ID: 1022235195

View in Genome Browser
Species Human (GRCh38)
Location 7:28454278-28454300
Sequence GACTTCCAACAGAAGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022235195_1022235201 25 Left 1022235195 7:28454278-28454300 CCTCATAACTTCTGTTGGAAGTC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1022235201 7:28454326-28454348 TCCAAAGCTGCCACAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022235195 Original CRISPR GACTTCCAACAGAAGTTATG AGG (reversed) Intronic
901330873 1:8407520-8407542 CACTTGCAACAGAAGCTCTGTGG + Intronic
901925987 1:12566444-12566466 GACTTCCAACAGCCTTGATGTGG - Intergenic
903164849 1:21513140-21513162 GCCTTCCAACTGAAATTCTGGGG - Intronic
909893302 1:81035266-81035288 AGCTTCCAAAAGAAGTTAGGGGG + Intergenic
911064731 1:93777940-93777962 AATTTCCAACAGAATTCATGTGG + Intronic
911278707 1:95896333-95896355 GAGTTCCAACAGATGATATCTGG + Intergenic
913412424 1:118567233-118567255 TACTTCCAACTGATTTTATGAGG + Intergenic
915038197 1:152946347-152946369 AACTTCTAACAGAAGTTAGGAGG + Intergenic
917373559 1:174322719-174322741 GACTTCCAAGAACAGTGATGGGG + Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918212243 1:182361545-182361567 GACTTTCAACTGATTTTATGAGG + Intergenic
919921922 1:202171271-202171293 GACTTCCTGCTGAAGTTAAGTGG + Intergenic
924651323 1:245930082-245930104 GACTTACAACAGAATTTATCTGG + Intronic
1064132525 10:12722580-12722602 TACTTCATAGAGAAGTTATGAGG + Intronic
1064474629 10:15674065-15674087 GACTTCCAACAGAAAGACTGTGG - Intronic
1073006650 10:100330085-100330107 GACTTCCCACAGCATTCATGGGG + Exonic
1074352264 10:112749153-112749175 GAATTAGAACAGAAGTGATGTGG - Intronic
1074594253 10:114845913-114845935 GACTCCCAACTGAATTAATGTGG - Intronic
1074880119 10:117650086-117650108 GGCATCCAACAGAAATTATTAGG - Intergenic
1078918117 11:15799966-15799988 GTCTTCCAACAAAAGATATAAGG + Intergenic
1080058385 11:27931408-27931430 GACAGCTAACAGCAGTTATGGGG - Intergenic
1082975681 11:59069354-59069376 CACTTCCCAAAGAAGATATGTGG - Intergenic
1086080675 11:82900227-82900249 TACTTCCAACAGAAGGTAAGGGG - Exonic
1086113446 11:83222694-83222716 AAGTTCCAACAGAAGTGAGGGGG + Intronic
1086344492 11:85882366-85882388 TACTTCCATCAGACATTATGAGG - Intronic
1091556465 12:1577278-1577300 GAGTTCCAACAGCAGTGAGGTGG - Intronic
1094049711 12:26205599-26205621 AACCTCCAACAGAATTGATGAGG - Intronic
1095156550 12:38863451-38863473 GCTTTCAAACAGAAGTAATGAGG + Intronic
1095220959 12:39613919-39613941 CCCTTCCAACAAAAATTATGCGG + Intronic
1097430792 12:59503512-59503534 GCCTTCCAAGAGAAGTCAAGGGG + Intergenic
1099022043 12:77418351-77418373 GACTTCCAACCAAAGTTACATGG + Intergenic
1099528537 12:83745464-83745486 GCCTACCAAGAGAAGGTATGAGG + Intergenic
1100163985 12:91895191-91895213 CACTTGCAACAGAAACTATGTGG + Intergenic
1102682795 12:114702061-114702083 GTCTCTCAACAGAAGCTATGTGG + Intergenic
1106259501 13:28053123-28053145 GAATTGCAACAGAACTTAAGAGG + Intronic
1107916261 13:45154583-45154605 GACTTGAAACAGAAATAATGAGG - Intronic
1109753663 13:66729502-66729524 GACTTCCTACTGAAGCTAAGAGG - Intronic
1110433551 13:75454676-75454698 GCTTTCCAACAGAATTTATGGGG + Intronic
1116849661 14:49894545-49894567 GACTTCCAGCAGATGGGATGGGG + Exonic
1117379995 14:55152487-55152509 GATTTCCAACGGAAATTCTGGGG + Intronic
1117517092 14:56512614-56512636 GGCTTACCACAGAAGTTATCTGG - Intronic
