ID: 1022241107

View in Genome Browser
Species Human (GRCh38)
Location 7:28513400-28513422
Sequence CTACTAGGATTAAGCAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022241107 Original CRISPR CTACTAGGATTAAGCAAACA CGG (reversed) Intronic
905844512 1:41217401-41217423 CTATTAATATTAAGCAAAAAAGG + Intronic
906042753 1:42801360-42801382 GTTTTAGGATTAAGAAAACACGG - Intergenic
910724257 1:90322166-90322188 CTACTAGGATTAAGGTTAGATGG - Intergenic
911182059 1:94870015-94870037 CTACTAGGATTTAGTGAAGATGG - Intronic
913041988 1:115036005-115036027 CTACTAGGCTCAACCAAACCTGG + Intergenic
918761485 1:188416077-188416099 TTAATAGGATTAAGCTAAAAAGG - Intergenic
919207278 1:194434315-194434337 CTACTGGAATTAAGTACACATGG + Intergenic
921450580 1:215301255-215301277 CTAAGAGGGTTAAGCCAACAGGG + Intergenic
921456443 1:215377735-215377757 CTATTAGGGTTAAGAAACCAAGG - Intergenic
922322146 1:224498240-224498262 CTCTTAGGATTAGGCTAACATGG + Intronic
922888446 1:229039732-229039754 CTACTGGGATTAAAAAAAGAAGG + Intergenic
1063015143 10:2069398-2069420 TTACTAGAATGAAGCAAAGAAGG - Intergenic
1065787828 10:29232568-29232590 ATACTAAAATTAAGCAGACACGG + Intergenic
1072871179 10:99122458-99122480 CTACTAGAATTAAGAAAATTTGG + Intronic
1073376936 10:103043445-103043467 TTATTATGATTAAGCCAACAAGG - Intronic
1073756307 10:106584540-106584562 CTACTAGAATTATCCAAAGAAGG + Intronic
1080219520 11:29884891-29884913 CTACTATGATTTAGTAAAAATGG + Intergenic
1081255014 11:40881955-40881977 CTTCTAGTATGAAGCAAAAATGG - Intronic
1085295183 11:75427461-75427483 CCACTAGGAATAAACAAAGATGG - Intronic
1086336801 11:85809273-85809295 CCTCTAGGATAAAGCAAACAGGG + Intronic
1089116239 11:116097271-116097293 CTACTAGGGTCAGGCAAAGAAGG + Intergenic
1092319242 12:7453542-7453564 CCACGAGGATCAGGCAAACACGG + Intronic
1093188236 12:16046603-16046625 ATAATAGAATTATGCAAACATGG + Intergenic
1094251459 12:28366911-28366933 CTACTAGCACTCAGCATACAGGG - Intronic
1095123947 12:38452685-38452707 TTACTGGAATTAAGCAAACTTGG - Intergenic
1102432088 12:112891503-112891525 AAAATAGGATTAAGCAGACAAGG + Intronic
1108043211 13:46358466-46358488 CAACTAAGATTATGCAAAAAAGG - Intronic
1108224349 13:48272670-48272692 CTTCTAGGATTCAGTATACATGG + Intergenic
1109755372 13:66752000-66752022 TTACTATGATTAAGGAGACAGGG + Intronic
1112986053 13:105451519-105451541 ATACTATTCTTAAGCAAACAAGG + Intergenic
1114570128 14:23661000-23661022 CCAGTAGGAGTCAGCAAACACGG - Intergenic
1118464511 14:66018652-66018674 TTATTAGTATTAAGGAAACATGG - Intergenic
1120218056 14:81702106-81702128 CCACTTGGGTTAAGCAAAAAAGG + Intergenic
1120840145 14:89078341-89078363 CTGCTATAATTAAACAAACAGGG + Intergenic
