ID: 1022250827

View in Genome Browser
Species Human (GRCh38)
Location 7:28606538-28606560
Sequence ACTGAGAGGCAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1426
Summary {0: 1, 1: 1, 2: 14, 3: 191, 4: 1219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022250827 Original CRISPR ACTGAGAGGCAGAGGGAAGA TGG (reversed) Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900311957 1:2037777-2037799 ACACAGAGGCAGGGGGAAGAGGG + Intergenic
900753041 1:4411762-4411784 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900983531 1:6060015-6060037 AGTGGGAGGCCGAGGGAAGGAGG - Intronic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
901460500 1:9388428-9388450 ACAGAGAGGCTGAGGGGACAAGG - Intergenic
901505261 1:9681146-9681168 ACAGAGAGAGAGAGAGAAGAGGG + Intronic
901785867 1:11624146-11624168 TTTGAGAGGCCGAGGCAAGAGGG - Intergenic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902489866 1:16773440-16773462 AGACAGAGACAGAGGGAAGATGG - Intronic
902718438 1:18288740-18288762 TCCGAGAGGCTGAGGGAGGAAGG + Intronic
902780499 1:18701829-18701851 AGGGATAGGCAGAGGGAAGAAGG + Intronic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903013114 1:20344125-20344147 ACTCGGAGGCAGGGGGAAGAGGG - Intronic
903480866 1:23652401-23652423 ACAGAGAGGGAGAGGGAGGAGGG + Intergenic
903485663 1:23688174-23688196 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
903548645 1:24142658-24142680 AGTGAGAGGCAGAGGAAGGATGG + Intronic
903832388 1:26182987-26183009 GCTAAGAGCCAGAGGGAAGCTGG - Intronic
903894579 1:26595463-26595485 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
903926634 1:26835126-26835148 AGAGAGTGGCAGAGGGAAGGAGG + Intronic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
905051894 1:35058911-35058933 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
905244909 1:36606052-36606074 ACAGAGAAGCAGATGGAAGGAGG + Intergenic
905269667 1:36779273-36779295 TCAGAGAGTCAGAGGGAACATGG - Intergenic
905394778 1:37660192-37660214 ACAGAGAGACAGAAGGCAGAAGG - Intergenic
905481881 1:38267627-38267649 AAGGAGAGACGGAGGGAAGAAGG - Intergenic
905722795 1:40220881-40220903 TTTGAGAGGCTGAGGGAGGAGGG + Intronic
906135988 1:43501270-43501292 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
906139879 1:43527721-43527743 AATGCGGGGCAGAGGGAACAGGG + Intronic
906527194 1:46501145-46501167 ACAGAGAGAGAGAGGGAAGGGGG - Intergenic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
906784882 1:48606548-48606570 ACTGAGGAACAGAGGCAAGAAGG - Intronic
906951799 1:50340934-50340956 ACAGTGAGGCAGGGAGAAGAGGG + Intergenic
907108504 1:51905642-51905664 ACAGAGGGACAAAGGGAAGAAGG - Intergenic
907275342 1:53313877-53313899 ACTCAGCTGCAGAGCGAAGATGG + Intronic
907699083 1:56765785-56765807 TCTGAAAGGTAGAGAGAAGAAGG - Intronic
907958031 1:59250168-59250190 ACTAAAATGCAGTGGGAAGAAGG + Intergenic
908161064 1:61409077-61409099 ACTAAGGGGCAAAGGGCAGAAGG + Intronic
908879620 1:68716076-68716098 ACTGAGGGGCTGAGGGAAGCTGG - Intergenic
909099781 1:71336210-71336232 ACTGAGGGGCAGAAGTTAGAAGG + Intergenic
909431659 1:75594749-75594771 AGAAAAAGGCAGAGGGAAGATGG + Intronic
909772629 1:79442742-79442764 ACACAGACGCAGAGGGAAGATGG + Intergenic
909875663 1:80799419-80799441 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
910022658 1:82611089-82611111 ACTGTAAGGTAGAGAGAAGAGGG - Intergenic
910033345 1:82759265-82759287 ACTTACAGCCAGAGGGAAAAAGG - Intergenic
910043397 1:82882305-82882327 AGAGAGAAACAGAGGGAAGAAGG + Intergenic
910126619 1:83849665-83849687 ATTGAAAGGCAGTGGTAAGAGGG - Intergenic
910135679 1:83966350-83966372 ACAGAGAGACAGAGGGAAGGAGG - Intronic
910262674 1:85307208-85307230 ACTGAGAGGCTGAGTAAGGATGG + Intergenic
910449595 1:87331845-87331867 GCTGAGGGGGAGAGGGAAGAAGG - Intronic
910525949 1:88178373-88178395 ACTGAGTGGCAGTGGGGAGATGG - Intergenic
911189040 1:94929500-94929522 ACCGAGAGGCATAAGGCAGAGGG + Intergenic
911210981 1:95137662-95137684 ACAGAGAGGAAGAAGGAAGAGGG - Intronic
911361934 1:96887306-96887328 ACGGAAAGGCAGCGGGGAGAAGG + Intergenic
911495973 1:98631871-98631893 ACAGAGAAGAAGAGGAAAGAAGG + Intergenic
911614478 1:99993446-99993468 ACCGAGAGGGAGAAGGGAGAGGG - Intronic
911615302 1:100004407-100004429 CTTGGGAGGCTGAGGGAAGATGG - Intronic
911854469 1:102859360-102859382 ACTGAGGGGCAGAAAGCAGAAGG - Intergenic
911910529 1:103628583-103628605 ACTGAAATGGAGAGGGATGAGGG + Intergenic
911917945 1:103722708-103722730 ACTGAAATGGAGAGGGATGAGGG + Intronic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912497032 1:110098384-110098406 CCTGAGAGTCAGAGGGACCAGGG - Intergenic
912626111 1:111205307-111205329 AGAGGTAGGCAGAGGGAAGAAGG + Intronic
913183889 1:116349016-116349038 ATTGAGAGAGGGAGGGAAGAAGG + Intergenic
913367066 1:118050379-118050401 ACTGAGGGGCATAAGGCAGAAGG - Intronic
913377619 1:118171157-118171179 ACTTAGAGGCAGACTGAATATGG + Intronic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
915297238 1:154929894-154929916 ATTGAGAGCCTGAGGGGAGAAGG - Intronic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
916036333 1:160925879-160925901 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
916054565 1:161059500-161059522 AGTGAGAGGCAGTGGGGAGAAGG - Intronic
916518887 1:165545465-165545487 AGTGAGAGAGGGAGGGAAGAAGG + Intronic
916707112 1:167362618-167362640 ACTCAGAGGCTGAGGCAGGAAGG - Intronic
916737983 1:167624985-167625007 AGAGAGAGGGAGAGGGAGGAGGG - Intergenic
916884063 1:169049850-169049872 GCAGAGTGGCAGAGGCAAGAAGG + Intergenic
917845745 1:179018906-179018928 CCTGAGAGCCAGAGGGCCGATGG + Intergenic
917959905 1:180133814-180133836 ACTGAGAGGAGGAGGAGAGAAGG - Intergenic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
918913996 1:190611121-190611143 ACAGAGAGAAAGAGAGAAGAGGG - Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919213843 1:194524577-194524599 AGTGAGAGCAAGAGAGAAGAGGG - Intergenic
919896537 1:202012804-202012826 GCTGGGAGCCAGAGGGAACAAGG - Intronic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
919979062 1:202631069-202631091 ACTGACAGCCAGAGAGAGGAAGG + Intronic
919981418 1:202644568-202644590 AAGGAGAGGCTGAGGGGAGAGGG - Intronic
920351043 1:205338256-205338278 ACTGTGACGCAGAGAGAATAAGG - Intronic
920536313 1:206738943-206738965 TTTTAGTGGCAGAGGGAAGAGGG - Intergenic
920606703 1:207396033-207396055 AGCCAGAGGCAGAAGGAAGATGG + Intergenic
920617450 1:207507426-207507448 ACACAGACCCAGAGGGAAGACGG - Intronic
920620110 1:207537228-207537250 ACACAGACCCAGAGGGAAGATGG - Intronic
920621892 1:207555783-207555805 ACACAGACCCAGAGGGAAGATGG - Intronic
920623518 1:207572877-207572899 ACACAGACCCAGAGGGAAGATGG - Intronic
920636084 1:207705128-207705150 ACACAGACCCAGAGGGAAGATGG - Intronic
920694323 1:208170405-208170427 ATTGACAGGCAGGGGGAAGCAGG + Intronic
921166637 1:212512870-212512892 ACTCAAAGGCAGAGAGAAGAGGG + Intergenic
921350328 1:214228050-214228072 ACAGATAGGGAGAAGGAAGAAGG + Intergenic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
921655871 1:217736652-217736674 AGTGAGAGGGAGAGAGAAGCAGG + Intronic
922102259 1:222486870-222486892 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
922102287 1:222486985-222487007 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
922174111 1:223181690-223181712 TCTGAAAGGCAGAGAGAAGGAGG + Intergenic
922310626 1:224386452-224386474 ACTGTGAGGCAGAGGTGATAGGG + Exonic
922356218 1:224778616-224778638 ACAGAGAGGCATAGGGGAAAAGG + Intergenic
922464983 1:225840314-225840336 ACTGAGAAGCAGAGGGATGGAGG + Intronic
922561501 1:226572895-226572917 ACTGAGGCTCAGAGGCAAGAGGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922662628 1:227443535-227443557 AGGGAGAGGGAGAGGGAAGATGG - Intergenic
922663446 1:227449452-227449474 ACTGACGGGCAGAAGGCAGAAGG + Intergenic
922730586 1:227947064-227947086 TCAGAGAGGGGGAGGGAAGAAGG + Intronic
923030740 1:230247364-230247386 GCTGAGAAGCAGAGGCAAAATGG - Intronic
923251663 1:232184153-232184175 ACAGATAGACAGAGGGAAGAGGG + Intergenic
923426064 1:233871139-233871161 ACAGAGAGACAGAGGGAGGCAGG + Intergenic
923530575 1:234809088-234809110 AGACAGAGACAGAGGGAAGATGG + Intergenic
923669286 1:236026172-236026194 GCAGGGAGACAGAGGGAAGATGG + Intronic
923932466 1:238717784-238717806 AGTGAGAGGGAGAGGAAGGAAGG - Intergenic
924271741 1:242340823-242340845 AGGGAGAGGAAGAGGGAAGGAGG + Intronic
924273506 1:242359946-242359968 ACAGAGAGGCAGAGAGAAATAGG + Intronic
924676140 1:246179897-246179919 ACTGAGAGCCAGGGTGAACATGG - Intronic
924925469 1:248676275-248676297 AGGGAGAGGGAGAGGGGAGAGGG - Intergenic
924947779 1:248857785-248857807 GGTGAGAGCCAGAGGGAAGAGGG - Intronic
1063009884 10:2011729-2011751 ACTGGAAGGCTGAGGGGAGATGG - Intergenic
1063029413 10:2217731-2217753 ACTGTCAGGCAGAGGAGAGAAGG + Intergenic
1063091677 10:2871026-2871048 AGTGGGGGGCAGAGGGAAGAAGG - Intergenic
1063572957 10:7233385-7233407 ACTCAGAGAGTGAGGGAAGAAGG + Intronic
1064227846 10:13503323-13503345 GCTGAAAGGAAGAGGGCAGAAGG + Intronic
1064414451 10:15136406-15136428 ACAGAGAGGGAGAGGGAGGAAGG + Intronic
1064464505 10:15565935-15565957 AGTGAGAGACAGAGGGAAAGAGG + Intronic
1064536350 10:16361350-16361372 ACAGAGATACACAGGGAAGAGGG + Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064745875 10:18477668-18477690 AGTGGGCTGCAGAGGGAAGATGG + Intronic
1064796250 10:19014831-19014853 ACACAGACACAGAGGGAAGAAGG + Intergenic
1064814106 10:19236545-19236567 AGTGAGAGGCAGAGGAATGAGGG - Intronic
1064928901 10:20602068-20602090 ACTGAGAGGCAGAGAAAAACTGG + Intergenic
1065640351 10:27776071-27776093 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1065756226 10:28933958-28933980 GCTGAGTGGCAATGGGAAGATGG - Intergenic
1065842280 10:29712479-29712501 ACTGAAAGGCAGAGAGGAGCTGG - Intronic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066289264 10:33998948-33998970 ACTGAGGGGCATAGGGCAGAAGG + Intergenic
1066629033 10:37440475-37440497 TCTGAGAACCAGAGGGATGATGG + Intergenic
1066711210 10:38236706-38236728 ACAGAGAGGCAGAGAGAAATAGG - Intergenic
1066712933 10:38255305-38255327 AGGGAGAGGAAGAGGGAAGGAGG - Intergenic
1067339593 10:45391045-45391067 AGGGAGAGGGAGAGGGGAGAGGG - Intronic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1067911937 10:50355281-50355303 GCAAAGAGGGAGAGGGAAGAGGG - Intronic
1067954910 10:50780411-50780433 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1068177631 10:53482321-53482343 ACACAGATGCACAGGGAAGAAGG + Intergenic
1068196626 10:53725999-53726021 AATGGGAGGCAGAGAGTAGAGGG + Intergenic
