ID: 1022250719

View in Genome Browser
Species Human (GRCh38)
Location 7:28605343-28605365
Sequence CACAATATCTAGATGGATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022250719 Original CRISPR CACAATATCTAGATGGATTC AGG (reversed) Intronic
900730363 1:4254909-4254931 CACAAAAACCAGATGGATCCTGG + Intergenic
902980435 1:20118927-20118949 CACAATTTTGAGATGGATTGAGG + Intronic
905637906 1:39567601-39567623 CAAAATTTCTGGATGCATTCTGG - Intronic
905779354 1:40694007-40694029 CCCATTATCTACCTGGATTCAGG - Intronic
908960353 1:69690352-69690374 CTCAATAACTAGAAGGAATCAGG + Intronic
909785052 1:79600727-79600749 CAGAATGTCTAGATGGGTTGAGG + Intergenic
915848022 1:159289380-159289402 CCCAACATCTAGATGTTTTCTGG - Intergenic
916023023 1:160810746-160810768 AATAATATTTAGATGGATTTTGG - Intronic
917757763 1:178119839-178119861 CACCATAACTAGATGAATTGAGG - Intronic
922781094 1:228252874-228252896 CACAATGTCTATTTGGATTTTGG - Intronic
924207584 1:241729328-241729350 TACAATATCTGGATGGTTTGGGG - Intronic
924694430 1:246383664-246383686 CAAAATATCAAGATGGGGTCAGG + Intronic
1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG + Intronic
1067756180 10:49007675-49007697 CTCAGTATCTAGATAGTTTCAGG - Intergenic
1068849495 10:61720729-61720751 CACAGTATCTATCAGGATTCTGG + Intronic
1073459066 10:103655220-103655242 CACCACATCTAAATGGAGTCTGG + Intronic
1075895631 10:125992138-125992160 CACAAAGTCTTGAAGGATTCAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1089819622 11:121212958-121212980 CACAATATAGAGATGTCTTCTGG - Intergenic
1092000891 12:5031257-5031279 CAAAATATCAAGATGGGATCAGG + Intergenic
1094019946 12:25903464-25903486 CACAAAGTCTATATGGATTTGGG + Intergenic
1097248525 12:57619910-57619932 CACAAGCTCTAGAGGGCTTCCGG + Exonic
1099262040 12:80395676-80395698 AACTATAACTAGATGTATTCTGG - Intergenic
1100515558 12:95324210-95324232 CAAAATATCTAGATGCTTTCTGG - Intergenic
1105750347 13:23417689-23417711 CACAATATCTTTATGGCTTCAGG + Intronic
1108017909 13:46095442-46095464 CACAAAAACCAGATGGATCCTGG + Intronic
1109758167 13:66789161-66789183 CACAAAATCTCTATGGATTATGG + Intronic
1111627171 13:90803922-90803944 CACAAAATGTAGACAGATTCGGG + Intergenic
1116291289 14:43045724-43045746 GACAATATCTAGATGGGTCTGGG - Intergenic
1116703824 14:48270739-48270761 GACAAAATCTAGATGGCTTTAGG + Intergenic
1119057831 14:71441309-71441331 CAAAATATTTAGATGGGATCTGG + Intronic
1120817367 14:88876373-88876395 CAAAAAATCTAGATAAATTCTGG - Intronic
1123607700 15:22052158-22052180 CACAATATATAGATTGCTTAAGG - Intergenic
1129209931 15:74062603-74062625 CACACGATCTAGAGGGTTTCAGG - Intergenic
1129404099 15:75302801-75302823 CACACAATCTAGAGGGTTTCAGG + Intergenic
1130777308 15:86998366-86998388 CTCAATTTCTAGATGGCTGCTGG - Intronic
