889 AGCTTTGTAGGTAGGCAGTGTGG + Intronic
910463707 1:87474592-87474614 ATCTTGGGAGGTAGGTCGTGAGG + Intergenic
910751922 1:90640477-90640499 TTTTTAGAAGATAGGAAGTGGGG + Intergenic
910976660 1:92913758-92913780 ATCAGAGGAGACAGGCAGAGAGG - Intronic
911060195 1:93740771-93740793 ATCTTAGGTGATAGGCATTAGGG + Intronic
911696280 1:100893873-100893895 ATCTTGGGGGATGGGGAGTGGGG + Intronic
914920586 1:151844694-151844716 ATCTTAGGAGAAAGGAAGGTGGG - Intergenic
915079215 1:153340198-153340220 TTCTTAGGAGATAGCCAAGGGGG - Intronic
915250577 1:154585418-154585440 CTCATAGGAGAGAGGAAGTGTGG + Intronic
916392363 1:164344481-164344503 ACCTTTGGAGGTAGGGAGTGAGG + Intergenic
916418179 1:164611801-164611823 TTTTTAGGAGATAGGGAGTGAGG + Intronic
916718295 1:167462961-167462983 ATCTGAGGAGACAGGCAATGAGG - Intronic
917686856 1:177425002-177425024 CTCTAAGGAGAAAGGGAGTGAGG - Intergenic
921066960 1:211630317-211630339 AACTCATGAGAGAGGCAGTGTGG - Intergenic
921359328 1:214316060-214316082 ATCCAATGAAATAGGCAGTGTGG + Intronic
921855957 1:219984708-219984730 ATCTTAGGGGCTAGGCATGGTGG - Intronic
922866219 1:228863560-228863582 AGCTTCTGAGAAAGGCAGTGTGG + Intergenic
923282177 1:232454299-232454321 ATCGTATGAAATAGGAAGTGAGG + Intronic
1063162833 10:3431962-3431984 ATCTGTGGAGATGGGCAGTGGGG + Intergenic
1069994522 10:72334374-72334396 ATCCTAGGAGAGAGGCGATGCGG + Exonic
1070402160 10:76062484-76062506 ATCATGGGAGAAAGGGAGTGAGG - Intronic
1071914506 10:90276926-90276948 ATCTTAGGAAAGATGCAGAGGGG - Intergenic
1073031058 10:100526267-100526289 GTCTTAGGAGATAGGAAGATAGG - Intronic
1073519012 10:104107927-104107949 ATCTTAATAGCTAGGCAGTGTGG - Intergenic
1074988050 10:118674683-118674705 ATCTTAGGAGCAATCCAGTGAGG - Intronic
1076149648 10:128151769-128151791 TTCTTAGGAGATGGCCAGTGGGG - Intergenic
1078822461 11:14895601-14895623 CTCTTAGGAGCCAGGCACTGAGG + Intergenic
1082752503 11:57034456-57034478 ATCTTAAGAAATAAGCAGAGTGG - Intergenic
1084413495 11:69017187-69017209 AACTTAGGTGGTAGGCAGGGAGG + Intergenic
1085617929 11:78015744-78015766 CTCTTAGGAGAAGGGGAGTGAGG + Exonic
1088680422 11:112236859-112236881 ATCTTAGTAGAGTGGTAGTGAGG + Intronic
1089050879 11:115544758-115544780 CTCTTAGGGCAAAGGCAGTGTGG + Intergenic
1089642743 11:119858495-119858517 AACTTAGGGGAGAGGCAGGGAGG + Intergenic
1090389469 11:126379263-126379285 ATCTTAGAGGATATTCAGTGTGG + Intronic
1093089072 12:14901457-14901479 ATTTTATGAGAGAGGCAATGTGG + Intronic
1094759596 12:33515566-33515588 AAATTAGGAGATCGGAAGTGAGG - Intergenic
1096912630 12:54999442-54999464 AACTTAGTAGGTAGGCAGGGTGG - Intergenic
1098097948 12:66980029-66980051 ATGTTAGGAGAATGCCAGTGAGG + Intergenic
1098168312 12:67719950-67719972 TTCTTAAGAGGTAGGCACTGGGG - Intergenic