1120899622 14:89564659-89564681 GACTTCCAACAGATCTTTTTAGG - Intronic
1122267965 14:100555453-100555475 CACTTCCAACAGAAGGTGGGGGG + Intronic
1123716031 15:23032752-23032774 TCCTTCAAACAGCAGTTATGTGG - Exonic
1123906258 15:24924529-24924551 TACTTTCAACTGAGGTTATGTGG - Intronic
1127982394 15:64044917-64044939 GGCTGCCAACAGAAGGGATGGGG + Intronic
1144271531 17:13621941-13621963 GAGTTCCAGCAGAAGTTTTAGGG - Intergenic
1150246178 17:63677121-63677143 AACTTCCGAAAGAAATTATGAGG + Intronic
1150475035 17:65468462-65468484 GACTTACATAAGATGTTATGCGG - Intergenic
1151496527 17:74461363-74461385 AACTCCCAACAGAAGGAATGGGG - Intergenic
1153745871 18:8179024-8179046 GACTGCATACAGAAGGTATGAGG + Intronic
1157146235 18:45165489-45165511 AACTTCTCACAGAAGTGATGGGG - Intergenic
1157406917 18:47429381-47429403 GGGTTCCCACAGAAGTTATGGGG - Intergenic
1157739850 18:50082845-50082867 GACTTCTAACACCAGATATGTGG + Intronic
1159057496 18:63480467-63480489 CACTTTCAACAGAAGTCATTAGG + Intronic
1159187988 18:65003323-65003345 GTCATCCAACAGGAATTATGGGG + Intergenic
1159739247 18:72144805-72144827 GACTTTCAAAATAAGTAATGAGG + Intergenic
1164756226 19:30691774-30691796 GACATCCAACTGCAGTTACGAGG + Intronic
928468933 2:31554155-31554177 TACTCACAACAGATGTTATGTGG - Intronic
928737305 2:34307022-34307044 TACTTCCACCTGAAGTCATGGGG + Intergenic
929949165 2:46393254-46393276 GATTTCCAACAGCAGGTATCAGG + Intergenic
930832944 2:55764648-55764670 GGCTACCAAGAGAAGTTTTGTGG - Intergenic
932442418 2:71745961-71745983 GAATTCCAACATGAGTTTTGAGG - Intergenic
932792497 2:74667950-74667972 GACATCCAACTGAAGATGTGTGG - Intronic
933165902 2:79074377-79074399 AAATTCCAACATAAGTTTTGTGG - Intergenic
937745727 2:125411519-125411541 TACTTCCACCAGAAGTTCTTGGG - Intergenic
941206147 2:162575507-162575529 GAGATCCAATAGAAGTTAAGGGG - Intronic
941334208 2:164221107-164221129 AGCTTCCAAAAGAATTTATGAGG + Intergenic
941646269 2:168045011-168045033 TACTTTCAACAGAAGTTACAAGG - Intronic
941882377 2:170494423-170494445 GAGGGCCATCAGAAGTTATGTGG + Intronic
943154524 2:184157181-184157203 GATTTCCAACACTAGTTACGAGG - Intergenic
944856593 2:203774015-203774037 GACTTCCAACAAAAGTCCAGTGG - Intergenic
947236201 2:227943862-227943884 GACTCACAACAGAACTTATCTGG - Intergenic
947693179 2:232158994-232159016 AAGTTCCAACTGAAGATATGGGG - Intronic
948382716 2:237561992-237562014 GAATTCCATCAGAATTTGTGGGG - Intergenic
948504078 2:238416104-238416126 GTCTCCCACCAGAAGTCATGTGG + Intergenic
1173082642 20:39883938-39883960 TAATTCCATCAGAAGTTATCGGG - Intergenic
1173498186 20:43534019-43534041 TTCTCCCAACAGAAGTTATCAGG - Exonic
1177908761 21:27003693-27003715 GCATTCTATCAGAAGTTATGTGG + Intergenic
1178242762 21:30921778-30921800 GCCTCCCAAGAGAAGATATGTGG + Intergenic
1181646586 22:24234489-24234511 GAGTCCCAAGAGAAGTTTTGGGG - Intronic
1185180235 22:49355721-49355743 GGCTTCCAACAGAAGCCACGGGG - Intergenic
950986236 3:17371140-17371162 GACATGTTACAGAAGTTATGTGG + Intronic
951637448 3:24795193-24795215 GACTGACAACAGAGGTAATGTGG - Intergenic
953443856 3:42945347-42945369 TACTTGCAACAGAAATTATATGG + Intronic
953849210 3:46453321-46453343 TACTTCTAACTGAAGTTGTGGGG + Intronic
954333761 3:49904305-49904327 CACTTACAAGAGATGTTATGGGG + Intronic
961694188 3:128692882-128692904 CACTGCCAACAGCAGATATGCGG + Intergenic