1068667812 10:59696079-59696101 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1069052874 10:63812473-63812495 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
1069065984 10:63942310-63942332 ACTGAGAGGGAGAAGGAAAATGG - Intergenic
1069174319 10:65271342-65271364 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1069386097 10:67884703-67884725 CCAGAGAGGCAGTTGGAAGATGG + Exonic
1069873714 10:71548636-71548658 ACACAGAGACAGAGGGAAAAAGG + Intronic
1069875608 10:71561217-71561239 ACTGAGGGCCAGAGTGAAAACGG - Intronic
1069921236 10:71816991-71817013 ACTGAGAGGCCCAGGAAAGCGGG + Exonic
1069960157 10:72074826-72074848 AATGAGAGACAGAGGAGAGAGGG - Intronic
1070294141 10:75144763-75144785 ACTCAGAGGCTCAGGCAAGAAGG - Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070629833 10:78076648-78076670 AGAGAGAGGGAGAGGGGAGAGGG + Intergenic
1070666738 10:78350412-78350434 GCTGTGGGGCAGAGGGGAGAGGG - Intergenic
1070895651 10:79981663-79981685 ACTGGGTGGCTGTGGGAAGAGGG + Intronic
1070971105 10:80568010-80568032 ACAGAGAGGCACAGAGATGAAGG - Intronic
1071118498 10:82251291-82251313 AGGAAGAGTCAGAGGGAAGAGGG - Intronic
1071276830 10:84063329-84063351 AATAAGAGGCAGAGGCAAGATGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071573948 10:86712337-86712359 ACTGCCAGGCAGGGGGAATAGGG + Intronic
1071606028 10:86990664-86990686 ACTGTGAGGTACAGGGAAGGTGG - Intergenic
1072073948 10:91949737-91949759 AAAGAGAGCCAGAGAGAAGAGGG - Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1072277775 10:93839722-93839744 CCAGAGAGGCAGAGTCAAGAGGG + Intergenic
1072316355 10:94207113-94207135 GCTGAGAAACAAAGGGAAGAGGG - Intronic
1072574787 10:96689768-96689790 ATTGTGGGGTAGAGGGAAGACGG - Intronic
1072756519 10:98025096-98025118 ACTGAGATCCAGAGAGGAGAGGG - Intronic
1072790744 10:98315958-98315980 ACTGAGAGGTAGAGGGACAAAGG - Intergenic
1073922380 10:108473830-108473852 ACTGAGAGATGCAGGGAAGAGGG - Intergenic
1074044223 10:109821741-109821763 CCTTAGAGGAACAGGGAAGAGGG + Intergenic
1074249172 10:111726712-111726734 ACTGAGGCTCAGAGTGAAGAAGG - Intergenic
1074876658 10:117618889-117618911 ACACAGACACAGAGGGAAGAAGG + Intergenic
1074919323 10:117991370-117991392 GCAGAGGGGCAGAGGGAAGGAGG + Intergenic
1075162279 10:120034732-120034754 GGAGAGAGACAGAGGGAAGAAGG + Intergenic
1075268975 10:121032616-121032638 TCTGAGAGACAGAGGGAATGGGG - Intergenic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075428437 10:122361035-122361057 CCTGACAGGCACTGGGAAGAGGG + Intergenic
1075618987 10:123911905-123911927 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1075944014 10:126416920-126416942 AGTGAGACACAGAGGGAAGAGGG + Intergenic
1076106457 10:127827407-127827429 CCAGAGAGGCTGAGGGTAGAGGG + Intergenic
1076383926 10:130044022-130044044 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1076468693 10:130703684-130703706 CCTGAGAGGCAGTAGGAAGAAGG + Intergenic
1077163248 11:1123096-1123118 AGGGAGAGAGAGAGGGAAGAGGG - Intergenic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1077810243 11:5629473-5629495 ACTGTGAGGCAAAGGGAAAAAGG - Intronic
1078293489 11:10040760-10040782 AGAGAGGGGAAGAGGGAAGAAGG + Intronic
1078541559 11:12217508-12217530 TCTGTGAGGCAGAGGGAAGAAGG - Intronic
1078632156 11:13012494-13012516 ACTGAGCTGCAGAGGGAAATCGG - Intergenic
1078729317 11:13961535-13961557 ACTGAGAGGCAGGGGGCTTATGG + Intergenic
1078819316 11:14861685-14861707 ACTGAGGGGCATAAGGCAGAGGG + Intronic
1079149590 11:17885564-17885586 TTTGAGAGGCCGAGGGAGGAGGG - Intronic
1079245208 11:18747008-18747030 ACTGAGACCCAGGGAGAAGAAGG - Intronic
1079566281 11:21887308-21887330 AATGAGAGACATAGGTAAGAAGG + Intergenic
1080357958 11:31473379-31473401 ACTGAGGAGCAGAGAGATGAAGG + Intronic
1080606442 11:33868961-33868983 ACCGAGAAGGAGAGGGAAGAAGG + Intronic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1080883148 11:36341318-36341340 ATTCAGAGGCAAAGGGAATATGG + Intronic
1080930247 11:36802524-36802546 ACAGTGAGTCAGAGGGGAGAAGG + Intergenic
1080986809 11:37477510-37477532 GCTGACAGGCAGAGGGCATAGGG - Intergenic
1081105076 11:39057117-39057139 ACTGAGAGCAATAGGGAGGAAGG + Intergenic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1081338719 11:41901327-41901349 AAAGAGAGGGAGAGGGAAGGAGG - Intergenic
1081376319 11:42362860-42362882 TATCAGAGGCAGAGGGATGATGG - Intergenic
1081481369 11:43492655-43492677 ACTGTGAGGCACTGGGAACAGGG - Intronic
1081587837 11:44399266-44399288 TCTGAGAGGCCGAGGCAGGAGGG + Intergenic
1082782667 11:57299832-57299854 GCAGAGAGGGAGAGGGAAGGAGG + Exonic
1082844970 11:57717712-57717734 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1082876993 11:57999146-57999168 ACTGACAAGCTGAGAGAAGAAGG - Intergenic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1083028378 11:59570092-59570114 AATGGAGGGCAGAGGGAAGAAGG - Intergenic
1083808643 11:65089771-65089793 AGTCTGAGGCAGAGGGAGGATGG + Intronic
1084007759 11:66332291-66332313 AACCAGAGGCAGAGGGAAGCCGG - Exonic
1084133392 11:67155544-67155566 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1084291138 11:68168812-68168834 GCTGAGAGCCAGAGGGTAAAAGG - Intronic
1084351350 11:68602200-68602222 ACTGAGGTCTAGAGGGAAGAAGG + Intronic
1084359899 11:68662447-68662469 GCTGAGATCCAGAGGGAAGTGGG + Intergenic
1084596967 11:70122757-70122779 ACAGAGAGACAGAGGGAGGAAGG - Intronic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085084037 11:73655076-73655098 AAAGAGAGGCGGAGGGAAGGAGG + Intronic
1085139882 11:74130134-74130156 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1085272888 11:75280813-75280835 AATGAGAGGCAGGGAGATGAGGG + Intronic
1085381074 11:76119297-76119319 ACAGAGAGAAAAAGGGAAGAGGG - Intronic
1085404494 11:76254053-76254075 ACTGAGGGGCAGAGGACAGAGGG - Intergenic
1085509743 11:77082243-77082265 ACTGGCAGGAGGAGGGAAGAGGG + Intronic
1085741410 11:79080910-79080932 ACTAGGAAGCAGAGGGAAGAGGG + Intronic
1085779076 11:79392311-79392333 ACTTGGAGGCAGAGGGAGCAAGG + Intronic
1086122787 11:83317811-83317833 GGGGAGAGGGAGAGGGAAGAGGG + Intergenic
1086203780 11:84234346-84234368 ACTGATGGGCAGAAGGCAGAAGG - Intronic
1086365872 11:86109810-86109832 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1086365900 11:86109925-86109947 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1087129988 11:94660457-94660479 ACTGAGAGGCAGATGCTGGATGG - Intergenic
1087484789 11:98747888-98747910 ACTGAGGGCCAGAGGGTAGCTGG + Intergenic
1088030609 11:105244373-105244395 ACTCAGAGAGAGAGGGAAAAAGG + Intergenic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088364200 11:109021616-109021638 ACTGAGGGGAAGAGAGAAAAGGG - Intergenic
1088731571 11:112688508-112688530 GCTGAGAGTGAGTGGGAAGAGGG + Intergenic
1088790111 11:113217317-113217339 ACTGAGTGGCAGAGGCTAGGAGG - Intronic
1088834207 11:113563960-113563982 AATGATAGCCTGAGGGAAGAAGG + Intergenic
1088920266 11:114255477-114255499 ACGGGGAGCCAGAGGGAGGAGGG - Intergenic
1089218555 11:116851478-116851500 ACTTAGGGGCAGAGGCAGGATGG + Intronic
1089305804 11:117525356-117525378 ACAGAGAGACAGATGGAAGAAGG + Intronic
1089323092 11:117639638-117639660 ACTGAGGGGAGGAGGGAAGGAGG + Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089713936 11:120337368-120337390 GTTGACAGGCAGAGGAAAGAGGG + Intronic
1090048632 11:123358398-123358420 ACAGAGAGAAAGAGGGAACACGG + Intergenic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1091049561 11:132355167-132355189 TATGAGAGGCAGAGGCAAGAGGG - Intergenic
1091059268 11:132446319-132446341 ACAGAGAGGCAGAGGAGGGAGGG + Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091296287 11:134476087-134476109 ACTGTGAGTGAGAGGGAAGGGGG + Intergenic
1091305237 11:134532225-134532247 ACTCAGAGGCAGCGGAAGGAAGG + Intergenic
1091386572 12:99793-99815 ACAGGGAGGCAGAGGGCAGGAGG - Intronic
1091515585 12:1177523-1177545 ACACAGAGGGAGAGAGAAGAGGG + Intronic
1091624994 12:2115054-2115076 TGTGAGATGCTGAGGGAAGAGGG - Intronic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091693434 12:2612096-2612118 AATGAGGGGAAGAGGGAAAAAGG + Intronic
1091749603 12:3014207-3014229 AGTCAGAGGCAGACGAAAGAGGG - Intronic
1092239954 12:6830282-6830304 ACTGGGAGGTAGAGAGGAGAGGG - Intronic
1092732220 12:11545645-11545667 GCTGAGTGGCAGGGGGAGGAAGG - Intergenic
1093428126 12:19052398-19052420 ACTGATAGGAGGAGGGATGAGGG - Intergenic
1094112466 12:26876172-26876194 TCTGGGAGGCCTAGGGAAGAGGG - Intergenic
1094128485 12:27049573-27049595 ACTGAGACACAGAGTGATGATGG - Intronic
1094205350 12:27833878-27833900 ACGGAGAGGGAGAGAGAGGAAGG - Intergenic
1094818473 12:34207828-34207850 AGGGAGAGACCGAGGGAAGATGG - Intergenic
1095360632 12:41334234-41334256 AATGAAAGGCAGAAGCAAGAAGG - Intronic
1095432159 12:42145319-42145341 ACTTAGAGGCTGGGGGAGGATGG - Intergenic
1095451588 12:42337196-42337218 GCAGAGTGGCAGAGGGGAGAGGG - Intronic
1095570898 12:43684337-43684359 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1095691673 12:45096282-45096304 CCTGGGAGGCGGAGGCAAGATGG + Intergenic
1095876134 12:47080786-47080808 AGAGAGAGGGAGAGAGAAGAGGG - Intronic
1095903254 12:47350649-47350671 ACTGAAAGGCTGGGGAAAGAGGG - Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096078296 12:48818270-48818292 AGAGAGAGGCAGAGGGAGGACGG - Intronic
1096131000 12:49158920-49158942 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1096139448 12:49230635-49230657 TTTGAGAGGGAGAGGGAAAAGGG - Intronic
1096390953 12:51228785-51228807 CTTGAGAGGCTGAGGCAAGAGGG - Intergenic
1096468799 12:51863835-51863857 TCTGAGAGGCCGGGGGAGGAGGG + Intergenic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096808398 12:54154529-54154551 ACTGGGAAGCAGAGAGAAGGTGG - Intergenic
1096934378 12:55255265-55255287 ACTGGGAGGCAAAGGGAACGAGG + Intergenic
1097008543 12:55936249-55936271 AGGTAGAGGCATAGGGAAGAGGG + Intronic
1097125340 12:56770139-56770161 GGAGAGAGACAGAGGGAAGAGGG + Intronic
1097134149 12:56837348-56837370 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1097201040 12:57278974-57278996 ACTAATAAGCAGAGGGATGAGGG + Intronic
1097493772 12:60301870-60301892 ACTGAGAGGCATGAGGCAGAAGG - Intergenic
1097931567 12:65193168-65193190 ACTGAGAGGCATAAGGCAGAAGG + Intronic
1098080345 12:66777905-66777927 ACTGAGAGAGGGAGGGAAGGAGG - Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1100236364 12:92665370-92665392 ACTGAGAGGCAAAGGCATGTGGG + Intergenic
1100616292 12:96234186-96234208 ACTGAGTGCCACAGGGAAGCTGG - Intronic
1100802868 12:98251727-98251749 ACTGGGAGGCAGAGGAGAGGTGG - Intergenic
