ID: 1022240764

View in Genome Browser
Species Human (GRCh38)
Location 7:28510524-28510546
Sequence GCAGCTAGAAGTTTTAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022240764 Original CRISPR GCAGCTAGAAGTTTTAAAGG TGG (reversed) Intronic
905938465 1:41843553-41843575 GCAGCTAGGAGTGCTAAAGACGG + Intronic
909937177 1:81565574-81565596 GCTGCCAGAAGTTTTCAATGCGG - Intronic
913447415 1:118964525-118964547 GCCCCTGGAAGTTTTCAAGGAGG - Intronic
914854001 1:151336866-151336888 CCAGCTAGAATGTTTAAAGTTGG + Intergenic
915656264 1:157363623-157363645 GCTGTTTGAAGTTTTAAACGTGG + Intergenic
916393530 1:164359786-164359808 GCAGGTGGAAGATTTTAAGGAGG - Intergenic
917163509 1:172084629-172084651 GTAGCTATAAATTTTAAAGTTGG + Intronic
917480414 1:175406866-175406888 GCAGCCAGAGATTTTCAAGGGGG + Intronic
919971141 1:202580034-202580056 TCAACTAGAAGAGTTAAAGGAGG - Intronic
922888928 1:229045749-229045771 GCAGATAGAAAGTTGAAAGGGGG + Intergenic
923240061 1:232075705-232075727 GCAGCTAGAATTTGCAGAGGAGG - Intergenic
923795074 1:237145812-237145834 GAAAATAGAAGTTTTAAGGGAGG + Intronic
924109487 1:240683955-240683977 GCAGTTAGGAGGTTAAAAGGAGG + Intergenic
1063573024 10:7234066-7234088 GTAGCTAGAAGATTTCAAGAGGG - Intronic
1066234856 10:33475907-33475929 GCAGTTAGAAGGATTAAATGAGG - Intergenic
1068948551 10:62754759-62754781 GCACCTACAAGTTTCAAAGCAGG + Intergenic
1073089570 10:100923245-100923267 GAAGCTAGAAGTTTGAAATCAGG + Intronic
1074332940 10:112537808-112537830 GCAGATAGAAATTTTAAAACAGG - Intronic
1080022289 11:27575211-27575233 GCAATGAGAATTTTTAAAGGGGG - Intergenic
1080186972 11:29501576-29501598 TCAGCAAGGAGTTTGAAAGGTGG + Intergenic
1081734301 11:45392487-45392509 GCAGAGACAAGTCTTAAAGGAGG + Intergenic
1084869305 11:72085967-72085989 GCAAACAGAAGCTTTAAAGGAGG - Intronic
1084990962 11:72925362-72925384 CCAGCTGGAATTTTTAAAGTAGG - Intronic
1085825768 11:79845578-79845600 GCATCTAGTTGTTTTAAAGTAGG - Intergenic
1086842900 11:91709987-91710009 GCAACTAGAAGCTTTTAAGATGG - Intergenic
1087042558 11:93815997-93816019 ACAGGTAAAGGTTTTAAAGGTGG - Intergenic
1088668060 11:112114351-112114373 GCAGGTACAGATTTTAAAGGAGG + Intronic
1090138563 11:124227332-124227354 ACTGCTAGAAGTTTTTAAGCAGG + Intergenic
1090242632 11:125194670-125194692 GCAGCAAGCAGTTTAAAAGGAGG - Intronic
1094458065 12:30660386-30660408 GCAGCTGTAGGTTTTAAATGGGG + Intronic
1096298796 12:50407484-50407506 GCAAATAAAAGTTTTAAAAGAGG + Intronic
1099139973 12:78960763-78960785 CTAGCTAAAAGTTTTAAAGAAGG + Intronic
1100337555 12:93645988-93646010 GGAGCTTGAAGTTCTAAATGAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1104079314 12:125416374-125416396 GGAGCCAGAGGTTTTAAAGCAGG - Intronic
1105337060 13:19482460-19482482 TCAGTTTGAAGTTTGAAAGGAGG - Intronic
1106557961 13:30826563-30826585 GAAGCAAGAGGTATTAAAGGGGG - Intergenic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1108632309 13:52297738-52297760 TCAGTTTGAAGTTTGAAAGGAGG - Intergenic
1108654392 13:52514856-52514878 TCAGTTTGAAGTTTGAAAGGAGG + Intergenic
1109123641 13:58489408-58489430 GCAGCTATAACTTTAAAATGAGG - Intergenic
1109609325 13:64742426-64742448 ACAGCTAGAATTTTGATAGGTGG - Intergenic