1102849660 12:116228559-116228581 TTCTTAGGAAAGAGGAAGTGGGG - Intronic
1106596491 13:31144933-31144955 AGCTTAAGAGGGAGGCAGTGTGG - Intronic
1113374778 13:109754911-109754933 ATCAGAGAAGATAGGCACTGGGG + Exonic
1115314352 14:32010345-32010367 GTCTTTGGAGAAAGGCAGTATGG + Intronic
1117621716 14:57594021-57594043 ATCTTCGGTGACAGACAGTGGGG + Exonic
1117714456 14:58566467-58566489 ATCTCAGGACATAGGGAGTGAGG + Intergenic
1118801360 14:69192349-69192371 ATCATAGGAATTAGGAAGTGCGG + Intronic
1119156852 14:72419462-72419484 ATTGTAGGAGAGAGACAGTGCGG + Intronic
1121350056 14:93166360-93166382 ATATTAGGAGCTAGGCATGGTGG + Intergenic
1121889854 14:97579479-97579501 ATTTTAGGAGATTGGGAGTCAGG - Intergenic
1125105153 15:35962174-35962196 ATCTGTGGAGATAGGAAGAGTGG + Intergenic
1126421716 15:48480710-48480732 ATATTTGCAGATTGGCAGTGGGG - Intronic
1128708322 15:69853390-69853412 ATCTTTGCAGACAGGCAGGGTGG - Intergenic
1130179220 15:81608097-81608119 ATCTTAAGAGAGGGGCAGTAGGG - Intergenic
1133089755 16:3394926-3394948 GTGTTGGGAGATAGGCTGTGAGG - Intronic
1135501686 16:23001229-23001251 ATCCGAGGAGAGAGGCATTGAGG - Intergenic
1137072092 16:35912437-35912459 AGCTCAGGAGAGAGGCAGTAAGG + Intergenic
1137088998 16:36164767-36164789 ATCTTAGGGCATAGGGAGGGTGG + Intergenic
1138407405 16:56807719-56807741 ATTTTAAAATATAGGCAGTGTGG + Intronic
1142485805 17:247082-247104 ATCCTGGGAGAGAGGCAGAGGGG + Intronic
1144181982 17:12760896-12760918 CTCCTAGGACAAAGGCAGTGAGG - Intronic
1146626636 17:34440091-34440113 AGCTCAGGAGAAAGGCAGTGGGG - Intergenic
1147018678 17:37513006-37513028 ATTTTAAGAGATAGGGAGGGAGG + Exonic
1148921162 17:51036057-51036079 ATCTTAGAAGAAGGGCAGAGGGG - Intronic
1149010267 17:51849330-51849352 ATCTTATGTGCTAGGCACTGTGG - Intronic
1152066110 17:78113310-78113332 ATCTCAGGAGAAAGGCTGTGGGG - Intronic
1152871070 17:82753201-82753223 ATTTTAGGAGTCAGGCAGGGTGG + Intronic
1154519888 18:15215634-15215656 ATTTTAGGAAAAAGGCAGTTTGG - Intergenic
1155775290 18:29753439-29753461 TTCTTAGAAGAGAGGTAGTGTGG - Intergenic
1156297386 18:35805204-35805226 CTCTTATGAGATAGCCAGTGGGG - Intergenic
1158168296 18:54567169-54567191 AGATTAAGAGATAGGCAGTGTGG - Intergenic
1161733632 19:5977607-5977629 GGCTTAGGAGATAGGCAGCCAGG + Intronic
1162546699 19:11335245-11335267 TTCCCAGGGGATAGGCAGTGGGG + Intronic
1164086979 19:21911920-21911942 ATCTCAGGAGTTAGGCAATGGGG - Intergenic
928037807 2:27841793-27841815 ATCTTGAGAAATAGTCAGTGTGG + Intronic
929305933 2:40361628-40361650 CTCTTAGTTTATAGGCAGTGAGG - Intronic
930745022 2:54873632-54873654 ATTTTAGGAAAAAGGCAGTTTGG - Intronic
931854077 2:66283101-66283123 GTCTTGGGAGATAGGGGGTGGGG + Intergenic
935155476 2:100480397-100480419 ATCTTAGAAGCAAGGCAGGGAGG + Intronic