1100952377 12:99865620-99865642 AGTAAGAAGCAGAGGGAAAAGGG + Intronic
1101407256 12:104439447-104439469 ACTAAGGGGCAGAAGGCAGAAGG - Intergenic
1101422669 12:104562395-104562417 ACTCAGGTGCAGGGGGAAGATGG - Intronic
1101521146 12:105483520-105483542 AGAGAGAGGCAGAGGGAAGGGGG + Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1101839891 12:108320583-108320605 GCTGAGGGGAAGATGGAAGAAGG - Intronic
1102128211 12:110502574-110502596 ACTTAGAGGCAGATGTAATATGG + Intronic
1102409426 12:112704429-112704451 ATGGAGAGACAGAGGGAAGGTGG + Intronic
1102527223 12:113520567-113520589 ACAGAGAGGCGGTGAGAAGATGG - Intergenic
1102531147 12:113547428-113547450 AGAGGGAGGCAGAGGGAGGAGGG + Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1102795071 12:115682105-115682127 TCTGAGACCCAGAGGGATGAAGG - Intergenic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1103741851 12:123096501-123096523 AGGAAGAGGCAGTGGGAAGATGG + Intronic
1103848520 12:123916114-123916136 CCTGGCAGGCTGAGGGAAGAGGG - Intronic
1103976477 12:124705879-124705901 TCTGACAGGCTGTGGGAAGATGG + Intergenic
1104053793 12:125214277-125214299 GCTGAGAGACAGAGGGAGGCTGG - Intronic
1104298142 12:127537723-127537745 AATGAGGGGGAGAGGGATGACGG + Intergenic
1104490353 12:129188720-129188742 AATGAGAGAGAGAGGGAAGGAGG + Intronic
1104804895 12:131580092-131580114 ACAGACAGGCAGAGCGCAGAGGG - Intergenic
1104804912 12:131581050-131581072 ACAGACAGGCAGAGCGCAGAGGG - Intergenic
1104804921 12:131581618-131581640 ACAGACAGGCAGAGTGCAGAGGG - Intergenic
1105527264 13:21187423-21187445 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1105950922 13:25228932-25228954 ACAGTGAGGCAGGGGAAAGAGGG + Intergenic
1106171761 13:27294739-27294761 AGAGATATGCAGAGGGAAGATGG + Intergenic
1106343065 13:28849810-28849832 ACTCAGAGGTAGAGAGGAGAGGG - Intronic
1106438925 13:29748306-29748328 AGTCAGAGGGAGGGGGAAGAAGG - Intergenic
1106550151 13:30764078-30764100 AATGAGAAGTAGAGGGGAGATGG - Exonic
1106619164 13:31357019-31357041 ACTGAGAGGAAGAGGTATGAGGG - Intergenic
1106747980 13:32724222-32724244 ACTGAGAGGCTGAGGTGGGATGG - Intronic
1107258998 13:38468119-38468141 TCTGAAAGGTAGAGAGAAGATGG - Intergenic
1107793609 13:44027897-44027919 ACTAAGAGGAAGAGAAAAGAAGG + Intergenic
1107965089 13:45590482-45590504 ACTGAGTGGCAGAGGCGAGCAGG + Intronic
1108246334 13:48517955-48517977 ACAGTGATGCACAGGGAAGAAGG + Intronic
1108353074 13:49604950-49604972 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
1108594462 13:51937757-51937779 ACCCAGAGGCCGAGGGCAGAGGG - Intronic
1108702141 13:52952823-52952845 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1108703341 13:52962475-52962497 ACTAAGCCGCAGAGGGCAGAAGG - Intergenic
1108905744 13:55469467-55469489 AGTGAGAGGAAGAGGGAAAAAGG - Intergenic
1109216694 13:59597644-59597666 ACTGAAAGGTGGAGAGAAGAGGG + Intergenic
1109392925 13:61716764-61716786 ACTGTATGGGAGAGGGAAGAAGG - Intergenic
1109821627 13:67664629-67664651 CCTGAAGGGCAGAGAGAAGAGGG + Intergenic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110609582 13:77474171-77474193 ACTGAGAGGCATAAGGCAAAAGG + Intergenic
1113059497 13:106307080-106307102 ACTGTGTGGCAGAGGAAAAATGG - Intergenic
1113509491 13:110841610-110841632 ACAGAGACACACAGGGAAGATGG - Intergenic
1113788312 13:113014496-113014518 ACTGAGAGACAGAGAGAGGGAGG - Intronic
1113935702 13:113994552-113994574 TCTGGGAGGCCGAGGCAAGAAGG + Intronic
1114174611 14:20309329-20309351 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1114259612 14:21026809-21026831 ACTGGCATCCAGAGGGAAGAGGG - Intronic
1114819048 14:25994020-25994042 AATGAGAGGCAGTGGAGAGATGG + Intergenic
1115013119 14:28574424-28574446 AAGGAGAGGCAGAGAGATGAGGG + Intergenic
1115225416 14:31096937-31096959 ACTCAGAGGCTGAGGTAAGGAGG - Intergenic
1115255453 14:31396296-31396318 ACTGAGAGGCTGAGGTGGGAGGG + Intronic
1115301960 14:31894668-31894690 ACTGAGAGGTACATGGAAGCTGG - Intergenic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1115539962 14:34411279-34411301 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1115640501 14:35332760-35332782 ACACAGAGGCACAGGGAAGCAGG - Intergenic
1115944561 14:38644715-38644737 AGTGAGAGAGAGAGAGAAGAGGG - Intergenic
1116192223 14:41675605-41675627 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1116341259 14:43726157-43726179 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1116649918 14:47576991-47577013 TTTGGGAGGCAGAGGCAAGAGGG - Intronic
1116663797 14:47748719-47748741 ACTGAGATGGAGGAGGAAGAAGG - Intergenic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116898036 14:50336204-50336226 ACTGACAGGCAGAGGGACTGGGG + Intronic
1117105622 14:52394794-52394816 AGTGACAGAAAGAGGGAAGAGGG - Intergenic
1117178364 14:53168355-53168377 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1117410845 14:55449608-55449630 ACTGAGACACAGAGAGAAGAAGG + Intronic
1117450061 14:55841407-55841429 TAAGAGAGGGAGAGGGAAGAGGG - Intergenic
1117582629 14:57168318-57168340 ACTGACAGGAGGAGGGAAGTTGG + Intergenic
1117708058 14:58493879-58493901 AGAAAGAGGGAGAGGGAAGAAGG + Intronic
1117729949 14:58712468-58712490 TCTGAGACCCAGAGGGAAGGCGG - Intergenic
1117947214 14:61041018-61041040 ACTGAGAGCTAGAGTAAAGAAGG + Intronic
1118048995 14:62005436-62005458 ACTGAGAAGTACAGAGAAGAAGG - Intronic
1118699173 14:68416318-68416340 AGTGTGGGCCAGAGGGAAGAGGG - Intronic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118808154 14:69255502-69255524 AGGGAGAGGAAGAGGGAAGGAGG - Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119319453 14:73720985-73721007 TCTGAGATTCAGAGGGAAAAAGG - Intronic
1119438074 14:74611093-74611115 TCTGAGAGGCAGCGGGGAGAGGG - Intronic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119925703 14:78491281-78491303 ACTCAGAGGGGGAGGGAAAAGGG + Intronic
1119996467 14:79258827-79258849 ACAGATAGGCAGAGAAAAGAAGG + Intronic
1120020529 14:79525059-79525081 ACAGAAAGGCAGAGGGAAATTGG + Intronic
1120459028 14:84769923-84769945 ACTAACAGGAATAGGGAAGAAGG - Intergenic
1120551750 14:85881182-85881204 ACAAAGAGGCAGAGGGAGAATGG - Intergenic
1120824134 14:88940002-88940024 ACTATTAGGCAGAGGGTAGAGGG - Intergenic
1120969999 14:90199269-90199291 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1121004279 14:90478459-90478481 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1121094081 14:91203750-91203772 ACTGGGAGGCAGAGGTTATAGGG - Intronic
1121139433 14:91528302-91528324 GCTGAGAGGCTGAGGCAAGAGGG - Intergenic
1121229127 14:92343473-92343495 TCTGGGAGGCAGAGAGAAGCTGG - Intronic
1121324859 14:93013942-93013964 ACTGAGAGGCACTGGGATGGGGG - Intronic
1121430297 14:93881755-93881777 ACTGAGAGCCAGGGGGCTGAGGG - Intergenic
1121544606 14:94754260-94754282 AGAGAGAGACACAGGGAAGAAGG + Intergenic
1121822132 14:96979512-96979534 ACTGAGAACCAGAGAGACGAAGG + Intergenic
1122053715 14:99078089-99078111 ACTGAAAGGCAGAGAGGTGAAGG - Intergenic
1122064979 14:99166614-99166636 AGTGAGAGGGACTGGGAAGACGG - Intergenic
1122282851 14:100634462-100634484 ACTGAACGGCAGAGGCAGGATGG - Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122394571 14:101414424-101414446 ACAGAGGCACAGAGGGAAGAAGG + Intergenic
1122580579 14:102769162-102769184 ACTGGAAGGAAGAGGGGAGAAGG + Intergenic
1123017347 14:105381766-105381788 ACTGATGGGCAGTGGGAACATGG - Intronic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123681187 15:22765437-22765459 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1123941898 15:25220802-25220824 ACTGAAGGACACAGGGAAGAAGG - Intergenic
1123945789 15:25238292-25238314 ACTGAAAGACACAGGGAAGAAGG - Intergenic
1123980164 15:25594919-25594941 ACTGAGAGGAGGAGGTGAGAAGG + Intergenic
1124226726 15:27901466-27901488 CCTGAGGGGCAAAGGGGAGATGG - Intronic
1124333400 15:28839899-28839921 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
1124494658 15:30178948-30178970 ACTGACAGCCAGAGAGAGGAAGG + Intergenic
1124497109 15:30193303-30193325 AAGGAGAGGCTGAGGGGAGAGGG - Intergenic
1124746467 15:32345344-32345366 AAGGAGAGGCTGAGGGGAGAGGG + Intergenic
1124748912 15:32359697-32359719 ACTGACAGCCAGAGAGAGGAAGG - Intergenic
1124887504 15:33700963-33700985 ACGGGGAGGCTGAGGGAGGAGGG - Exonic
1125041137 15:35188613-35188635 ACTGAGGGACAGAAGGCAGAAGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125446408 15:39762371-39762393 ACATAGAGCCACAGGGAAGAAGG - Intronic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1125891252 15:43268788-43268810 ACTGAGAGGAAGAGGACAGTGGG - Intergenic
1126113023 15:45186766-45186788 CCTGAGAGGACGAGGGAAGGAGG + Intronic
1126208889 15:46077403-46077425 AGTGAGAGGCAGAGGGCAGTAGG - Intergenic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1126614471 15:50562820-50562842 AATGAGGGACAGATGGAAGATGG + Intronic
1126775285 15:52094979-52095001 TGTAAGAGGCAGAGGGAGGATGG + Intergenic
1126918003 15:53487368-53487390 GCTGAGAGCCAAAGGGAACATGG - Intergenic
1127541275 15:59941294-59941316 ACTCAGTGGCAGAGAGCAGAGGG + Intergenic
1127593959 15:60458947-60458969 ACTGAGGGGAAGAGGAAACAGGG + Intronic
1127900434 15:63337149-63337171 ACTGAGAAACTGAGGAAAGAGGG + Intronic
1127913339 15:63436211-63436233 ACTGAGAGACATAAGGCAGAAGG - Intergenic
1127919472 15:63481991-63482013 ACGGAGAGGCAGGGGGATGGAGG - Intergenic
1128056132 15:64701639-64701661 AGTGAGAGGCAGAGGCCATAAGG + Intronic
1128073583 15:64812420-64812442 AAGGAGAGGCAGAGAGAAGGAGG + Intergenic
1128079969 15:64851129-64851151 TCAGAGAAGCAGTGGGAAGAGGG + Intronic
1128264474 15:66254459-66254481 ACTGAGACCCAAAGAGAAGAGGG + Intergenic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128433949 15:67627037-67627059 ACAGGGAGGCTGAGGCAAGAGGG - Intronic
1128458245 15:67845323-67845345 ACTGAGAGCTAGAGAGAAGCTGG - Intergenic
1128705969 15:69837667-69837689 GCTGTGAGGCAGAGGCAAAAGGG + Intergenic
1128949778 15:71865641-71865663 GCTCAGAGGAAGAGAGAAGAGGG + Intronic
1129185297 15:73902467-73902489 GCTGAGAGGCAGAGAAAAGAGGG - Intergenic
1130521021 15:84660592-84660614 AATGGGAGGCACAGGGGAGAAGG + Intergenic
1130526709 15:84713405-84713427 ACTGAGAATCAGACGAAAGAGGG - Intronic
1130595175 15:85244134-85244156 ACTTTGAGGCAGAGGGAAAGAGG + Intergenic
1130712291 15:86294988-86295010 ACTGAAAGCAAGAGGGAGGAGGG - Intronic
1130733451 15:86523327-86523349 ACTTGGACACAGAGGGAAGATGG - Intronic
1130862830 15:87906333-87906355 ACAGAAAGGCAGATGGGAGAAGG + Intronic
1130936667 15:88476847-88476869 ACAGGGAGGCAAAGGGCAGATGG - Intronic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1131139818 15:89968096-89968118 AGGGAGAGGAAGAGAGAAGAAGG + Intergenic