1110752293 13:79129105-79129127 ACAGCAAGAATTTTTCAAGGAGG + Intergenic
1116344254 14:43770448-43770470 GCAGACAGAATTTTTAAAAGGGG - Intergenic
1116542127 14:46111866-46111888 GCAGCAAGAAGAGTCAAAGGGGG - Intergenic
1116596778 14:46858734-46858756 GCAGATAGAGGCTTTAAAGAAGG - Intronic
1118484218 14:66198574-66198596 GCAGCTGGAACTGTTAAAAGGGG - Intergenic
1119905991 14:78302538-78302560 GTAGCTAGAAGGCTTAAACGTGG - Intronic
1120446655 14:84606721-84606743 GGACCTAGAGGTTTTAAAGGAGG - Intergenic
1120574961 14:86170329-86170351 GATGCTAGTAGATTTAAAGGAGG - Intergenic
1123470414 15:20547381-20547403 GGACCTAGAAGATTTAGAGGAGG - Intergenic
1123748854 15:23339784-23339806 GGACCTAGAAGATTTAGAGGAGG - Intergenic
1124281226 15:28363667-28363689 GGACCTAGAAGATTTAGAGGAGG - Intergenic
1124301477 15:28547954-28547976 GGACCTAGAAGATTTAGAGGAGG + Intergenic
1124531133 15:30507664-30507686 GGACCTAGAAGATTTAGAGGAGG + Intergenic
1124767522 15:32500032-32500054 GGACCTAGAAGATTTAGAGGAGG - Intergenic
1126198627 15:45959281-45959303 TCTCATAGAAGTTTTAAAGGTGG - Intergenic
1127695784 15:61445580-61445602 ACAGATAGCAGTTTTAAATGTGG - Intergenic
1130715307 15:86328160-86328182 GGAGCTGGAAGTTTTATAGTTGG - Intronic
1131022177 15:89108200-89108222 GAAGCTAGAAGTTTGAAAACAGG + Intronic
1132306208 15:100814980-100815002 CAAGCAAGAATTTTTAAAGGTGG - Intergenic
1134156528 16:11848484-11848506 GGAGCTAAGAGTTTTAAAGAAGG - Intronic
1137327607 16:47457558-47457580 TCAGCTACAGGTTTTAAAAGTGG + Intronic
1138010081 16:53371007-53371029 GGACCTAGAAGATTTACAGGAGG - Intergenic
1143428919 17:6864793-6864815 GCAGCTGGAGTTTCTAAAGGTGG - Intergenic
1148023936 17:44572510-44572532 ACAACTAAAAGTTTTAAAGGAGG - Intergenic
1153715098 18:7839487-7839509 GGAGCTAGAAGCTGGAAAGGGGG + Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1155866277 18:30969252-30969274 GTAACTAGAAGTTATAAATGAGG + Intergenic
1157101100 18:44730713-44730735 GCAGCTAGAAGAGTTACAGTGGG + Intronic
1161163997 19:2775843-2775865 ACAGCTCAATGTTTTAAAGGGGG + Intronic
1162784179 19:13023899-13023921 GAAGGTAAATGTTTTAAAGGGGG - Intronic
926600414 2:14837817-14837839 CCAGATAGAAGTTTTCAATGTGG - Intergenic
928525532 2:32135837-32135859 GAAGGAAGAAGTTTTAAAGAAGG + Intronic
928525612 2:32136726-32136748 GAAGGAAGAAGTTTTAAAGAAGG + Intronic
928727213 2:34188515-34188537 ACAGATAGAAGAATTAAAGGTGG + Intergenic
929204285 2:39273327-39273349 GAAGCAAGAAGTTCTGAAGGAGG + Intronic
932363851 2:71133192-71133214 GGACCTAGAAGATTTAGAGGAGG + Exonic
936558312 2:113514989-113515011 GAAGCTAGAAGTTCAAAACGAGG + Intergenic
936573001 2:113631983-113632005 GCAGCTTGAATTGTAAAAGGAGG - Intronic
936797083 2:116219247-116219269 GCAGTTTGAATATTTAAAGGTGG - Intergenic
938122092 2:128641214-128641236 GAAGGTAAAAGATTTAAAGGCGG - Intergenic
939007500 2:136806301-136806323 GCAGCTAGGAGTTGGGAAGGTGG - Intronic
942431989 2:175921447-175921469 GCATCTAAAAGTATTAAAAGGGG - Intergenic
942788659 2:179733023-179733045 AAAAGTAGAAGTTTTAAAGGAGG + Intronic
943045144 2:182851738-182851760 CCAGGTAGAAGTGTTACAGGAGG + Intronic
943387167 2:187216450-187216472 ACAGCTAAAAGTGGTAAAGGTGG + Intergenic
