ID: 1022249590

View in Genome Browser
Species Human (GRCh38)
Location 7:28593986-28594008
Sequence TCCGGAAGGAACCCAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022249590_1022249595 13 Left 1022249590 7:28593986-28594008 CCTGACTTTGGGTTCCTTCCGGA 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1022249595 7:28594022-28594044 GCCTTGTCAATCACTTCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022249590 Original CRISPR TCCGGAAGGAACCCAAAGTC AGG (reversed) Intronic
902935417 1:19761428-19761450 TCCGGCAGGATCCAAAAGTCTGG - Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
910418070 1:87022794-87022816 TCCTCCAGGAACTCAAAGTCAGG + Intronic
910418113 1:87023593-87023615 TCCTTAAGGAACTCAGAGTCTGG - Intronic
913215259 1:116614776-116614798 ACTGGAAGGAAGCCACAGTCTGG + Intronic
914677596 1:149916643-149916665 TCTGGGTGGACCCCAAAGTCAGG - Intronic
914814979 1:151056650-151056672 TCAGGAAGGATCTCAAGGTCAGG - Intronic
915585614 1:156842295-156842317 TGAGGAAGGAACCCAGAGGCTGG + Intronic
920790014 1:209081098-209081120 CCAGGAAGGAAACCAAAGTGTGG - Intergenic
922351867 1:224740834-224740856 TCAGGAATGAAGCCAAAGCCAGG - Intergenic
1063791111 10:9449311-9449333 TGATGAAGGAACACAAAGTCTGG - Intergenic
1073309397 10:102529315-102529337 TCTGGGAGGGACCCAAGGTCAGG + Intronic
1075754857 10:124802263-124802285 TCGGGAAGGAATCTAAAGGCCGG + Intronic
1083429563 11:62607053-62607075 TCCGGAAGGAACACAAAGCAAGG + Exonic
1083452161 11:62753423-62753445 TCCAGAAGCAGCCCAAAGGCTGG + Exonic
1084618032 11:70249548-70249570 TCCGGAAGGAACCCACCCTGCGG - Intergenic
1090530739 11:127589020-127589042 TCAGAAAAGAACTCAAAGTCAGG - Intergenic
1092429203 12:8396212-8396234 TCCGGGAGCAACCCCAAGACTGG + Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1098227433 12:68339324-68339346 TCCAAAAGGAATCCAAAGTACGG + Intergenic
1099331265 12:81291701-81291723 TCAGGAAGGAAACCAAACCCAGG + Intronic
1102027438 12:109721503-109721525 CCTGGAAGGAACCCAAGGTCAGG - Intronic
1102077052 12:110067913-110067935 TCAAGAAGGAAGCCAAAGGCCGG + Intronic
1103743533 12:123107222-123107244 TCCGGAAGGAAGCCACTGCCTGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1105218992 13:18308265-18308287 ACTGGAAGGAAGCCACAGTCTGG + Intergenic
1111531951 13:89548363-89548385 TCCGCAAGTAACCCAAAATGTGG + Intergenic
1121444607 14:93970579-93970601 CCAGGAACTAACCCAAAGTCAGG + Intronic
1133370320 16:5241168-5241190 TCCGGGAGCAACCCCAAGACTGG - Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1136318886 16:29469764-29469786 TCCGGGAGCAAACCCAAGTCTGG + Intergenic
1136433458 16:30209108-30209130 TCCGGGAGCAAACCCAAGTCTGG + Intergenic
1138329358 16:56201080-56201102 TCCTGAAGGAACTCATGGTCTGG + Intronic
1141808653 16:86358934-86358956 TCCGGGGGGAACCCAGAGCCAGG - Intergenic
1153365235 18:4248309-4248331 TCCTGAAGGAACTGAAAGTATGG - Intronic
1154017003 18:10627565-10627587 TCCCAAAGGAACCCAGAATCAGG + Intergenic
1154187857 18:12202038-12202060 TCCCAAAGGAACCCAGAATCAGG - Intergenic
1160921344 19:1522315-1522337 TCAGGAAGGAACCGGAAGCCAGG + Intergenic
1162535675 19:11261984-11262006 TGAGGAAGGAACAGAAAGTCCGG + Intronic
1165348587 19:35264556-35264578 TCCTGAAGGAAACCAAGGACTGG - Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167208986 19:48121440-48121462 TCCAGAAGGAACCCCAAGGATGG + Intronic
1168462025 19:56567471-56567493 TCCGGAAAGGACCCAAAGCCGGG + Intergenic
926757023 2:16244545-16244567 TCCCAAAGGAGCTCAAAGTCCGG - Intergenic
927461468 2:23302120-23302142 TGCAGAAAGAACCCAAAGTGGGG - Intergenic
932410726 2:71545906-71545928 TGCGGAAGGCATTCAAAGTCGGG + Intronic