1132185886 15:99801324-99801346 CACATGCTCTAGATGGTTTCAGG + Intergenic
1132429793 15:101751374-101751396 CACATGCTCTAGATGGTTTCAGG - Intergenic
1202979934 15_KI270727v1_random:343960-343982 CACAATATATAGATTGCTTAAGG - Intergenic
1134409563 16:13992775-13992797 CACCAGGTCTAGCTGGATTCAGG + Intergenic
1137403012 16:48168642-48168664 CAAAATATCTAGAAAGCTTCTGG + Intronic
1137529609 16:49270137-49270159 CTCAATATGAAGATGGTTTCTGG + Intergenic
1137900999 16:52269146-52269168 CACAATATCTCCAAGGATGCCGG + Intergenic
1139184062 16:64783292-64783314 CAGAAAATCTAGATGACTTCGGG - Intergenic
1140783957 16:78322203-78322225 AACAAAATCCAGATGGATTTTGG - Intronic
1141643314 16:85354287-85354309 CACAATAACTGGAGGGATACGGG - Intergenic
1142484082 17:235631-235653 CACACTAACAAGATGGATCCAGG + Intronic
1148100482 17:45087487-45087509 CAGAATATCTAAAAGGATTCTGG + Intronic
1149285646 17:55161210-55161232 CACAAATCCTAAATGGATTCAGG - Exonic
1149803467 17:59592214-59592236 GACAATTTCAATATGGATTCTGG - Intronic
1149843024 17:59983272-59983294 GACAATTTCAATATGGATTCTGG + Intergenic
1151442620 17:74141869-74141891 CACAAGATCTCAAAGGATTCAGG + Intergenic
1153406902 18:4751011-4751033 CATAATATCAAGTTGGTTTCAGG - Intergenic
1153450335 18:5220068-5220090 TACAACATCTAGATGAATTTTGG - Intergenic
1153786482 18:8539529-8539551 AGCAATTTCTAGAAGGATTCAGG - Intergenic
1156247560 18:35316817-35316839 CACAATAACTATAAGGACTCAGG + Intergenic
1159676033 18:71285408-71285430 GACACTATCAAGATGGATTTGGG + Intergenic
1165171644 19:33896190-33896212 CTCAACATCTAGTTGGATTTTGG + Intergenic
1168505712 19:56933033-56933055 CCCAATCTCTAGATGGTGTCTGG + Intergenic
926309923 2:11668066-11668088 CTCAATATCTGGAAGGATTCTGG + Intronic
929081170 2:38123919-38123941 AAAAATATCTAGATCTATTCTGG + Intergenic
932085210 2:68751637-68751659 CACAATTTCTAGAGGGTTTTGGG - Intronic
937805402 2:126137121-126137143 AAAAATATCTAGATGGAATATGG - Intergenic
943829708 2:192444790-192444812 CACAATATCTAGGTGAGTTCTGG + Intergenic
948358980 2:237405031-237405053 CTCAATATCTGGATATATTCTGG - Intronic
1174280816 20:49437799-49437821 GACAGCATCCAGATGGATTCAGG - Intronic
1178890013 21:36513405-36513427 AACAATATCTTCAAGGATTCAGG - Intronic
1183809802 22:40245651-40245673 GACAATATCCAGATGGCTTCTGG - Intronic
950509454 3:13417030-13417052 CAAAATATCTAGAAGGAATCAGG + Intronic
951630102 3:24710575-24710597 CACAATTTATAGAGGCATTCAGG - Intergenic
957066976 3:75532038-75532060 CTGAATCTCTAGATGGCTTCGGG - Intergenic
964246751 3:154662658-154662680 GACAATATCTAGGTGTATGCAGG + Intergenic
966295188 3:178411960-178411982 CACTATATCTCAATGGATCCTGG + Intergenic
966438338 3:179915258-179915280 CACAAGATTTCTATGGATTCTGG - Intronic
976290570 4:83413279-83413301 GACACTATCTAGCTGGAGTCTGG - Intronic