1121768000 14:96503624-96503646 CTACTAAGATGAAGAAAACTCGG - Intronic
1122103481 14:99432636-99432658 CTACAAGGATTAAGAAGAGATGG + Intronic
1127448328 15:59089250-59089272 CTAATAGAATCAAGCAAAAAAGG + Intronic
1128352113 15:66897966-66897988 CTACTATGATTAAATAAATATGG + Intergenic
1128625149 15:69193768-69193790 GTACTAGACTGAAGCAAACAAGG - Intronic
1130379671 15:83360612-83360634 CAAGTTGGATTAAGCAAAGAGGG - Intergenic
1135203093 16:20456631-20456653 CTTCTAGGATACAGCAAAGATGG + Intronic
1135216006 16:20571230-20571252 CTTCTAGGATACAGCAAAGATGG - Intronic
1138693369 16:58789526-58789548 CTCCCAGGCTTAAGCAATCATGG + Intergenic
1139447149 16:67004922-67004944 CTACTAGGTTAAAAAAAACAGGG - Intronic
1146133197 17:30295946-30295968 CTACCAAGTTAAAGCAAACAAGG + Intergenic
1149543631 17:57487314-57487336 CCACTAGGATGGAGCACACAGGG - Intronic
1150153829 17:62833765-62833787 CTACTGGCCTAAAGCAAACAAGG + Intergenic
1150307799 17:64101015-64101037 CTAACAGGCTTAAGCAAAGAGGG - Intronic
1155194816 18:23463761-23463783 CAACTAGGATTAAGAGAACTGGG - Intronic
1159097856 18:63925065-63925087 GTTCTAGGATTAAGCAAATAAGG + Intronic
1165472575 19:36011669-36011691 CTACCAGGATTTAGGAATCAGGG + Intronic
1165775559 19:38402627-38402649 CTACTAGGTGTAAGCCACCAAGG + Intergenic
925539424 2:4951080-4951102 CTTCTAGCATTGAGCACACAGGG - Intergenic
926960970 2:18358165-18358187 CCACTAGGATGAAGGATACAGGG - Intronic
927343119 2:22005238-22005260 CTACTTGTATTAGGGAAACAAGG + Intergenic
928601277 2:32906039-32906061 CTACAAAGCTTAAGTAAACAAGG + Intergenic
932225315 2:70034962-70034984 CTACAAGGGTAAAGCAAACTGGG - Intergenic
932683122 2:73844382-73844404 CTAGAAGGAGTAAGGAAACATGG + Intronic
935009561 2:99120419-99120441 CTTCTAGGATCAAGAAAATATGG - Intronic
936736662 2:115452212-115452234 CTCTTAGGATTAAGCAAAGTAGG - Intronic
937723949 2:125137008-125137030 GTACTGGAATTAAGCAAAAAAGG - Intergenic
939912538 2:148001096-148001118 TTCCTGGGATTAAGCAAATAAGG + Intronic
947790763 2:232867267-232867289 ATCCTAGGATTTAGCAAATAAGG - Intronic
1175637969 20:60601385-60601407 CTACTAGGATTCTGTAAAAAAGG + Intergenic
1177094301 21:16812287-16812309 CCACTTGGTTTAAGCAAACTAGG - Intergenic
1180635700 22:17261391-17261413 TTACCTGGATTCAGCAAACAAGG - Intergenic
1181276616 22:21691242-21691264 CTACTAGAAATAAGAAAAGAAGG - Intronic
1183234605 22:36608018-36608040 CAACTAGGGTAAAGCAAGCAAGG - Intronic
950996976 3:17511366-17511388 CTACTGAGATTATGAAAACATGG - Intronic
952241954 3:31540324-31540346 TTAATAGGAATGAGCAAACAAGG - Intronic
953419342 3:42742443-42742465 CTACCAGGTTTAAGCAACAAAGG - Intronic
953981309 3:47414506-47414528 CTCCCAGGAGTCAGCAAACATGG + Intronic