944661692 2:201926673-201926695 TCAGCTTGAAGTTTTCAAGAAGG + Intergenic
946487891 2:220118222-220118244 GCAGGTTGCAGTTTTAAATGAGG - Intergenic
946523838 2:220496542-220496564 ACAGCTAGAAGAATTGAAGGAGG - Intergenic
948399839 2:237675662-237675684 GCAGGTACTACTTTTAAAGGGGG - Intronic
1169093583 20:2876041-2876063 GCTACTAGAGGATTTAAAGGAGG + Intronic
1173205881 20:40992750-40992772 GCTGCTATAAGTTTTTAAGAAGG - Intergenic
1173699746 20:45058390-45058412 GCAGGTTGAAGTTTTAAAATTGG - Intronic
1174430216 20:50462702-50462724 GAAGCTTGGAGTTTTAAAGCTGG + Intergenic
1176736504 21:10552722-10552744 TCAGTTTGAAGTTTGAAAGGAGG + Intronic
1177448944 21:21239580-21239602 TCATCTAAAAGTTTTAAAGGAGG - Intronic
1183046602 22:35225657-35225679 TCAGACAGGAGTTTTAAAGGTGG + Intergenic
1183532634 22:38369958-38369980 TCAGTTTGAAGTTTGAAAGGAGG - Intronic
1185427187 22:50778891-50778913 GCAGCTTGAATTGTAAAAGGAGG + Intronic
951646076 3:24892424-24892446 GCAGATAGAACTTATGAAGGTGG + Intergenic
952165933 3:30748753-30748775 GCAGCTAGAATTTTTAACCTGGG + Intronic
952799636 3:37276998-37277020 GTAGCTACAAATATTAAAGGAGG + Intronic
953007693 3:38993450-38993472 GAAACTAGAAGTTTTAGAGGAGG - Intergenic
955270209 3:57490548-57490570 GCAGATAGAAACATTAAAGGTGG - Intronic
956800694 3:72755380-72755402 CCAGCTTGAGGTATTAAAGGTGG - Intronic
957802406 3:85102462-85102484 TCAGCTAGAGGTTAAAAAGGAGG - Intronic
959133695 3:102390382-102390404 GCAGATAGAAGTATAAAATGTGG - Intronic
960322510 3:116253703-116253725 GAACCCAGAAGTTTTAAAGCAGG + Intronic
960847250 3:122015965-122015987 GCTGTTAGAGGTTTTTAAGGAGG - Intronic
961868207 3:129969468-129969490 GAAACTAGAAGATTTAAAGGAGG - Intergenic
962952480 3:140232191-140232213 GCATCAATAAGTTTTGAAGGTGG - Intronic
964222723 3:154365291-154365313 GAAGGCAGAAGTTTCAAAGGAGG - Intronic
970393833 4:15645040-15645062 GCAGGCAGAAATTTTAAAGAGGG + Intronic
971849659 4:31967827-31967849 GCAGGCACAAGTTTTAAGGGAGG + Intergenic
974431923 4:61809570-61809592 GCAGCTAGCAATTTTAAATAGGG - Intronic
975731960 4:77346318-77346340 TCAGGAAGAAGTTTTAAAGGTGG + Intronic
982426453 4:155267819-155267841 GCAACTAGGAGTTTGAAAGTTGG + Intergenic
983077085 4:163339068-163339090 GCAGCTAAAAGATTTAAACTGGG - Intronic
983853438 4:172612165-172612187 GCAGGAAGAATTTTTAAAGTTGG + Intronic
985608785 5:874255-874277 GCAGCTAGAATTTTAAGAGCTGG - Intronic
987115011 5:14719207-14719229 GGAGCAATAAGTTTTGAAGGCGG + Intronic
988424750 5:31050634-31050656 GCAGGGACAAGATTTAAAGGTGG + Intergenic
990555216 5:56927066-56927088 GCTGCTAGAAGTTGTTAGGGAGG + Intronic
991443590 5:66677126-66677148 GAAGTTAAAAGTTTTAAAAGTGG + Intronic
998219615 5:140266025-140266047 TCAGCTAGAAGTTTGCTAGGTGG - Intronic
999197125 5:149790013-149790035 CCAGCTAGAAGTGGTAGAGGCGG - Intronic
1000027638 5:157373843-157373865 GCAGATAAATTTTTTAAAGGAGG - Intronic
1003428794 6:6020088-6020110 ACACCTAGAAGGTTTAAAAGTGG + Intergenic
1007930066 6:45682669-45682691 GTAGCTAGAAGTGAAAAAGGAGG - Intergenic
1008295279 6:49768251-49768273 GCAGCTATAAGTTACAAAAGAGG + Intergenic
1013063421 6:106660035-106660057 GCAGCTAGAATTTGCAAAGCAGG - Intronic