1131293620 15:91128650-91128672 ACAGAAAGGCAGAGGGAAGTGGG - Intronic
1131442683 15:92470858-92470880 ACAGGGAGCCAGAGGGAGGAGGG - Intergenic
1131595261 15:93792010-93792032 AGTCAGAGAGAGAGGGAAGAGGG - Intergenic
1131603088 15:93870108-93870130 ACAGAGAGGGAGAGGGAAAAGGG + Intergenic
1131643064 15:94313202-94313224 AATGAGAGGCAGAGTGGAGGGGG - Intronic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1131965775 15:97840754-97840776 ACTGGTGGGCAAAGGGAAGAGGG + Intergenic
1132049332 15:98593922-98593944 CTTGGGAGGCAGAGGGCAGAAGG - Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1132409420 15:101565452-101565474 AGAGAGAGGCAGAGGAAACAAGG + Intergenic
1132416606 15:101624784-101624806 ACTGAGAGGCAGAGAAAAGAAGG + Intronic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1132699147 16:1214905-1214927 AGTGGGAGCCAGGGGGAAGAGGG + Intronic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132801754 16:1758106-1758128 ACAGAGAGGCAGGGGAAGGAAGG - Intronic
1133011293 16:2913279-2913301 AGTGGGAAGGAGAGGGAAGATGG + Intronic
1133104852 16:3500855-3500877 CCTGAGACGCCGAGGGCAGAGGG - Intergenic
1133175967 16:4014839-4014861 ACTGGGAGAGAGAGGGAAGCTGG - Intronic
1133392585 16:5422179-5422201 AGAGAGAGGGAGAGGGAGGAAGG + Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133485511 16:6215031-6215053 ATGGAGAGGGAGAGGGGAGAAGG + Intronic
1133555581 16:6903749-6903771 GGTGAGAGGCAGAGGGCTGAGGG + Intronic
1133657419 16:7879420-7879442 TCTGAGAGGCTGAGAGAGGAGGG - Intergenic
1134046170 16:11102899-11102921 CCTGAGGGCCAGAGGGGAGACGG + Intronic
1134067991 16:11241632-11241654 ACAGAGAGGGAGAGGAGAGAAGG - Intergenic
1134231729 16:12435151-12435173 ACGGAGAGGCAGAGGGCAGCAGG - Intronic
1134410342 16:13998684-13998706 AAGAAGAGGAAGAGGGAAGAAGG + Intergenic
1134523643 16:14929199-14929221 ACAGGGAGGCAGAGGGAGGGTGG - Intronic
1134549254 16:15131737-15131759 ACAGGGAGGCAGAGGGAGGGTGG + Intronic
1134610601 16:15605329-15605351 TCTGAGAGGCAGAGAGAGGTGGG + Intronic
1134711235 16:16327684-16327706 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134719089 16:16370986-16371008 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134851764 16:17484579-17484601 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1134912026 16:18036132-18036154 ACTGAGGGGGAAAGGGAAGATGG + Intergenic
1134948338 16:18340899-18340921 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1134955594 16:18381009-18381031 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135045702 16:19153414-19153436 ACTCAGAGGAGGAGGGGAGAAGG + Intronic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1136083639 16:27869010-27869032 ACTAAGAGGCAGAGGGAGGAGGG + Intronic
1136230211 16:28881228-28881250 ACTGAGGCTCAGAGGGATGAAGG - Intronic
1136285570 16:29238470-29238492 AGTGGGAGGGAGAGAGAAGAAGG + Intergenic
1136565055 16:31064799-31064821 ACTGAGCTGAAGAAGGAAGATGG - Exonic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137289589 16:47042893-47042915 AGGGGGAGGCAGAGGGCAGAGGG + Intergenic
1137316629 16:47331324-47331346 AGGGAGGGACAGAGGGAAGAGGG + Intronic
1137511971 16:49108688-49108710 ACTGAGACGTAGAGGGAAAGTGG - Intergenic
1137800877 16:51260920-51260942 ACTGAGGGAGAGAAGGAAGAAGG - Intergenic
1137810706 16:51350045-51350067 CCTGAGAGCCAGAGGGCTGATGG + Intergenic
1137971360 16:52988164-52988186 ACTGAGAGACAGAAGGAAACTGG - Intergenic
1138088399 16:54154587-54154609 CCTGAGAGGCATGGGGAAGAGGG + Intergenic
1138235005 16:55374687-55374709 ACTGACACACAGAGGGAGGAAGG + Intergenic
1138272544 16:55706013-55706035 GCAGAGAGACAGAGGGATGAGGG - Exonic
1138391048 16:56670072-56670094 ACATAGAGGCACAGGGAAGAGGG - Intronic
1138396924 16:56711577-56711599 ACTGACTGGCAGGGGGATGAGGG - Intronic
1138522326 16:57577992-57578014 AGAGAGAGGAAGGGGGAAGAGGG - Intronic
1138609364 16:58110662-58110684 CCAGTGAGGCTGAGGGAAGAGGG - Intergenic
1138889167 16:61121394-61121416 CCTGAGAGAGAGAGGAAAGAGGG - Intergenic
1139140613 16:64257815-64257837 ACTGAGAGAGAGAGAGTAGAGGG - Intergenic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139618579 16:68117613-68117635 CCTGAGAGGCTGAGGCAGGAGGG - Intronic
1139946044 16:70642910-70642932 GCTGGGAGGAAGAGGGAATAGGG + Intronic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140170446 16:72598860-72598882 ACTGAGTGGGAGGAGGAAGAGGG + Intergenic
1140692010 16:77493574-77493596 TCTGAGTGGCAGGAGGAAGATGG - Intergenic
1140852473 16:78947990-78948012 AGTCAAAGGCAGAGGGAGGAAGG + Intronic
1140860132 16:79010876-79010898 ACAGAGAGCGAGAGGGCAGACGG + Intronic
1140899729 16:79356675-79356697 ACTGAGAGCCAGTGGAAAGTGGG - Intergenic
1141279047 16:82614084-82614106 AAAGAGAGGCAAAGGGAAAAGGG + Intergenic
1141311793 16:82920544-82920566 ACTGAGAGTCTGTGGGAACAAGG + Intronic
1141585058 16:85028078-85028100 GCTGGGAGGCAAAGGGAATAGGG + Intronic
1142212506 16:88815170-88815192 GCTGAGAGGCCGAGTCAAGAGGG - Intronic
1142350575 16:89577456-89577478 GGTGAGCGGCAGAGGGGAGATGG + Intronic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142497042 17:311410-311432 TCTGAAAGGCTGAGGGCAGAGGG - Intronic
1143173624 17:4944358-4944380 AAAGAGAAGCAGAGGTAAGAAGG - Intronic
1143277380 17:5721922-5721944 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1143374267 17:6458129-6458151 AGTGAGAGGCAGTGGGCACATGG - Intronic
1143563880 17:7709930-7709952 AGTGAGAGGCAGAAAGAAGGCGG - Exonic
1143645648 17:8228417-8228439 CCTGGGAGGAAGAGGGATGAGGG - Intronic
1143784405 17:9245803-9245825 TCTGAGAGGCAGAGGGGAATGGG - Intergenic
1144126874 17:12211026-12211048 TCTGAGAAGCAGAGAGAAAATGG + Intergenic
1144335184 17:14262283-14262305 ACGGAGTAGCCGAGGGAAGACGG - Intergenic
1144426903 17:15151711-15151733 TCTGAAATGGAGAGGGAAGAGGG - Intergenic
1144602836 17:16633684-16633706 AGAGAGAGGGAGAGAGAAGATGG + Intronic
1144683821 17:17213419-17213441 AATGAAAGGCGGAGGGATGATGG - Exonic
1144847229 17:18226180-18226202 AATGAGAGGCAGAGAGATAAAGG - Intronic
1145124009 17:20285743-20285765 ACAGGGAGGGGGAGGGAAGAAGG - Intronic
1145158244 17:20556942-20556964 ACGGAGAGGGAGACGGCAGACGG - Intergenic
1145243139 17:21251322-21251344 ACTCAGAGACAGAAAGAAGAGGG - Intronic
1145308591 17:21688996-21689018 ACTGAGACCCAGAGGGGACAGGG + Intergenic
1145684065 17:26637527-26637549 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1145815153 17:27789848-27789870 GATAAGAGGAAGAGGGAAGATGG - Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146370525 17:32263266-32263288 AATAAAAGGGAGAGGGAAGATGG - Intergenic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1146912947 17:36659790-36659812 AGTCAAAGGCAGACGGAAGAGGG + Intergenic
1147045321 17:37746941-37746963 GCTGAGAGCCAGAAGGAAGCGGG + Intergenic
1147158455 17:38557390-38557412 ACTGAGAGGCTGAGTGATCAGGG - Intronic
1147184004 17:38704104-38704126 ACAGAGAGGAGAAGGGAAGACGG - Intergenic
1147252912 17:39164440-39164462 ACTAGGAGCCAGAGGCAAGAAGG + Intronic
1147384648 17:40074158-40074180 AGAGAGAGGCAGGGGTAAGAAGG - Intronic
1147530169 17:41268952-41268974 AATGAGAGGAAGAAGAAAGATGG + Intergenic
1147615635 17:41825666-41825688 AATGAGAGGCAGAAGCCAGAGGG + Intronic
1147749416 17:42720216-42720238 AGTGACAGGGATAGGGAAGAAGG - Intronic
1148427906 17:47616148-47616170 ACTGAGACCCAGAGGGATGAAGG + Intronic
1148497332 17:48060634-48060656 GCTGTGAGGCAGAGGAATGATGG + Exonic
1148542624 17:48492596-48492618 AGTGAGAGGGAGAGGGGCGAAGG + Intergenic
1148548064 17:48531709-48531731 AAAGAGAGAGAGAGGGAAGATGG - Intergenic
1148563485 17:48619676-48619698 AGTGCGAGGCAGAGAGAAGCCGG - Intronic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148765177 17:50034676-50034698 GGTGAGAGGCAGAGGGCAGTGGG + Intergenic
1148843128 17:50511863-50511885 CCGGAGAGGCAGAGGCAAGCTGG - Intronic
1148869416 17:50647446-50647468 TCTGAGAGGCAGCAGGAAGTAGG + Intronic
1149107116 17:52982691-52982713 AGGAAGAGGAAGAGGGAAGAAGG - Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150380462 17:64716009-64716031 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1150506467 17:65703602-65703624 GCTGAGAGGCAGAGGGACCTGGG - Intronic
1150674698 17:67234855-67234877 GCCGAGAAGCAAAGGGAAGAGGG - Intronic
1150715971 17:67572872-67572894 ACAGAGACCCAGAGGGAAGAAGG + Intronic
1150823974 17:68457881-68457903 GCTGGGAGGGAGAGGGAAGAAGG + Intergenic
1150827892 17:68492734-68492756 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1150974705 17:70071890-70071912 AATCAGAGGCAGAAGGAAAAGGG - Intronic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151420525 17:73994095-73994117 GCTGGGAGGAAGATGGAAGAGGG + Intergenic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1151871704 17:76841207-76841229 ACAGAGAGGCAGAGAGAGGTGGG - Intergenic
1151976862 17:77488201-77488223 ACGCAGAGTCAGAGGGGAGACGG - Intronic
1152254032 17:79227080-79227102 AGTTAGAGGGAGAGGGAAGGAGG - Intronic
1152261322 17:79268805-79268827 AATGAGAGAAAGAGGAAAGAGGG - Intronic
1152397739 17:80044913-80044935 ACTGAGAGCCAGTGGGAGGTGGG - Intronic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152523084 17:80871852-80871874 ACTGACAGTCAGCTGGAAGATGG - Intronic
1152621446 17:81366891-81366913 ACTGAGACCCAGAGCGGAGAAGG - Intergenic
1153084694 18:1271193-1271215 ACAGAGAGTGACAGGGAAGAGGG - Intergenic
1153096451 18:1411614-1411636 AGTGAGAATCAGAGGGAAGCAGG + Intergenic
1153096954 18:1417976-1417998 ACTGAGAAGGAGAGGCCAGAGGG + Intergenic
1153581728 18:6580962-6580984 TCAGAGAGGAAGAGGGAACAAGG - Intronic
1153662772 18:7340040-7340062 TGTGAGAGGAAGAGGGCAGAGGG + Intergenic
1154005184 18:10521277-10521299 TCTGGGAGGCTGAGGCAAGAGGG + Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155041851 18:22071453-22071475 AAAGAGAGAGAGAGGGAAGAAGG - Intergenic
1155128348 18:22903026-22903048 ACTGAGTGGCAGAGAAGAGAAGG + Intronic
1155368363 18:25071961-25071983 GCTGAGAACCAGAGGGCAGAAGG + Intronic
1155523800 18:26696239-26696261 ATTGGGAAGCTGAGGGAAGATGG + Intergenic
1155774853 18:29748033-29748055 ACTGTGTGGCAGAGAGAAGGTGG - Intergenic
1156083868 18:33375883-33375905 ACTGAGAAGCATAAGGCAGAAGG + Intronic
1156192752 18:34738593-34738615 ACCGAGGTGCAGAGGGAACAGGG - Intronic
1156254900 18:35385609-35385631 ACTCAGACACAGAGGGAAGAAGG - Intergenic
1156534572 18:37850172-37850194 ACAAAGAGGGAGAGGGTAGAAGG - Intergenic
1157007465 18:43601628-43601650 AGAGAGTGGCAGAGGGAAGAAGG + Intergenic
1157009361 18:43627978-43628000 ACGGAGCGGCAGTGGGAGGAAGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157560865 18:48645146-48645168 TCGGAGAGGTGGAGGGAAGAAGG + Intronic