956755001 3:72376646-72376668 CTGCTATTATTAAGCAAACCAGG + Exonic
959850699 3:111083173-111083195 CTTCAAGGATTAAGAAATCATGG + Intronic
959864373 3:111249360-111249382 CTTCAAGGCTTAAGAAAACATGG + Intronic
962377327 3:134869238-134869260 CCACTTGGCTTAAGCAAACAGGG + Intronic
963626200 3:147677082-147677104 CTACTGTGATTTAGCAAAGAAGG - Intergenic
963931983 3:151012891-151012913 CTCCTAGGATATAGGAAACAGGG - Intergenic
965470071 3:169079869-169079891 CTGCTAGGAATTTGCAAACAAGG + Intergenic
972587022 4:40447205-40447227 CTGCTAGCATTAAATAAACATGG + Intronic
974374250 4:61056391-61056413 CTATTATGATTAAACCAACAAGG + Intergenic
977687447 4:99864393-99864415 AGACTAGGATAAAGCAAATATGG - Intronic
983906780 4:173191413-173191435 CCATTAGGATTTACCAAACAGGG - Intronic
984281855 4:177680001-177680023 GTAGTAGGATAAAGCAAAAATGG + Intergenic
986432537 5:7695401-7695423 CTGCCAGGATGAAGCAGACATGG - Intronic
992140591 5:73793094-73793116 CTTCTATGATTAAACCAACAAGG - Intronic
993967909 5:94380476-94380498 CCACCAGGATAAGGCAAACAAGG + Intronic
995276643 5:110284993-110285015 TTATTAGGATTAAGATAACATGG - Intergenic
999226134 5:150026303-150026325 CTGCAAAGATGAAGCAAACATGG + Intronic
1000473883 5:161680607-161680629 GTACTATGATTAAGAAAAGAGGG - Intronic
1003137273 6:3443434-3443456 CTTCTAGGAATAATTAAACATGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1004659818 6:17700503-17700525 CATCTAGGATAAAGCAAATAAGG + Intronic
1008325463 6:50175459-50175481 CTACAAAGATTAGACAAACATGG + Intergenic
1017678681 6:156841389-156841411 CAACTAGAATAAAGCACACAGGG - Intronic
1018642621 6:165918148-165918170 CTAGTAGGTTACAGCAAACATGG + Intronic
1021571835 7:22073830-22073852 CTAATAGGAACAAACAAACAAGG + Intergenic
1022241107 7:28513400-28513422 CTACTAGGATTAAGCAAACACGG - Intronic
1023790698 7:43750791-43750813 GTCCAAGGATTAAGCCAACAAGG + Intergenic
1026925075 7:74186051-74186073 CAGCAAGGATTCAGCAAACAAGG - Intronic
1034008334 7:147499678-147499700 CTACTAGTTTTAACCAAAGAAGG + Intronic
1036734605 8:11299934-11299956 AAATTAGTATTAAGCAAACATGG - Intronic
1037254506 8:16938166-16938188 CTACTAAGACTAAGAAAAAAAGG + Intergenic
1046175019 8:110564155-110564177 CTATAAGTATTAAGGAAACATGG - Intergenic
1057098624 9:92336563-92336585 CTACAAGGATAAAGGGAACAGGG - Intronic
1058845516 9:108954516-108954538 CTACTGGGTTTAAGCAAGTAAGG - Intronic
1059660394 9:116394437-116394459 CAACGAGTATGAAGCAAACAAGG + Intronic
1186039818 X:5463484-5463506 CAACCAGGTTTAACCAAACATGG - Intergenic
1188453160 X:30330788-30330810 CTAATAGAATGAAGGAAACAAGG - Intergenic
1192304882 X:69948566-69948588 CTCCTGGGAGTAAGCAAACAAGG - Intronic
1195556614 X:106234051-106234073 CCACTGGGATATAGCAAACACGG + Intergenic