935448706 2:103185617-103185639 GTATTAGGAGATGGGCATTGGGG + Intergenic
937375600 2:121333806-121333828 ATCCTAGGAGATGGGAATTGGGG - Intergenic
937733218 2:125259585-125259607 ATCTTTGCAGACAGGCAGCGGGG - Intergenic
937826666 2:126374172-126374194 ATCTTTGCAGATGGACAGTGGGG + Intergenic
941044167 2:160653539-160653561 AGCTGAGGAGATAGGGACTGAGG + Intergenic
941668992 2:168270705-168270727 ATCTTTGCAGATAGACAGAGGGG - Intergenic
944481938 2:200166031-200166053 AACTTTATAGATAGGCAGTGAGG - Intergenic
944858464 2:203791304-203791326 TACCTAGGATATAGGCAGTGAGG + Intergenic
945199292 2:207265206-207265228 AAATTAGGAGCTAGGCAATGTGG - Intergenic
1171982800 20:31639118-31639140 ATCTCTGGAGTTAGGCAGGGAGG - Intronic
1173782823 20:45770808-45770830 ATTCTATGAGGTAGGCAGTGTGG + Intronic
1174784502 20:53419884-53419906 GTATTAGGAGATCGGCAGCGTGG - Intronic
1175168057 20:57060265-57060287 ATCTCAGGACAGAGGCAATGGGG + Intergenic
1178930378 21:36813441-36813463 TGCTTGGGAAATAGGCAGTGTGG - Intronic
1182013710 22:27021652-27021674 ATCCTATGAGATGGGCACTGTGG - Intergenic
1182860935 22:33558647-33558669 ATCAGAGGAGACAGGCAGGGCGG + Intronic
1183576663 22:38694914-38694936 ATCTGAGGACACAGACAGTGGGG - Intronic
949189180 3:1231100-1231122 CTCTTAGGAGAAAGGCAGGGAGG - Intronic
951689877 3:25384309-25384331 CTCTTAGGAGAGAGGGAGGGAGG - Intronic
952198735 3:31103092-31103114 ATGTTTGGAGATGGGCAGTGTGG + Intergenic
952403795 3:32987429-32987451 CTCTAAGGAGAAAGGAAGTGAGG - Intergenic
953225276 3:41013310-41013332 ATCTTTGGAGAGAGGAAGTTTGG - Intergenic
953365851 3:42344402-42344424 ATCTTTGGTAATAGGCTGTGGGG - Intergenic
953666694 3:44930703-44930725 ACCTGAGGAGATATGCATTGTGG - Intronic
954144035 3:48625512-48625534 ATCTGAGGAGACAGCGAGTGAGG + Intergenic
955114591 3:55984784-55984806 TTCTTGGGGGATACGCAGTGTGG + Intronic
955356519 3:58237175-58237197 ATCCTATGAGGTAGGCACTGGGG - Intergenic
960059700 3:113308534-113308556 ATCTTATGAGTTAGGAATTGTGG - Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960823864 3:121761947-121761969 ATCTTAGGAGATAGGTGGCAGGG + Intergenic
960826929 3:121797022-121797044 ATCTTAAGAGAAAGAAAGTGAGG + Intronic
962187726 3:133277711-133277733 ATCTCAGCAGAAAGGCTGTGAGG - Intronic
962889298 3:139657490-139657512 ATCTTAGGAGGTGTGTAGTGGGG + Intronic
965398071 3:168184615-168184637 ATTTTAGGAAGTAAGCAGTGAGG - Intergenic
966448264 3:180028135-180028157 ATCTGAGGAGGAAGGCAGTATGG - Intronic
967498399 3:190168249-190168271 ACCTTTGGAGGTAGGGAGTGAGG + Intergenic
969659879 4:8520339-8520361 ATATCAGGAGATGGGCAGTCTGG - Intergenic
970617032 4:17777698-17777720 ATCTCAGGATATAGATAGTGAGG + Intronic
971513097 4:27452250-27452272 ATTCTAGAAGAAAGGCAGTGGGG - Intergenic
976219525 4:82744824-82744846 ATCTTAGGAGAGAGACTGGGTGG + Intronic