1157629656 18:49081513-49081535 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1158329811 18:56349439-56349461 AAAGAGAGGATGAGGGAAGACGG - Intergenic
1158565755 18:58553009-58553031 ACAGAGACACAGAGGGAAGAAGG + Intronic
1158697964 18:59719384-59719406 AATGAGAGGGATGGGGAAGAAGG - Intergenic
1158789159 18:60754762-60754784 ACTCAAAGGCAGACAGAAGAGGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159266256 18:66083859-66083881 TCTGGGAGGCAGAGGTCAGAAGG - Intergenic
1159539947 18:69761935-69761957 ACTGAGGGGCATAAGGCAGAAGG + Intronic
1160064552 18:75562561-75562583 ATTGAGAGGCAGAGAAAAGAAGG + Intergenic
1160367115 18:78335646-78335668 ACTATGAGGCAGAGGGAGGTAGG + Intergenic
1160378411 18:78430849-78430871 AGTGAGAGGCGGAGGGAGGAAGG - Intergenic
1160388154 18:78510380-78510402 ACTTAAAGGCAAAGGGAGGAAGG + Intergenic
1160465657 18:79073672-79073694 ACGGAGAGGGAGAAGGGAGAGGG + Intronic
1160591198 18:79945562-79945584 ACTAAGAGGCAAACAGAAGAAGG + Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1162776445 19:12982698-12982720 ACTGAGAGACAGAGAAATGAGGG - Intergenic
1163013326 19:14439122-14439144 ACTGAGAGGAAGCAGGAAGTTGG + Intronic
1163154741 19:15433508-15433530 ACTGCGAGGCAGAGGGTTGGCGG - Intronic
1163176746 19:15569551-15569573 GATGAGAGGCAGAAGAAAGAGGG + Intergenic
1163345198 19:16736818-16736840 ACTGATCAGCAGAGGGAAGTAGG + Intronic
1163884085 19:19950664-19950686 AGTTACAGGCAGAGGGAAGGAGG - Intergenic
1163921611 19:20295777-20295799 AAAGAGAGGCAGAGGGGAGAGGG - Intergenic
1164086958 19:21911725-21911747 ACTTAGAGGCATAAGGCAGAAGG + Intergenic
1164180076 19:22810604-22810626 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1164581603 19:29438627-29438649 ACAGACAGGGAGAGGGAAGGAGG + Intergenic
1164649713 19:29882952-29882974 ACAGCGGGGCAGAGGGAAGGTGG - Intergenic
1164771590 19:30813739-30813761 ACTGGGAGGCAGTGGCAAGAGGG + Intergenic
1165259506 19:34599753-34599775 ACTGAGGAACAGGGGGAAGAGGG - Intronic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1165404353 19:35620526-35620548 ACTGAGACGCAGAGGTTAGTAGG + Intronic
1165482528 19:36073173-36073195 AAGCAGAGGAAGAGGGAAGAGGG + Intronic
1166022519 19:40045327-40045349 CCTGAGAGGATGAGGGAAAAAGG + Intronic
1166134757 19:40769325-40769347 ACTGAGAGGCCGAGGTGGGAGGG + Intergenic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166698501 19:44867972-44867994 AGTGGGGGGCAGAGGGAAGCGGG + Intronic
1167111865 19:47467296-47467318 ACTGAGAGGCAGGGAGCAGGAGG + Intronic
1167130927 19:47585237-47585259 ACTGAGCTGAAGATGGAAGACGG - Intergenic
1167222973 19:48215150-48215172 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1167311566 19:48740355-48740377 ACTCCGAGTCAGAGGGAGGAGGG + Intronic
1167476242 19:49702894-49702916 AGTGAGAGGGGAAGGGAAGAGGG + Intronic
1167551761 19:50166066-50166088 ACTGGGAGGCAAAGGCAAGCTGG + Intergenic
1167600426 19:50451530-50451552 ACTGAGGTCCTGAGGGAAGAGGG + Intronic
1167627638 19:50603227-50603249 AGTGAGAGAAAGAGAGAAGAAGG - Intergenic
1167634322 19:50645280-50645302 ATTGAGTGGCAGAGGGAAGTCGG + Intronic
1167666116 19:50823584-50823606 ACTGTGGGCCAGAGGGATGAGGG + Intronic
1167954830 19:53056420-53056442 ACTGAGGGGCATAGGGCAGAAGG - Intergenic
1168000494 19:53441957-53441979 AGTGAGAAGCTGAGGGAAAAAGG + Intronic
1168572451 19:57482565-57482587 ACCGAGAGGGAGAGGGGAGAAGG - Intergenic
925466394 2:4110463-4110485 ACTGACAGGCAGGGGGCAGCAGG - Intergenic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
925522010 2:4757300-4757322 CGTCAGAGGAAGAGGGAAGAAGG - Intergenic
925693517 2:6549620-6549642 AATGAGGGAGAGAGGGAAGAAGG - Intergenic
925751619 2:7094858-7094880 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
926010109 2:9400462-9400484 TCTCAGAGGCCGAGGGAGGAGGG - Intronic
926130102 2:10297527-10297549 AGAGAGAGGCAGAGGGCATACGG + Intergenic
926138071 2:10351400-10351422 ACTGGGAGGCTGAGGGGAAATGG + Intronic
926169460 2:10542950-10542972 ACAGAGAGCCAGAAGGAAGAAGG - Intergenic
926364054 2:12116664-12116686 GCTGAGAAACAGATGGAAGAAGG + Intergenic
926369249 2:12163703-12163725 ACTGAGAGGAAGGGGAATGAAGG - Intergenic
926439572 2:12874118-12874140 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
926577426 2:14597492-14597514 AATGAGAGGGAGAGGAAAGGAGG + Intergenic
926837211 2:17036279-17036301 AATGATAGGCAGATAGAAGAAGG + Intergenic
926846803 2:17150019-17150041 AGGGAGAAGCAGAGGGAAGCGGG + Intergenic
927045170 2:19271020-19271042 GATGAGAGACATAGGGAAGAGGG - Intergenic
927096156 2:19749081-19749103 GCTGAGAGGCCCAGGGGAGATGG - Intergenic
927551924 2:24008972-24008994 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
927719674 2:25374552-25374574 AGTAGGAAGCAGAGGGAAGACGG + Intergenic
927809114 2:26172431-26172453 ACTGAGGGGCAGAGGTCAGGTGG - Intergenic
927899523 2:26809275-26809297 TTTGGGAGGCAGAGGTAAGAGGG - Intergenic
928654900 2:33440395-33440417 AATGAGAGGCAGATGGAAAATGG + Intronic
928854940 2:35791676-35791698 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
929626904 2:43418749-43418771 TTTGAGAGGCAGCGGGAGGAAGG + Intronic
929654557 2:43717470-43717492 AGTGAGAGGGGGAGGGAAGTGGG + Intronic
930002508 2:46870609-46870631 ACTCAGAGGCAGAGGGGTGGGGG + Intergenic
930008076 2:46914043-46914065 AATGAGAGCCAGAGGAGAGAGGG - Intronic
930059377 2:47275597-47275619 ACAGAGAGGGAAAGGGAAGGAGG - Intergenic
930148640 2:48034125-48034147 TCTGAGTGGTAGAGAGAAGAAGG - Intergenic
930382667 2:50651544-50651566 ACTGGGAGGCTGAGGCAGGAGGG + Intronic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
930591049 2:53326750-53326772 ACTGAGGGGCACAAGGCAGAAGG - Intergenic
931260659 2:60615544-60615566 ATTGAGAGTGAGAAGGAAGATGG + Intergenic
931869114 2:66440530-66440552 AGTGAGAAGGAGAGGGGAGAGGG - Intronic
932309656 2:70729304-70729326 ACCCTGAGGCAGAGGGAGGAAGG - Intronic
932385188 2:71325804-71325826 ACAGAGTGGGTGAGGGAAGAAGG + Intronic
932454025 2:71834717-71834739 ACTGAGGGGCAAAGGAGAGATGG + Intergenic
933069187 2:77836332-77836354 GCTGAGGGGCATAGGGCAGAGGG - Intergenic
933521441 2:83379939-83379961 AATAAGAGGAAGAGAGAAGAGGG - Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933804465 2:85988027-85988049 ACTGCCGGGCAGAGGGAGGATGG + Intergenic
934147038 2:89105058-89105080 ACACAGAGACAGAGGGAGGAGGG - Intergenic
934222228 2:90095537-90095559 ACACAGAGACAGAGGGAGGAGGG + Intergenic
934676064 2:96250423-96250445 ACAGAAAGGCAGAGTGAAGTGGG - Exonic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
935132732 2:100273095-100273117 ACAGACACACAGAGGGAAGAAGG + Intergenic
935299966 2:101685619-101685641 ACTGAGCGGCATAAGGCAGAAGG + Intergenic
935325150 2:101929060-101929082 ACTGAGGGGAAGAAGTAAGAAGG + Intergenic
935328063 2:101955844-101955866 CCTGAGAGCCAGAGGGCTGATGG + Intergenic
936344507 2:111665123-111665145 GCTGTGAGGCAGAGGGGAGTGGG - Intergenic
936940606 2:117880124-117880146 ATTCAGAGGCAGAGCAAAGATGG - Intergenic
936984704 2:118297877-118297899 ACGAAGAGGTAGAAGGAAGAAGG - Intergenic
937067802 2:119031431-119031453 ACTGAGAGAAGGAGGGATGAAGG + Intergenic
937198285 2:120179869-120179891 ACTGACAGGAAGATGGAGGATGG + Intergenic
937483510 2:122289458-122289480 AGAGAGAGGCAGGGAGAAGAGGG - Intergenic
937740841 2:125351335-125351357 ACTGAGAAGCATAGAGAAGAGGG + Intergenic
938213490 2:129488305-129488327 ACTGGGAGGCAGCTGGGAGAAGG - Intergenic
938328280 2:130428724-130428746 ACGGAAAGGCAGCGGGAAGGAGG - Intergenic
938361667 2:130692770-130692792 ACGGAAAGGCAGCGGGAAGGAGG + Intergenic
938649092 2:133362695-133362717 ACTGAGAGGCAAAGTGAATCTGG + Intronic
938694679 2:133824511-133824533 GGAGAGAGGCAGAGGGAACATGG + Intergenic
938781529 2:134589109-134589131 AGTGAGAGGCAGCAGAAAGAAGG + Intronic
938798357 2:134737642-134737664 AATCAGAGTCAGAGAGAAGAAGG - Intergenic
938816006 2:134904772-134904794 AATGTGAGGAAGAGGGAGGAAGG + Intergenic
938949953 2:136246238-136246260 AGGGAGAGGCAGAGGGAAGCCGG + Intergenic
939186995 2:138872362-138872384 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
939429374 2:142083227-142083249 AGTGAGATGAAGAGAGAAGATGG - Intronic
939858474 2:147389558-147389580 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
940541818 2:155029953-155029975 AGTGGGAGGCAGAGGGAATTTGG + Intergenic
940840281 2:158571917-158571939 TCTGAAAGCCAGAAGGAAGATGG + Intronic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
940868438 2:158839468-158839490 ACTGAGGGGCATAAGGTAGAGGG - Intronic
940928247 2:159393167-159393189 AGTGAGAGGCAGAGGTCAGTGGG + Intronic
941001711 2:160209121-160209143 CCAGACAGGCAAAGGGAAGAGGG + Intronic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
941624028 2:167810355-167810377 AGTGAGAGCCACAGAGAAGACGG - Intergenic
941768553 2:169326202-169326224 ACCGAGAGGGAGAGGGGAGAGGG - Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
941989529 2:171541431-171541453 ACTGAGAGGCAGGGGTAACATGG + Intronic
941999720 2:171633828-171633850 ACAGAGAGGGAGAGGGAAGGAGG - Intergenic
942251877 2:174054078-174054100 CCTGAGAGGCAGTGGGAAATAGG + Intergenic
942361816 2:175181053-175181075 ACAGAGAGGCTGAGAGAAGGTGG + Intronic
942588622 2:177515468-177515490 ACTTGGGGGCAGAAGGAAGAAGG - Intronic
942872699 2:180754434-180754456 ACTGGGAGGCCAAGGCAAGAGGG + Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943089147 2:183353290-183353312 ACTGACAGCCAGAGAGAAAATGG + Intergenic
943903020 2:193465449-193465471 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
944240099 2:197478004-197478026 ACTGAGAGGCAGAAGAAAGGTGG + Intergenic
944586168 2:201175750-201175772 ACTGAGGGGCATAAGGCAGAAGG + Exonic
944935513 2:204563204-204563226 AGAGAGAGACAGCGGGAAGACGG - Intronic
944938427 2:204594640-204594662 ACTCAGTGACAAAGGGAAGAAGG - Intronic
945276639 2:207994399-207994421 ACAGTGATGCAGAGGGAAAAGGG + Intronic
945914536 2:215689196-215689218 ACTCAGAGGCTGAGGCAGGAGGG - Intergenic
946020671 2:216637771-216637793 CCTGTCAGGCAGAGGGAAGAGGG + Intronic
946053884 2:216884839-216884861 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
946175695 2:217920942-217920964 ACTTCCAGACAGAGGGAAGAAGG + Intronic
946178109 2:217934287-217934309 ACAGAGAGGCAGAGGGGATGAGG + Intronic
946334425 2:219027905-219027927 ACTGATGGGCGGGGGGAAGATGG + Exonic
946373385 2:219294203-219294225 AGAGAGAGAAAGAGGGAAGAAGG + Intronic
946396131 2:219444600-219444622 AGTTGGAGGCAGAGGGAGGAGGG + Intronic
946416270 2:219541543-219541565 TCTGAGAGGCAAAGGGATGTTGG - Intronic