964632753 3:158830653-158830675 GCCTTCCAGCAGAAGTAGTGTGG - Intergenic
965443056 3:168739878-168739900 GAATTCAAAAAGAAGTCATGTGG - Intergenic
970687794 4:18588186-18588208 GAATTCCCACAGATGTTAAGTGG - Intergenic
971061523 4:22977466-22977488 AACTCCCAAGAGAAGTTATGAGG + Intergenic
975345139 4:73284596-73284618 TACTTCCAGCAGTAGTTATAGGG + Intergenic
982536314 4:156610469-156610491 TACTTTCAAAAGGAGTTATGAGG + Intergenic
983991314 4:174123408-174123430 CACTTCAAACAGAAGTCAAGGGG - Intergenic
988901838 5:35741314-35741336 GACTGACAACAGAAGTGATTGGG + Intronic
989469358 5:41797058-41797080 GACTTCCCACAGGACTGATGAGG - Intronic
991469110 5:66948576-66948598 GAGTACCAAGAGTAGTTATGTGG - Intronic
993173626 5:84453218-84453240 GAAATCCTACAGAAATTATGAGG + Intergenic
999908975 5:156175708-156175730 GACTTCCAAGTGAATTTATTTGG - Intronic
1000675239 5:164113902-164113924 GGCTTCCATCAGAAGCTATGAGG + Intergenic
1005753770 6:28907370-28907392 GACTAACAACAGAGGTTCTGGGG - Intronic
1006614550 6:35317731-35317753 GGCTTGCATCATAAGTTATGGGG - Intronic
1012911161 6:105119491-105119513 GAATTCCCACAGACGGTATGAGG + Intronic
1012938689 6:105394992-105395014 CATTTCCAACAGAAGTCATTAGG + Intronic
1013209302 6:107972548-107972570 GAGTTACAACAGTAGTGATGAGG + Intergenic
1021693995 7:23258759-23258781 TAGTTCCATCAGAAGTTATAAGG - Intronic
1022235195 7:28454278-28454300 GACTTCCAACAGAAGTTATGAGG - Intronic
1024439695 7:49402515-49402537 GACTTCCAATAGAAAATCTGGGG + Intergenic
1028519873 7:91717948-91717970 AACTTTCAACACCAGTTATGTGG + Intronic
1029308222 7:99637975-99637997 GACTTCCAGCAGATGGGATGGGG - Intergenic
1031253657 7:119420013-119420035 GATTTTCAACAGTAGTTGTGGGG + Intergenic
1033160810 7:138994863-138994885 GGCTTCTAATAGAAGTTATAAGG + Intergenic
1035094061 7:156339071-156339093 GACTTGCACCAGAATTTATAAGG + Intergenic
1035797751 8:2375029-2375051 AAATTCCAAAAGAATTTATGGGG - Intergenic
1036290936 8:7489603-7489625 GAAGTTCAAGAGAAGTTATGTGG + Intergenic
1036330554 8:7821934-7821956 GAAGTTCAAGAGAAGTTATGTGG - Intergenic
1036711158 8:11079495-11079517 GACTTCCAAATGATCTTATGTGG - Intronic
1037472355 8:19223322-19223344 GACATCAAAAAGAAGTAATGTGG + Intergenic
1037543989 8:19899853-19899875 GACATCCAACAGAATATGTGTGG + Intergenic
1038926712 8:32148638-32148660 TACTTCCAACAGAGGTCATTTGG - Intronic
1039770634 8:40683482-40683504 GGTGTCCAACAGATGTTATGAGG - Intronic
1042501914 8:69517649-69517671 GACTTCAAACAGTAACTATGGGG + Intronic
1043100418 8:76038477-76038499 GATTTCCAAGAGGAGATATGTGG - Intergenic
1043148708 8:76685451-76685473 GACATCCTAAAGAAGTTGTGAGG + Intronic
1049811540 8:144576375-144576397 GACTTCCATGAGAAGCTCTGTGG - Intronic
1050492304 9:6200857-6200879 CACTCCCAACAGAATATATGAGG - Intergenic
1053257814 9:36633556-36633578 TACTTCCCAGAGAAGTTATGAGG + Intronic
1056205483 9:84315691-84315713 GATTTCCAACAGAATTAGTGGGG + Intronic
1058152632 9:101479239-101479261 GGCTTCCATCAGCAGTGATGTGG - Intronic
1059370111 9:113823768-113823790 GGCCTCCAACAGAAGCCATGCGG + Intergenic
1060583721 9:124772709-124772731 GAAGTCCACCAGAAGTGATGGGG + Intergenic
1195033783 X:100952016-100952038 GAATTCCAACTGATTTTATGAGG + Intergenic
1195145280 X:102008259-102008281 GATTTTCAACAAAAATTATGAGG + Intergenic
1198432928 X:136586061-136586083 GAGTTCCACCAGTAGTTAAGAGG + Intergenic