978602316 4:110441768-110441790 TTCCCAGGAGATAAGCAGTGGGG + Intronic
978697932 4:111605625-111605647 ATCTTAGAAGAAAGGCACTATGG - Intergenic
981153927 4:141412172-141412194 ATCTGAGGAATTAGGCAGTTAGG + Intergenic
981502120 4:145463120-145463142 ACCTTTGGAGGTAGGGAGTGAGG + Intergenic
981528605 4:145732187-145732209 ATCTTACCAGAGAAGCAGTGGGG + Intronic
982397269 4:154925889-154925911 ATCCAGGGAGATAGGCAGTGAGG - Intergenic
983513478 4:168632946-168632968 ATGTTAGGAGAGGGGCAGCGGGG + Intronic
984790904 4:183613907-183613929 ATCTTGGGAGCTAGGGAGGGAGG - Intergenic
986225948 5:5812859-5812881 ATCTTAGGAGATGGGGCGTTTGG + Intergenic
986247620 5:6025117-6025139 ACCTCAGGAGAGAGGCAATGCGG + Intergenic
986806694 5:11314146-11314168 ATCTTAGGAGGTAGGGTCTGCGG + Intronic
986819558 5:11450464-11450486 ATCTTAGGACAGGGGAAGTGAGG + Intronic
988426628 5:31072732-31072754 ATATGAGGAGATAGGGAGAGTGG + Intergenic
989686916 5:44099943-44099965 ATGTTGGGCAATAGGCAGTGAGG + Intergenic
991496401 5:67230520-67230542 ATCTTAGAATCTAGGCAGAGTGG + Intergenic
996101773 5:119452044-119452066 ATTTTGGGAGGTAAGCAGTGGGG + Intergenic
1000403097 5:160853484-160853506 GTCTTAGGAGAAAGACAATGTGG - Intergenic
1002955949 6:1864715-1864737 TTGTTAGGCGATAGGCAGTGAGG - Intronic
1005032191 6:21520776-21520798 ATGCTAGCACATAGGCAGTGTGG + Intergenic
1005272567 6:24181606-24181628 CACTTAGGAGTTAGCCAGTGAGG + Intronic
1005562948 6:27060050-27060072 CTCTTTGCAGATAGACAGTGGGG - Intergenic
1006575480 6:35042246-35042268 AACTTAGCAGTAAGGCAGTGAGG + Intronic
1007151188 6:39693291-39693313 ATCTTAGGAGATAAAGTGTGAGG + Intronic
1007468032 6:42068903-42068925 AAATGAGGAGATAGGAAGTGGGG + Intronic
1008015896 6:46519363-46519385 ATCTAAGGACATAAGAAGTGGGG + Intergenic
1010795145 6:80109948-80109970 ATCTTAGTATATAAGTAGTGTGG - Intronic
1011488111 6:87864300-87864322 GTCTTAGGAGAAAGGGAGCGAGG + Intergenic
1011624856 6:89274357-89274379 ATCTTGAGAGCCAGGCAGTGGGG - Intronic
1013630386 6:111980663-111980685 ATCTTAGAACATAGGCTCTGTGG + Intergenic
1014916021 6:127149414-127149436 ATCTTATGAGAAGGGAAGTGAGG - Intronic
1016476502 6:144433732-144433754 ATCTCAGAAGATGGGCAGTCGGG + Intronic
1016738186 6:147502944-147502966 AGCTTTGGAGCAAGGCAGTGTGG - Intergenic
1016865438 6:148761321-148761343 TTCTTAGGAACTTGGCAGTGTGG - Intronic
1018103666 6:160463698-160463720 ATCTTAGGAGAAAGGCCATTTGG + Intergenic
1020634273 7:10677563-10677585 TTCTTAGGAGAAGGGCATTGTGG + Intergenic
1022233621 7:28439683-28439705 ATCTTAGGAGATAGGCAGTGTGG - Intronic
1027616512 7:80430905-80430927 ATCTTAGGAGTTAGGCAAGTGGG + Intronic
1029241468 7:99166282-99166304 ATAGTAGGTGCTAGGCAGTGTGG - Intergenic
1030087976 7:105833215-105833237 ATCTGAGGAAACAGCCAGTGAGG - Intronic