946436480 2:219659668-219659690 ACAGAGGGGCTGAGGGTAGATGG - Intergenic
947014108 2:225599051-225599073 ACTGAGAGAGAGAGAGAAGGAGG - Intronic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947224561 2:227827302-227827324 ACAGACACGCAGAGGGATGAGGG - Intergenic
947373974 2:229476347-229476369 GCTGAGAGGCAGGGGGAGGGCGG - Intronic
947754429 2:232551133-232551155 ACTGAGGCTCAGAGGGGAGAGGG - Intronic
947869272 2:233423940-233423962 CCTGAAAGGTAGAGAGAAGATGG - Intronic
947941896 2:234064129-234064151 AATGAGGGGGAGAAGGAAGAGGG - Intronic
948044922 2:234936276-234936298 ACAGAGGGGCAGAGGGCGGAGGG - Intergenic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948237783 2:236403318-236403340 AGAGAGAGGCAGAGAGAAGAGGG + Intronic
948703436 2:239775045-239775067 ACATAGAAGCAGAGGGAAGGGGG + Intronic
948724375 2:239922735-239922757 ACTGTGAGGGAGAGTGAAGTGGG + Intronic
948792601 2:240386680-240386702 TCACAGAGGCAGAGGGCAGACGG + Intergenic
948864879 2:240770192-240770214 ACTGAGGGGCTGAGGGGAAAAGG - Intronic
949009123 2:241668422-241668444 ACTGAGAAGCAGTGGGCAGGAGG - Intronic
1168801671 20:647275-647297 ACAGAGAGAAAGGGGGAAGAGGG + Exonic
1168808277 20:685810-685832 ACCGGGAGGCAGAGGTAAGAGGG + Intergenic
1168818894 20:760441-760463 ACTGAGGGGCAAAGGAGAGAGGG + Exonic
1168828353 20:829499-829521 AAAGTGAGGCAGAGGGCAGAAGG - Intergenic
1169151846 20:3295613-3295635 ACTGAGAGGGAGCGTGAGGATGG + Intronic
1169319152 20:4616951-4616973 ACACAGACACAGAGGGAAGATGG - Intergenic
1169890741 20:10449419-10449441 GGCGTGAGGCAGAGGGAAGAAGG + Intronic
1169990249 20:11495270-11495292 GGTGAGAGACAGAGGGAGGAAGG + Intergenic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170678322 20:18502658-18502680 ACTGGGAGCCAGGGGGATGATGG + Intergenic
1170704187 20:18729869-18729891 ACTCAGAGAGAGAAGGAAGAAGG - Intronic
1171049987 20:21848934-21848956 ACTCAGAGGCAGATGCAAGAAGG - Intergenic
1171532372 20:25861114-25861136 ACTGAGAGACAGAGAGAGAAGGG + Intronic
1171532699 20:25862791-25862813 ACTGAGAGACAGAGAGAGAAGGG + Intronic
1171847517 20:30286086-30286108 ACTGAGAGACAGAGAGAGAAGGG + Intergenic
1171905837 20:30899311-30899333 AAGGAGAGGGAGAGGGAAGGAGG - Intergenic
1171957673 20:31472412-31472434 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1172093900 20:32451428-32451450 ACTGTGAGGCCAAGGGAAGCAGG - Intronic
1172190569 20:33059725-33059747 CCTGAGAGGGTCAGGGAAGAGGG + Intronic
1172956147 20:38760772-38760794 ATTGAAAGGCAGTGGGTAGATGG + Intronic
1173076387 20:39823621-39823643 AGTGAGAGGCAAAGGGAAAGTGG + Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173437624 20:43047076-43047098 TCTGAGGGGAAGAGGGAGGAGGG - Intronic
1173531295 20:43771767-43771789 GCTGATAGGCTGGGGGAAGAGGG + Intergenic
1173822859 20:46030174-46030196 ACTGAGAGGAGGGGGAAAGAGGG - Intronic
1174017699 20:47502064-47502086 AGTGCGAGGCGGAGGGAAGAGGG + Intronic
1174045185 20:47728149-47728171 CCGGAGAGGGGGAGGGAAGATGG + Intronic
1174350145 20:49961406-49961428 ACTGAGAGACAGAGATATGAAGG + Intergenic
1174366484 20:50059695-50059717 ACAGAGAGGCACAGAGGAGAAGG + Intergenic
1174951930 20:55051530-55051552 ACTCAGAAACAGAGGGGAGAGGG + Intergenic
1175170038 20:57073967-57073989 ACAGACACACAGAGGGAAGAAGG - Intergenic
1175192263 20:57219404-57219426 ACTGAGAAGCACAGGGTGGAGGG - Intronic
1175392499 20:58636081-58636103 ACAGAGAGAGGGAGGGAAGAAGG + Intergenic
1175392536 20:58636201-58636223 ACAGAGAGAGGGAGGGAAGAAGG + Intergenic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1175482924 20:59324170-59324192 GCTGAGAAGCACTGGGAAGAGGG + Intronic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1175663792 20:60840723-60840745 ACAGAGAGTGAGAGGGAAAAGGG - Intergenic
1176018442 20:62950726-62950748 ACTGACAGGCAGCAGCAAGAGGG - Intergenic
1177259200 21:18706962-18706984 AAGGAGAGGGAGAGGGAAAAGGG - Intergenic
1177489007 21:21797198-21797220 ACAGACACACAGAGGGAAGAAGG + Intergenic
1177547662 21:22579465-22579487 ACTGAGGGGCATAAGGAAGAAGG - Intergenic
1177684347 21:24417366-24417388 ACAGAGAGGCAGGGTGAGGAAGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1178374976 21:32059258-32059280 AAAGAGAGGAAGAGGGCAGAGGG + Intergenic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179162294 21:38908575-38908597 GCTGAGAGGCATAAGGCAGATGG - Intergenic
1179243518 21:39611542-39611564 ACTGGGAGGGAGAGGGCAGGGGG + Intronic
1179254821 21:39706504-39706526 ACTGAGGGGCATAAGGCAGAGGG + Intergenic
1179367572 21:40772651-40772673 ACAGAGAGGAAGAGGGAATTTGG - Intronic
1179464812 21:41564546-41564568 ACTGAGACTCAGAGAGATGAAGG - Intergenic
1179481114 21:41679245-41679267 AATGAGTGGCAGAGGCCAGAGGG + Intergenic
1179496327 21:41773602-41773624 GCTGAGGGACAGAGGGAATAGGG + Intergenic
1179526348 21:41978923-41978945 ACTGGGAGGCTGAAGCAAGAGGG + Intergenic
1179992815 21:44957477-44957499 ACTGCAAGGCACAGGGCAGATGG - Intronic
1181292019 22:21802468-21802490 ACTGGGAGGCAGCAGGAAGAAGG - Intronic
1181349188 22:22243347-22243369 CCAGAGAGGCAGTGGGAAGAAGG + Intergenic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181440632 22:22933653-22933675 ACTGAAGGGCAGAGAGAGGACGG + Intergenic
1181458526 22:23072771-23072793 ACTGAGAGGCTGGGGACAGAGGG - Intronic
1181880720 22:25977632-25977654 AATGAGGGGCACAGGGAAGATGG + Intronic
1181921091 22:26320994-26321016 CCTGAAAGACAGAGAGAAGATGG + Intronic
1181960588 22:26619236-26619258 ACAGAGAGGCACAGGGGACATGG + Intergenic
1182100861 22:27656319-27656341 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1182117936 22:27768090-27768112 AAGGAGAGGAGGAGGGAAGAAGG + Intronic
1182355644 22:29721226-29721248 TCTGAGAGGCAGGGGGAACGGGG - Intronic
1182369714 22:29802213-29802235 AGTGAGAGCCAGAGCCAAGAAGG + Intronic
1182551307 22:31102254-31102276 GGTGGGAGGGAGAGGGAAGATGG + Intronic
1182677143 22:32048247-32048269 ACACAGAAGAAGAGGGAAGATGG + Intronic
1182755142 22:32673228-32673250 GCTGTGGGGAAGAGGGAAGAGGG + Intronic
1182922343 22:34091501-34091523 TCGGAGAGGAAGGGGGAAGACGG + Intergenic
1183050082 22:35253801-35253823 ACTCAGAGCCAGAGAGAAGCAGG - Intergenic
1183074639 22:35419232-35419254 ACTGAGACCCAGAGGGAGGGAGG - Intronic
1183121008 22:35730206-35730228 ACAGAAAGGCAGAAAGAAGAGGG - Intergenic
1183200535 22:36382976-36382998 TCTGAGAGGCTGAGGCAGGAGGG + Intronic
1183362322 22:37389186-37389208 CCAGAGAGGGAGAGAGAAGAGGG + Intronic
1183481681 22:38068848-38068870 TCTGTGAAGCAGAGGGAATAGGG + Intronic
1183975148 22:41507716-41507738 ACTGAGAGGGAGAGGCAGGGCGG + Intronic
1184177338 22:42795809-42795831 ACTGAGGGGCGGGGGGAAGGGGG + Intergenic
1184420315 22:44378358-44378380 AGGGAGAGAGAGAGGGAAGAAGG - Intergenic
1184466008 22:44669122-44669144 ACTCAGAGATAGAGGGAAGGGGG - Intronic
1184548608 22:45191189-45191211 AATGAGGGGCAGAGAAAAGAGGG - Intronic
1184979811 22:48087540-48087562 ACAGACAGACAGAGGTAAGATGG + Intergenic
1184996198 22:48209377-48209399 ACAGAGAGGAAAAGGGATGACGG - Intergenic
1185000755 22:48244229-48244251 ACTGAGAGGAGCTGGGAAGAGGG + Intergenic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
949184053 3:1169060-1169082 AGTGAGTGGCAGAGGAAGGATGG + Intronic
949191076 3:1249877-1249899 GCTGAGAGGCAGCTGGCAGAGGG - Intronic
949261721 3:2109518-2109540 ACTGAAAGGCATAGGCAACATGG - Intronic
949396289 3:3617628-3617650 ACCGAGAGGCATAAGGGAGAGGG - Intergenic
949676454 3:6459844-6459866 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
950092496 3:10305764-10305786 CCTGAGAAGCGGAGGGGAGAGGG - Intronic
950362509 3:12459628-12459650 ACTGAGGGCCAGAGAGGAGAAGG - Intergenic
950608906 3:14112193-14112215 ACTGAGAGCCAGTGTGAACATGG + Exonic
950755082 3:15164150-15164172 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
950779774 3:15381385-15381407 CGTGAGAGGAAGGGGGAAGAGGG + Exonic
951280238 3:20739274-20739296 AGTGAGAGGCACAGGGAGGGAGG + Intergenic
951576685 3:24121717-24121739 CCTCAGAGTCAGAGGGAAAAAGG + Exonic
951897454 3:27623742-27623764 GCTGAGAGGCAGAGGGACACTGG - Intergenic
952281864 3:31931149-31931171 ACCGAGAGACAGAAGGAAGGGGG + Intronic
952284342 3:31953727-31953749 ATTGAGAGGGAGAAGGAAAAGGG - Intronic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952569038 3:34692081-34692103 AGAGAGAGAGAGAGGGAAGAAGG - Intergenic
952594623 3:35001101-35001123 AGTGAGAGTGAGAGGGAAGTGGG + Intergenic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953381155 3:42473768-42473790 CCTGAGAGGAAGACGGAAGCTGG + Intergenic
953719270 3:45341101-45341123 ACCTAGAGGCCGAGGGAAGCTGG + Intergenic
953798938 3:46006627-46006649 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
953855655 3:46497592-46497614 GAGGAGAGGCACAGGGAAGAAGG - Exonic
953910482 3:46890246-46890268 AGTGAGGGGCAGATGGGAGATGG - Intronic
953927679 3:46990641-46990663 ACTGAAACTCAGAGGGCAGAAGG - Intronic
954439790 3:50515625-50515647 ACTGAGAGGCAGAGGAGAAATGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954952716 3:54489349-54489371 ACTGACAGGCAGAGGACAGAGGG - Intronic
955117601 3:56021274-56021296 TCTAGGAGGCAGAAGGAAGAAGG + Intronic
955492381 3:59496133-59496155 ACACAGAGGCACAGGGGAGATGG + Intergenic
955650918 3:61192994-61193016 TCTGGGAGACAAAGGGAAGAAGG - Intronic
955666559 3:61355425-61355447 ACTGAAAGGTAGAGAAAAGAAGG - Intergenic
956044177 3:65177545-65177567 ACTCAAAGGTAGGGGGAAGAAGG - Intergenic
956142342 3:66158738-66158760 GTAGAGGGGCAGAGGGAAGAAGG + Intronic
956205370 3:66749567-66749589 AAAGAGAGGCAGAGGGAAAGAGG + Intergenic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
957191116 3:77010946-77010968 ACAGAGAGGGAGAGGGAGAAAGG - Intronic
957222598 3:77402951-77402973 ACTGAGGGGCATAAGGCAGAAGG - Intronic
957372789 3:79317319-79317341 AATGAGGGTCAGATGGAAGAAGG - Intronic
958043763 3:88257874-88257896 ACACAGAGGCACAGGAAAGAAGG - Intergenic
958708084 3:97681843-97681865 ACTGATTGGGAGAGGGATGAAGG + Intronic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
959683604 3:109123359-109123381 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959707987 3:109357070-109357092 ACAGAGAAGCAGAGGGAAAGTGG - Intergenic
960248760 3:115428780-115428802 AAAGAGAGGAAGGGGGAAGAGGG - Intergenic
960312806 3:116137126-116137148 ACAGAGAGACACTGGGAAGAAGG - Intronic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
960709411 3:120512270-120512292 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
960891478 3:122452700-122452722 ACGGAGAGACGGAGGGAAGGAGG + Intronic
961025310 3:123550547-123550569 ACAGAGAAGCAGAGGGCAAATGG + Intronic
961312043 3:126008640-126008662 AGTGAGAGGCTGAGGGAGGCGGG - Intronic