1014208447 6:118682540-118682562 GCAGCAAAATGTTTTAAAGAAGG + Intronic
1015356475 6:132282710-132282732 GCACCTAGAAGTCTGAAATGAGG + Intergenic
1015950193 6:138545335-138545357 GTAGCTAAAAGTTTAAAAGAAGG - Intronic
1016493548 6:144633973-144633995 GCAGCTAGACATTTAAAAGCAGG - Intronic
1016917640 6:149259710-149259732 CCATGGAGAAGTTTTAAAGGTGG - Intronic
1018934795 6:168266621-168266643 GCAGAAATAAGTTGTAAAGGTGG - Intergenic
1020434729 7:8150793-8150815 GCAGCTGTATTTTTTAAAGGTGG + Intronic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1022683652 7:32574282-32574304 GCACATAGGAGTTTTAAAGTAGG + Intronic
1024922623 7:54575412-54575434 GCAGTTAGAATTTTAAAAAGAGG + Intergenic
1025244596 7:57307084-57307106 GAAGCTTGGAGTTTTAAAGCTGG - Intergenic
1029046861 7:97639238-97639260 TCAGCTGGAAGATTCAAAGGAGG - Intergenic
1030267930 7:107639745-107639767 CCAGCTGGAATTTCTAAAGGTGG - Intergenic
1030590519 7:111475764-111475786 GCAGGTAGACGTTTTACAGAAGG - Intronic
1030773351 7:113502234-113502256 ACAACTAGAAGGTTTTAAGGAGG + Intergenic
1031527826 7:122842774-122842796 ATAGCTAGAAGGTGTAAAGGAGG + Intronic
1032622998 7:133557022-133557044 GCACTTAGAATTTCTAAAGGTGG - Intronic
1032810236 7:135406762-135406784 GGAGCCACAAGTTGTAAAGGGGG - Intronic
1035903857 8:3487658-3487680 CCAGATAGAATTTTCAAAGGAGG + Intronic
1036561128 8:9901346-9901368 GCATCTGGAGGTTTTACAGGAGG + Intergenic
1037295111 8:17391266-17391288 GCAACTGGAAGGTTTACAGGGGG + Intronic
1040032430 8:42838057-42838079 GCAGCTTGAAAAATTAAAGGAGG - Exonic
1041054342 8:53967682-53967704 GTAGCTACAAATATTAAAGGAGG - Exonic
1041612045 8:59862360-59862382 GAAGCTGGAAGTTTTCAATGGGG - Intergenic
1042190322 8:66179060-66179082 GCAGATAGACGTTTAAAAGCTGG - Intergenic
1042860833 8:73311916-73311938 GCAACTAGAATATTTAAAGTTGG + Intronic
1045556298 8:103217918-103217940 GCAGCTGCTAGTTTTAATGGAGG + Intronic
1049894552 9:101277-101299 GAAGCTAGAAGTTCAAAACGAGG - Intergenic
1051583541 9:18703172-18703194 TGAGCTAGAAGCTTTAAAGAGGG - Intronic
1051799200 9:20912559-20912581 GCAGGTAGATTTTTTAAATGGGG + Intronic
1052202459 9:25799427-25799449 GGGCCTATAAGTTTTAAAGGTGG - Intergenic
1053735758 9:41101267-41101289 GAAGCTAGAAGTTCAAAACGAGG - Intergenic
1054692618 9:68330131-68330153 GAAGCTAGAAGTTCAAAACGAGG + Intronic
1057026197 9:91735531-91735553 GCAGCTAGCATTTTAAAAGATGG + Intronic
1059537079 9:115090844-115090866 GCAGCTTGATGTTGTAAACGTGG + Exonic
1062361319 9:136189650-136189672 GCAGCTGGGAGTTTTATGGGCGG - Intergenic
1187076863 X:15944150-15944172 GCAGAAAGAACTTGTAAAGGAGG + Intergenic
1188695979 X:33191344-33191366 GCATCTTGAATTTTTAAAGGAGG - Intronic
1188763943 X:34067354-34067376 ACACTTAAAAGTTTTAAAGGAGG - Intergenic
1189746046 X:44169966-44169988 GCAGCTAGAAGTGCTGAAAGTGG + Intronic
1196843338 X:119878838-119878860 GAAGATAGAAGATTTAACGGTGG + Intergenic
1198558546 X:137823337-137823359 GCATTGAGAAGATTTAAAGGTGG - Intergenic
1198882777 X:141299140-141299162 GCAATTGGAAGTTTTAAAGCAGG - Intergenic
1200279918 X:154768444-154768466 GGGGCTAGAAGTTTTAGAGCTGG + Intronic
1202594775 Y:26525916-26525938 TCAGTTTGAAGTTTGAAAGGAGG + Intergenic