1030133853 7:106227295-106227317 CTCTATGTAGATAGGCAGTGAGG - Intergenic
1033148606 7:138893291-138893313 AAATTAGGAGATAGGGAGTGGGG + Intronic
1033352060 7:140569803-140569825 GTCCTAGGAGAGGGGCAGTGAGG - Intronic
1033436143 7:141335215-141335237 CTGTTAGGAGATGGGCAGAGGGG + Intronic
1034979407 7:155466700-155466722 TCCTTAGGAGAAAGGCAGGGCGG - Intergenic
1036803697 8:11812271-11812293 ACCTTAGGAAATAGACTGTGCGG - Intronic
1037178706 8:15976790-15976812 GTCTTAGGAGATTTGCAGTCTGG - Intergenic
1042795377 8:72656828-72656850 ATCTGATGAGATAGTCACTGAGG - Intronic
1044387484 8:91606734-91606756 GTCTTAAGAGAAAGACAGTGAGG + Intergenic
1046028549 8:108754878-108754900 AGCTTAGGAGTAAGGCAGAGGGG + Intronic
1046318045 8:112532891-112532913 TTCTTAGGAGATAGACAATATGG + Intronic
1048803673 8:138219222-138219244 AACATGGGAGATAGGAAGTGGGG + Intronic
1050249283 9:3727408-3727430 ATTTTAGGGGAAAAGCAGTGGGG - Intergenic
1050778377 9:9297814-9297836 AGCTTAGGACATTGGCAGTGGGG + Intronic
1051459142 9:17293706-17293728 ATCTTAGGCAAAAGGCAGGGTGG + Intronic
1052463448 9:28797868-28797890 ATTTTAGGGGATATGAAGTGGGG + Intergenic
1053281805 9:36825369-36825391 ATCTCAGGAGGTAGACACTGTGG - Intergenic
1055592842 9:77835788-77835810 TTGTTATGAGATAGGCACTGTGG - Intronic
1055676608 9:78669022-78669044 ATCCTAAGAGTTAGGCAGTAGGG + Intergenic
1056645656 9:88409476-88409498 ATCTTAGGGAATAGGCAGTCTGG + Intronic
1059465229 9:114465146-114465168 CTCTTAGGAAACAGGCATTGTGG - Intronic
1060382420 9:123188985-123189007 ATCTTCTGGGAGAGGCAGTGAGG - Intronic
1186080443 X:5925109-5925131 AGCTTATGAGATGGGCAGTTTGG - Intronic
1186284624 X:8030216-8030238 ATCTTGGCAAATGGGCAGTGAGG - Intergenic
1186839161 X:13468008-13468030 ATCTTATGAGATGGGCATGGTGG - Intergenic
1187577653 X:20575444-20575466 TTCTCAGGAGAAAGGAAGTGAGG - Intergenic
1188410706 X:29868833-29868855 AACTCATGGGATAGGCAGTGTGG + Intronic
1191749802 X:64529450-64529472 ATCTTAGGGCCTTGGCAGTGAGG + Intergenic
1192056422 X:67778315-67778337 ATCATAGGAGATATGCAGGAGGG + Intergenic
1192322851 X:70106035-70106057 AGTTTAGGAGCTAGGCACTGTGG + Intergenic
1193442787 X:81564118-81564140 ATAGTAGGAGCAAGGCAGTGGGG - Intergenic
1194222432 X:91211430-91211452 ATTTTAGTAGATAGTAAGTGAGG + Intergenic
1197236642 X:124073385-124073407 GTCTAAGGAGATAAGAAGTGTGG - Intronic
1198243497 X:134807373-134807395 ATCATGGGAGATAGGCGGTTCGG + Exonic
1199474551 X:148231135-148231157 ATTTTTGGAGATAAGGAGTGAGG - Intergenic
1199571127 X:149268417-149268439 ATCTTAGGAGGTAGGGACTGAGG - Intergenic
1199620607 X:149697236-149697258 ATTTGAGGAGAGAGGCGGTGAGG - Intronic
1200291134 X:154875192-154875214 ATCTTAGGTGCTAGGGACTGTGG + Intronic
1200558958 Y:4675204-4675226 ATTTTAGTAGATAGTAAGTGAGG + Intergenic