961509985 3:127394983-127395005 AGGGAGAGGCAGAGGGGAGCAGG + Intergenic
961542547 3:127609807-127609829 ACTGAGAAACAGAGGAAGGAAGG - Intronic
961835640 3:129656294-129656316 TCTGTCAGGCAGAGGGCAGATGG + Intronic
962783393 3:138743259-138743281 ACACAGGGGCAGAGGGAATACGG + Intronic
962863646 3:139428054-139428076 AGGGAGAGGAAGAGGGAAGGTGG + Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963458059 3:145572685-145572707 ACTGAGTGGCATAAGGCAGAAGG + Intergenic
963833235 3:150031207-150031229 ATTAAGAGGGTGAGGGAAGATGG - Intronic
963911868 3:150822062-150822084 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
964167824 3:153730063-153730085 ATTGTGAGGAAGAGGCAAGAAGG + Intergenic
964249792 3:154699735-154699757 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
964677833 3:159303497-159303519 ATAGAGAGGGAGAGGGAAGAAGG + Intronic
965063714 3:163816057-163816079 ACTAAAAGGAAGAGGGAAGTGGG + Intergenic
965089879 3:164148798-164148820 AATGAGAGAGAGAGGAAAGAGGG + Intergenic
966223104 3:177569986-177570008 ACACACAGACAGAGGGAAGATGG - Intergenic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
966971633 3:185050266-185050288 ACTGAGAGGGTTACGGAAGAAGG + Intronic
967038133 3:185663354-185663376 ACTGAGAGGCAGAGGGAGATGGG + Intronic
967264444 3:187677970-187677992 GATGACAGGGAGAGGGAAGAAGG - Intergenic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967456261 3:189689993-189690015 GCAGAGAGGTAGAGGGAAGGAGG - Intronic
967462027 3:189758660-189758682 ACTGAGGGGCATAAGGCAGAGGG - Intronic
967488133 3:190057883-190057905 ACTGAGGAAGAGAGGGAAGAAGG - Intronic
967598410 3:191355583-191355605 ACTGAAAGCCAGAAGGAAGAAGG - Intronic
967881311 3:194303761-194303783 TCTGAGAGGCAGTGGCCAGAAGG + Intergenic
968619189 4:1596098-1596120 ACACAGAGACAGAGGGACGAGGG + Intergenic
968762350 4:2449299-2449321 ACTGGGAGACAGGCGGAAGATGG - Intronic
968927263 4:3556193-3556215 CCTGAGAGGCTCAGGGGAGACGG - Intergenic
968951911 4:3699817-3699839 ACTGAGGGGCAGAGGCAAGAGGG + Intergenic
968979396 4:3838582-3838604 AGTGAGGGACAGAGGGAAGAGGG + Intergenic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969307204 4:6332657-6332679 ACTGAGAGGTAGGGAGATGAGGG - Intronic
969414705 4:7050789-7050811 GATGAGAGGCAGAGCGAAGCCGG - Intronic
969422257 4:7104226-7104248 ATCGTGGGGCAGAGGGAAGATGG - Intergenic
969453091 4:7286064-7286086 ACAAAGAGGCACCGGGAAGATGG - Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
970156733 4:13149647-13149669 ATTGGGAGGCAGAGGGCAGGAGG - Intergenic
970234846 4:13948133-13948155 ACTGAGACTCAGAGGGATAAAGG - Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
970403439 4:15739958-15739980 ACAGAGAAAGAGAGGGAAGAAGG + Intergenic
970471104 4:16380055-16380077 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
970473342 4:16398414-16398436 ACAGAGGCGAAGAGGGAAGAAGG - Intergenic
970535757 4:17028331-17028353 ACAGAGACACACAGGGAAGAAGG + Intergenic
970837102 4:20422601-20422623 AATGAGAGGCAGTGGGCAGAAGG + Intronic
971020038 4:22525577-22525599 AGTGAGAAGCAAAGGAAAGAGGG + Intergenic
971138404 4:23896630-23896652 ATTGAGAAACAAAGGGAAGATGG - Intronic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971181966 4:24337204-24337226 GGTGAGAGTCAGAGGAAAGATGG - Intergenic
971411312 4:26375546-26375568 ACTGAGATGAAGAGGAATGAGGG - Intronic
971754392 4:30688746-30688768 ACTCAGAGATAAAGGGAAGAAGG - Intergenic
972241874 4:37202229-37202251 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
974581911 4:63814518-63814540 AATGACAGTCAGTGGGAAGAAGG + Intergenic
974612442 4:64233229-64233251 ACTGAGAGGCATATGGCTGAAGG + Intergenic
974778169 4:66515423-66515445 AGAGAGAGGGAGAGGGAAGAAGG + Intergenic
975678072 4:76847507-76847529 ACAGAGAGACATAGGGAAGAAGG - Intergenic
975990445 4:80254315-80254337 TTTCAGAGGCAGAGGCAAGAGGG - Intergenic
976008547 4:80459558-80459580 ACTGAGGGGCATAAGGCAGAAGG - Intronic
976264903 4:83181463-83181485 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
976656480 4:87493907-87493929 ACTGAATGGCAGAGTCAAGAGGG - Exonic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976753383 4:88473364-88473386 ATTGAGAGGGAAAGAGAAGAGGG - Intronic
976805625 4:89043363-89043385 TCTGAGAGGCAAAGGAGAGATGG + Intronic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
976996091 4:91436192-91436214 ACAGAAAGTAAGAGGGAAGATGG - Intronic
977086579 4:92606459-92606481 AGTGAGAGGAAGAAGAAAGAAGG + Intronic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
977200239 4:94106697-94106719 ACAGAGACACAGAGGGAAGATGG - Intergenic
977319168 4:95489376-95489398 CCTGGGAGGCAGAGAGAAGTGGG + Intronic
977354941 4:95933551-95933573 ACTGAAAGGCACAGGAAAAAAGG + Intergenic
977851674 4:101837925-101837947 AGGGAGAGGGAGAGAGAAGAGGG - Intronic
977881857 4:102214347-102214369 ACTGAGAGGAAGAGGCACTAGGG - Intergenic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
978290341 4:107130389-107130411 ACTGAAAGGCAGAAGGTAGCAGG + Intronic
979857068 4:125646990-125647012 ACTAACAGACACAGGGAAGAAGG - Intergenic
980056691 4:128084609-128084631 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
981010747 4:139922401-139922423 ACATACAGGCAGAGAGAAGAAGG + Intronic
981394249 4:144228538-144228560 ACTCAGGGGAAGAGTGAAGATGG + Intergenic
981659538 4:147149237-147149259 GCAGAGGGGCAGAGGGAAGTTGG - Intergenic
981839836 4:149098640-149098662 ACAGATAGGCAAGGGGAAGAGGG - Intergenic
981843798 4:149143705-149143727 TTTGAGAGGCAGTGGTAAGAGGG + Intergenic
982271296 4:153591997-153592019 ACTGAAAGTTAGAGGTAAGAGGG - Intronic
982791728 4:159600011-159600033 GCTGAGGGGCAGAGGTAAGAAGG - Intergenic
982984217 4:162184859-162184881 ACTGAGATGCACTGGGAAGTGGG + Intergenic
983406310 4:167335475-167335497 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
983527835 4:168778245-168778267 ACTGGGAGACAGTGGGAGGATGG + Intronic
983768156 4:171512725-171512747 ATACAGAGGCAGAGGGAAGAGGG - Intergenic
983842337 4:172472679-172472701 ACTCAGACACAGAGGGAAGGTGG + Intronic
984084480 4:175291993-175292015 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
985200444 4:187479140-187479162 TCTGAGAGCCACAGGGAAGCTGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985840499 5:2301821-2301843 AGAGAGAGGCAGAGGGACGGAGG - Intergenic
985932805 5:3072382-3072404 AGAGAGAGGCAGGGGGGAGACGG - Intergenic
986066614 5:4240611-4240633 ACGGAGGGGCAGAAGGCAGAAGG - Intergenic
986104426 5:4646086-4646108 ACTGTGATACAGAGGGATGATGG + Intergenic
986392176 5:7297431-7297453 CTTGAGAGGCTGAGGCAAGAAGG - Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
986851255 5:11816608-11816630 AGAGAGAGAGAGAGGGAAGAGGG + Intronic
986977804 5:13412573-13412595 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
987071251 5:14338805-14338827 AGGAAGGGGCAGAGGGAAGAGGG + Intronic
987169149 5:15235270-15235292 TCTTGGAGGCAGAGAGAAGATGG + Intergenic
987292630 5:16523038-16523060 AGAGAGAGAGAGAGGGAAGAAGG + Intronic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
987467614 5:18291072-18291094 ACTGAGATAAAAAGGGAAGACGG - Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988787426 5:34577871-34577893 TCTGAGAGCCAGAGGGCTGATGG - Intergenic
989135050 5:38145422-38145444 AGAGAGAGGCAGGGTGAAGATGG - Intergenic
989205719 5:38807222-38807244 ACAGAGAGACAGAGAGAAGATGG - Intergenic
989985309 5:50690150-50690172 CCTGAGAGGCTGCAGGAAGAAGG - Intronic
989999827 5:50879896-50879918 ACTGAAAGGCATAAGGCAGAAGG - Intergenic
990018583 5:51097970-51097992 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990114281 5:52369291-52369313 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990318055 5:54602571-54602593 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
990423230 5:55658482-55658504 ACAGACACACAGAGGGAAGAAGG + Intronic
990459271 5:56015982-56016004 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
990517820 5:56546951-56546973 TAGGAGAGGCAAAGGGAAGAGGG - Intronic
990623145 5:57581979-57582001 AATGAGAGGCTGAGGGATGCTGG + Intergenic
990754574 5:59054875-59054897 AAAGGGAGGAAGAGGGAAGAGGG - Intronic
991048237 5:62245262-62245284 ACTGATGGGCAGAAGGCAGAAGG - Intergenic
991085726 5:62646916-62646938 GCTGTGTGGCAGAGGGAGGAAGG - Intergenic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
991523379 5:67527200-67527222 ACTGAGAGGAGGAGAGAACAGGG + Intergenic
992028502 5:72696110-72696132 TCTGGGAGGAAGAGAGAAGAGGG + Intergenic
992399121 5:76395538-76395560 ACTGAGGGGCATAAGGCAGAGGG - Intergenic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993406993 5:87524311-87524333 ACTGAGGCGCATAGGGCAGAAGG + Intergenic
994214974 5:97127533-97127555 AATGAAGTGCAGAGGGAAGAAGG + Intronic
994628532 5:102252018-102252040 AGAGGGAGGGAGAGGGAAGAAGG + Intronic
994737630 5:103575150-103575172 ACTGGGAGGGAGAGAGAGGAAGG - Intergenic
994754016 5:103772825-103772847 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
995191399 5:109322443-109322465 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
995381136 5:111534646-111534668 ACTGGGAGGGAGAGAGTAGAAGG + Intergenic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
995441329 5:112195620-112195642 AAGGACAGTCAGAGGGAAGAAGG - Intronic
995482897 5:112610398-112610420 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
995530631 5:113088597-113088619 ACAGAGAGACACAGGGAAGAAGG + Intronic
995614901 5:113951019-113951041 ATTTAGGGGCAGAGGGAATATGG + Intergenic
995807259 5:116067034-116067056 TCTGAAAGGCAGAGAGAAGGAGG - Intergenic
995906589 5:117131374-117131396 AATAAGATGCAGAGGGAAAATGG - Intergenic
995912873 5:117208679-117208701 ACTGAGAGGCAGATAGCAAAAGG - Intergenic
996181533 5:120426198-120426220 ACTGACAAGCTGAGAGAAGAAGG - Intergenic
996892188 5:128434613-128434635 AAGGAGAGGGACAGGGAAGAAGG - Intronic
996998131 5:129724481-129724503 ACTGAGAAGCATAAGGCAGAAGG + Intronic
997265071 5:132490627-132490649 TCCGAGTGGAAGAGGGAAGAAGG + Exonic
997290280 5:132727559-132727581 ACAGAGATGGAAAGGGAAGATGG + Intronic
997375148 5:133392368-133392390 ACGGAGAGTCAGAGGGATGGGGG + Intronic
997409314 5:133679091-133679113 CCTGAGAGGGAGAGGGCATAGGG - Intergenic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
997845593 5:137283194-137283216 ACTGGGAGGTAGAGGCAAAAGGG - Intronic
998166111 5:139845016-139845038 TTTGAGAGGCAGAGTGGAGAAGG + Intergenic
998352362 5:141509818-141509840 AATGGGAGGTAGAGAGAAGATGG - Intronic