976758773 4:88525932-88525954 CACAATAACCTGATGGTTTCTGG + Intronic
977441872 4:97077835-97077857 CAAAATAGCTAAAAGGATTCAGG + Intergenic
979416749 4:120450608-120450630 TACAATAACTAGATATATTCAGG + Intergenic
987107567 5:14655492-14655514 CACTATTTTAAGATGGATTCTGG + Intergenic
1002404138 5:179015950-179015972 CACAATAACTAAATGGAATGTGG - Intergenic
1002570063 5:180135110-180135132 CACAATCTCGAGATGGATTAGGG + Intronic
1006861863 6:37177115-37177137 CAAAATATCAGGATGTATTCAGG - Intergenic
1014496158 6:122125721-122125743 CACAATATGTAGTTGGAGGCCGG - Intergenic
1016239457 6:141912018-141912040 CTCAATATGTATTTGGATTCCGG + Intergenic
1016676973 6:146782305-146782327 CAAAGTATCTAGATGGTTTCTGG - Intronic
1017430433 6:154365272-154365294 CACATTATCTATAAGGCTTCTGG - Intronic
1022250719 7:28605343-28605365 CACAATATCTAGATGGATTCAGG - Intronic
1024616238 7:51115177-51115199 CAACATATCTAGATTGATCCAGG - Intronic
1026349430 7:69502918-69502940 CAGAATTTCAGGATGGATTCTGG - Intergenic
1026406781 7:70074170-70074192 CAAAATATGTAGATTGATTATGG + Intronic
1027694586 7:81393850-81393872 TCCAATAGATAGATGGATTCAGG + Intergenic
1037028996 8:14078635-14078657 CACAATCACAAGTTGGATTCAGG + Intergenic
1038853969 8:31310798-31310820 CATAATATATTGATTGATTCGGG - Intergenic
1040607877 8:48952494-48952516 TACAATATCAGGATGGATTGAGG - Intergenic
1040905041 8:52459907-52459929 CACAAACTCTACATGGATTATGG + Intronic
1043540641 8:81258358-81258380 CACAATTTGTAGATTGATTGTGG + Intergenic
1046909177 8:119607173-119607195 AAAAATATCTAGATGGTCTCAGG - Intronic
1047669090 8:127125227-127125249 CACAATATCTTGATGAAATGTGG - Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1050275685 9:3996392-3996414 CAAAATAGATAGATAGATTCTGG + Intronic
1051734079 9:20180074-20180096 CACAAAATCTAGATAGAGTGTGG + Intergenic
1051911589 9:22158759-22158781 CACAGTATCTATTTTGATTCAGG - Intergenic
1052454485 9:28677933-28677955 GATAACATGTAGATGGATTCGGG - Intergenic
1058945900 9:109855653-109855675 AACAATTTCTAGATGGACTCAGG - Intronic
1059872197 9:118589872-118589894 CAGAATTTCTAGAAGTATTCAGG + Intergenic
1185922069 X:4104340-4104362 CACTATTTATAGAAGGATTCAGG + Intergenic
1192787104 X:74346409-74346431 AAAAACAACTAGATGGATTCAGG - Intergenic
1196455636 X:115889535-115889557 CTCAATATCTAGCTGTATTCAGG - Intergenic
1196463515 X:115951677-115951699 CTCACTCTCTAGCTGGATTCAGG + Intergenic
1196622584 X:117840419-117840441 CACAATCTCTTGATTGATTGTGG + Intergenic
1197230059 X:123994090-123994112 CACCATATCTACTTGGCTTCTGG + Intronic
1198202642 X:134437210-134437232 CCCCATATCCAGATGGAGTCAGG + Intergenic
1200803191 Y:7405218-7405240 GATGATCTCTAGATGGATTCAGG + Intergenic
1200870562 Y:8093710-8093732 CACAACATCTAGGTGGGTCCTGG + Intergenic