934295327 2:91738369-91738391 ACTGGAAGGAAGCCACAGTCTGG - Intergenic
939721927 2:145664207-145664229 TCCAGAAGGAAAACAAGGTCAGG - Intergenic
942168780 2:173268961-173268983 TCTGAAAGGAACACAAAGTATGG + Intergenic
943515686 2:188883285-188883307 TCCTAAAAGAATCCAAAGTCTGG - Intergenic
948664663 2:239527291-239527313 GCCGGAAGGAACCCACACACTGG + Intergenic
1172200319 20:33121516-33121538 TGTGGAAGGAACCCAAAGGGAGG + Intergenic
1178916129 21:36706399-36706421 TCCGGCAGGAAACCACAGGCTGG + Intronic
1181780654 22:25190644-25190666 CCCGCAAGGAGCCCACAGTCTGG + Intronic
1183192953 22:36333442-36333464 TCAGGAAGAATCCCAAAGCCAGG + Intronic
955544847 3:60017427-60017449 CCTTGAAGCAACCCAAAGTCAGG - Intronic
956846637 3:73189601-73189623 TCCGGGATGGACCTAAAGTCTGG - Intergenic
961106627 3:124248317-124248339 TCCTGAAGGAAACCTCAGTCTGG - Intronic
968631058 4:1651766-1651788 TCAGCAAGGGACCCAAAGCCGGG + Intronic
968631069 4:1651806-1651828 TCAGCAAGGGACCCAAAGCCGGG + Intronic
969737720 4:9002122-9002144 TCCGGGAGCAACCCCAAGACTGG - Intergenic
969796923 4:9533683-9533705 TCCGGGAGCAACCCCAAGACTGG - Intergenic
972000185 4:34021992-34022014 GGCGGAAGGATCACAAAGTCAGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
990237967 5:53788218-53788240 TCCAGAAGGAACCAGAGGTCTGG + Intergenic
990450138 5:55925850-55925872 TCCTGAAGGACAACAAAGTCTGG - Intergenic
993340336 5:86717718-86717740 TCCTCATGGAACCTAAAGTCTGG - Intergenic
997865869 5:137462271-137462293 TCCAGAAAGACCCCAAAGGCAGG + Intronic
1002521148 5:179793870-179793892 GCAGGGAGGAAACCAAAGTCTGG - Intronic
1005137444 6:22586137-22586159 TCCTGAAGGAACCCTAATCCAGG + Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1007248380 6:40478694-40478716 ACAGGAAGGAAACCAAATTCAGG - Intronic
1007478724 6:42136308-42136330 TCCGGAAGCCTCCCAAAATCAGG + Intronic
1015400039 6:132778302-132778324 TCCATAAGGTACCCAATGTCAGG - Intronic
1016873328 6:148840143-148840165 TGCAGAAGGAACCCAAAGGAAGG + Intronic
1022249590 7:28593986-28594008 TCCGGAAGGAACCCAAAGTCAGG - Intronic
1023671245 7:42578985-42579007 TCCTGAAGGACCCCAAAACCAGG + Intergenic
1026948636 7:74332749-74332771 TGAGGAAGGAACCCAAAATGTGG - Intronic
1029074895 7:97927872-97927894 TCCGGGAGCAACCCCAAGACTGG + Intergenic
1030505556 7:110417360-110417382 TCCTCAAGGAACTCAGAGTCAGG - Intergenic
1033287642 7:140056490-140056512 TCAGGGAGGAACCCAAAGTTAGG - Intronic
1036829910 8:12013761-12013783 TCCGGGAGCAACCCCAAGACTGG + Intronic
1036899004 8:12658053-12658075 TCCGGGAGCAACCCCAAGACTGG + Intergenic
1037750602 8:21679643-21679665 TCCCAAAGGAACCCAAGGTTTGG + Intergenic
1039929881 8:41976172-41976194 TCAGGGAGGAAACCAAGGTCAGG + Intronic
1039987171 8:42457437-42457459 TCCGCAAATCACCCAAAGTCTGG + Intronic
1041305034 8:56448893-56448915 TCGGGAAGGAACTCAGAGGCTGG - Intergenic
1045059874 8:98402458-98402480 TCTGAAAGGAAGCGAAAGTCTGG + Intronic
1049163250 8:141111132-141111154 TCCCGAAGGACCCCAAAGCTGGG - Intergenic
1052550552 9:29942033-29942055 TCCAGCAGGAACCAAAATTCAGG - Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057917912 9:99071812-99071834 TTGGGGAGGAGCCCAAAGTCAGG + Intergenic
1061938687 9:133872548-133872570 TCCAGAGGAAACCCAAAGCCTGG + Intronic
1185835164 X:3339164-3339186 TCAGGAAGGCACCCAAAGTCTGG + Intronic
1187722298 X:22163847-22163869 TCCTGAATGAACCCTAAGTAAGG - Intronic
1190714943 X:53095082-53095104 ACCAGAAGCAACCCAAAGCCAGG - Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1201668931 Y:16493256-16493278 TCCGTAGGGTACCCAAAGTCTGG - Intergenic
1202113909 Y:21451813-21451835 TCCGGCAGGTACCCCGAGTCCGG + Intergenic