998495254 5:142582894-142582916 ACTGTGAGGCACAGGGAAAGTGG - Intergenic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998796095 5:145820710-145820732 ACTGAGGGGCATAAGGCAGAAGG + Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999454336 5:151702546-151702568 GCTGAGCGGCTGAGGGAAGCTGG - Intergenic
999735463 5:154509715-154509737 AATGAGAGGGAGGGGGCAGACGG + Intergenic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000506119 5:162120312-162120334 CCTGAGAGAATGAGGGAAGATGG - Intronic
1000645597 5:163757024-163757046 TCAGAGAGGTGGAGGGAAGATGG - Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001206215 5:169765693-169765715 ACAGAAAGAGAGAGGGAAGAAGG + Intronic
1001472111 5:172021772-172021794 ACTTAGAGGAGGAGGGTAGAGGG + Intergenic
1001737821 5:174021195-174021217 AGTGAGAGGGAGAGGGAAGACGG + Intergenic
1001837773 5:174846126-174846148 ACTGGGATGCAAAGAGAAGAAGG + Intergenic
1002043952 5:176531937-176531959 TCTGAGAGGCAGAGGCAGCAAGG - Intronic
1002069858 5:176672797-176672819 ATTGAGAGGCAGAGGACTGAGGG + Intergenic
1002297293 5:178238808-178238830 ACTGAGAGGGAGTGGGGGGAGGG - Intronic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1002953081 6:1835057-1835079 ATAGAGAGGGAGAGGGAAGGAGG + Intronic
1003114776 6:3276564-3276586 ACTGAAAGGCAGAGGACAGGAGG - Intronic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004184845 6:13413055-13413077 ACTCAGTGGCAGAGCCAAGAGGG - Intronic
1005008042 6:21309817-21309839 GCTGAAAGGCAGCGGGGAGAGGG - Intergenic
1005225136 6:23634013-23634035 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1005830383 6:29666258-29666280 ACTGAGAGGTACAGGGCAGAGGG + Exonic
1006065267 6:31456512-31456534 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
1006225824 6:32535426-32535448 ACGGGGAAGCCGAGGGAAGATGG + Intergenic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006582391 6:35084435-35084457 ACTGACGCGCAGAGGGAACAGGG + Intronic
1006648954 6:35535337-35535359 ACTGAGAGGCTGGGGTAGGAAGG - Intergenic
1006764611 6:36493753-36493775 ACTTAGAGGCAGAGTGCTGATGG - Intergenic
1006797002 6:36738145-36738167 ACTGAGACCCAGAGGGCAGATGG + Intergenic
1007301820 6:40873388-40873410 ACAGAGAGAGAGAAGGAAGATGG - Intergenic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1007412482 6:41673098-41673120 AGCGGGAGGCAGATGGAAGAGGG - Intergenic
1007518377 6:42431397-42431419 ACAGAGAGGCAGAAAGAAAAAGG + Intronic
1007628647 6:43260373-43260395 ACTCAGAGGCCAAGGGAAGATGG - Intronic
1007707794 6:43801612-43801634 ATTGACAGGCACAGGGCAGATGG + Intergenic
1007736254 6:43984099-43984121 ACAGAGAGACAGAGGGAAGAAGG - Intergenic
1007839630 6:44705086-44705108 ACTGAGAGGCAGATGGAAGGTGG - Intergenic
1007944899 6:45817382-45817404 ACAGAGAGGTATAGAGAAGAGGG + Intergenic
1008480159 6:51977807-51977829 GCCCAGTGGCAGAGGGAAGAGGG + Intronic
1008549069 6:52610333-52610355 CCTGACAGGCAGAGGGAATCCGG + Intergenic
1008762903 6:54875662-54875684 ACGGAGGGGAAGAGGGAAGGTGG + Intronic
1009185445 6:60569027-60569049 ATTGGGAGGCAGAGGAAGGAGGG + Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009756252 6:67943708-67943730 AATTTGAGGCAGAGGGCAGAAGG + Intergenic
1009761547 6:68013037-68013059 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1010203865 6:73306348-73306370 ACGGAGAGGCTGGGGGAAGAGGG - Intronic
1010386237 6:75284258-75284280 ACAGAGAAACAGAGGGAAGGGGG + Intronic
1010819002 6:80391401-80391423 AGAGAGAGGCAGAGGGAATTTGG + Intergenic
1010977293 6:82330040-82330062 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1011509910 6:88088926-88088948 ACACACAGGCAGAGGAAAGATGG - Intergenic
1012291852 6:97466072-97466094 ACTGGGATGGAGAGGGAAGTGGG - Intergenic
1012497677 6:99852582-99852604 TCTGGGAGGCAGAGAGAGGAAGG - Intergenic
1012509672 6:99988713-99988735 AGTGAGAGGCAGAGGGTAAAAGG - Intronic
1012512741 6:100023037-100023059 CCTGGGAGGCTGAGTGAAGAGGG + Intergenic
1013606276 6:111751859-111751881 TTTGAGAGGCCGAGGCAAGAGGG - Intronic
1013836363 6:114341191-114341213 AGGGAGAGGGAGAGGGAATAGGG + Intronic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014225432 6:118841354-118841376 AGAGAGAGGCAGGGAGAAGAGGG - Intronic
1014242405 6:119032490-119032512 GGGGAGAGGGAGAGGGAAGAGGG + Intronic
1014693869 6:124595000-124595022 ACTGAGAGACAGAGGAAAAGAGG + Intronic
1014722788 6:124938635-124938657 ACTTAGAGGAAGGGGGAAGGTGG - Intergenic
1015490721 6:133822821-133822843 ACTGAGAGACAGTGAGAAGGCGG - Intergenic
1016518221 6:144921009-144921031 AATGAGACTCAGAGGGAAAATGG + Intergenic
1016953019 6:149599572-149599594 AGAGAGAGGGAGAGGGGAGAGGG - Intronic
1016987062 6:149903595-149903617 AGGAAGAGGCAGACGGAAGAGGG + Intergenic
1017213128 6:151879161-151879183 CCTGAGAGGCAGAAGGAACTGGG + Intronic
1017694433 6:157000308-157000330 ACTGTGAACCAGAGGGAAGTAGG + Intronic
1017778321 6:157696838-157696860 CCTGAGAGGCTGATGGAACAAGG + Intergenic
1017880929 6:158561791-158561813 ACTAAGAGGGTTAGGGAAGACGG + Intronic
1017888668 6:158621640-158621662 AGTGGGAGGAAGAGGGAAGGGGG - Intronic
1018097735 6:160406702-160406724 ACAGAGAGGCAGAAAGAAGAAGG - Intronic
1018195867 6:161355930-161355952 ACTGAGATGGAAAGGGAGGAGGG + Intronic
1018476625 6:164148899-164148921 ACTAAAAGGAAGAGGGTAGAGGG + Intergenic
1018664771 6:166125579-166125601 ACCGAGGGGCACAGGGCAGAGGG + Intergenic
1018691783 6:166351897-166351919 ACACAGGGGCTGAGGGAAGAGGG - Intergenic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018863642 6:167731351-167731373 ACTCACCGGAAGAGGGAAGAAGG + Intergenic
1019424574 7:968276-968298 ACCCACAGGCAGAGGGACGAGGG + Exonic
1019532093 7:1508736-1508758 ACAGAGACACAGAGAGAAGACGG - Intergenic
1019607902 7:1919198-1919220 GCTGAGATGCAGAGAGAAAAGGG + Intronic
1019775365 7:2909381-2909403 AGTGAGAGGCTGAGGGGTGAGGG - Intronic
1019775423 7:2909557-2909579 AGTGAGAGGCTGAGGGGTGAGGG - Intronic
1019805072 7:3117661-3117683 AGAGAGAGGGAGAGGGAAGAAGG + Intergenic
1019817732 7:3213422-3213444 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
1019819504 7:3231423-3231445 ACTGAGAGATGGAGAGAAGAAGG - Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020646102 7:10816133-10816155 ACAGAGAGACATAGGGAAGAAGG + Intergenic
1021088226 7:16449528-16449550 AGTGAGAAGCAGAGGAAAGAAGG - Intergenic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1021658428 7:22894860-22894882 ACTCAGAGGAAAAGGGAAGAAGG - Intergenic
1021891175 7:25187715-25187737 ACAGAGAAGCAGAGGGAAATTGG - Intergenic
1022032841 7:26507847-26507869 CCTGAGCAGCAGGGGGAAGAAGG + Intergenic
1022207944 7:28180763-28180785 ACCGGGAGGCAGAGGGGAGGCGG + Intergenic
1022250827 7:28606538-28606560 ACTGAGAGGCAGAGGGAAGATGG - Intronic
1022307420 7:29160479-29160501 ACTCAGTGGCAAAGGGAAAAGGG - Intronic
1022853676 7:34293981-34294003 ACTGATAAGTAGAGGGAAAATGG - Intergenic
1023049076 7:36235515-36235537 ACAGAGATGCAGAGGGGAGCCGG - Intronic
1023088890 7:36599833-36599855 ACTGAGAGGCAGAAAGCAGGAGG - Intronic
1023176333 7:37439130-37439152 AGGGAGGGGCAGAGGAAAGATGG - Intronic
1023450439 7:40278747-40278769 AAAGGGAGGGAGAGGGAAGAAGG - Intronic
1023495145 7:40787517-40787539 ACTGAAAGACAGAGAGAAGAAGG + Intronic
1024049057 7:45606580-45606602 ACTAAAAGTCAGAGGGAAGAAGG - Intronic
1024160055 7:46664668-46664690 GATGAGAGGCACAGGGATGATGG - Intergenic
1024678983 7:51663762-51663784 AGGGAAAGGCAGGGGGAAGAAGG - Intergenic
1024854126 7:53757192-53757214 AGAGAGAGGCAGAGTGAAGCAGG - Intergenic
1025796196 7:64739575-64739597 ACCAAGAGGGAGAGGGGAGAGGG + Intergenic
1026285010 7:68955257-68955279 ACAGAGAGAAAGAGGGGAGAGGG + Intergenic
1026385543 7:69843815-69843837 ACTGAGATTCAGAGAGATGAAGG + Intronic
1026699560 7:72628047-72628069 TCTGAGAGGCCGAGGCAGGAGGG + Intronic
1026789764 7:73324075-73324097 AGGGAGAGGAAGAGGGAAGAGGG + Intronic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027616557 7:80431302-80431324 ACTGAGGGGCATAAGGTAGAAGG - Intronic
1027742017 7:82020334-82020356 ACTAAGTGGCAGAGTCAAGATGG - Intronic
1027993290 7:85392407-85392429 ACTAGGAGGCATAGGGCAGAAGG + Intergenic
1028061235 7:86319308-86319330 AGAGAGAGGGAGGGGGAAGAAGG + Intergenic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028380063 7:90190238-90190260 ACTGAAAGCCAGCAGGAAGATGG - Intronic
1029027779 7:97435578-97435600 GGAAAGAGGCAGAGGGAAGATGG + Intergenic
1029364993 7:100111044-100111066 ACAAGGGGGCAGAGGGAAGAGGG - Intronic
1029569517 7:101360419-101360441 ACCGAGAGGGAGAGGGGAGAGGG + Intergenic
1029619381 7:101680358-101680380 ACTGAGAGGCGAAGGGAGCAGGG + Intergenic
1030159460 7:106492611-106492633 ACTGAAAAACAGAGGGAAGGAGG + Intergenic
1030410518 7:109172967-109172989 ACACAGAGGCATAGGGGAGAAGG - Intergenic
1030515553 7:110533792-110533814 ACTGAGAGGCATAAGGCAGAAGG - Intergenic
1030602566 7:111609296-111609318 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1030736604 7:113056031-113056053 ACTGAGTGTCACAGGCAAGAGGG - Intergenic
1031018581 7:116602075-116602097 CCTGAGTGACAGAGAGAAGATGG + Intergenic
1032025576 7:128439276-128439298 ACAGACAGACAGAGGGAAGATGG - Intergenic
1032120325 7:129150486-129150508 ACTGGGAGGCAGAGATAGGAAGG + Intronic
1032379283 7:131459312-131459334 ACAGAAAGGCAGAGGAAAGTTGG + Intronic
1032870300 7:135977527-135977549 ACTGGGAGGCAGAATGAAGGAGG + Intergenic
1033031307 7:137829978-137830000 AATGAGAGAGAGAGGGAAGGAGG + Intronic
1033059764 7:138095032-138095054 ACTGTGAGGAAGAGGAATGAAGG + Intronic
1034167891 7:149039634-149039656 ACAGACATACAGAGGGAAGATGG + Intergenic
1034477857 7:151297961-151297983 ATTGGCAGGCAGATGGAAGACGG + Intergenic
1034488537 7:151381016-151381038 TGTGAGAGGCAGAGGGCAGGAGG + Intronic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1034799671 7:154047135-154047157 ACTGTGAGCCACAGGGAACAAGG - Intronic
1034993872 7:155566037-155566059 ACTGAGAGACAGCAGGGAGACGG + Intergenic
1035038015 7:155908069-155908091 AGAGAGAGGGAGAGGGAGGAGGG + Intergenic
1035089259 7:156293175-156293197 GCTAAGAGTCAGAGAGAAGAGGG - Intergenic
1035132437 7:156668520-156668542 ACACAGAGGCAGAGGGAAGCAGG - Intronic
1035224404 7:157425491-157425513 AAGCAGAGGCAGAGGGCAGAGGG + Intergenic
1035489711 7:159263163-159263185 AGAAAGAGGAAGAGGGAAGAGGG + Intergenic
1035522926 8:289962-289984 AAGGAAAGGAAGAGGGAAGAAGG - Intergenic
1035580125 8:734573-734595 AGTGAGATGCAGTGGCAAGAGGG - Intronic
1035978464 8:4340225-4340247 AGTGAGAGGAAAAGGGGAGAAGG - Intronic
1036625969 8:10471789-10471811 ACTGAGGGGCATAAGGAAGAGGG + Intergenic
1036682323 8:10884562-10884584 ACATGGAGGCAAAGGGAAGAAGG + Intergenic
1037866688 8:22449705-22449727 ACTAAGAAGTAGAGAGAAGATGG + Intronic
1037968975 8:23158215-23158237 ACTGAGGGGCATAAGGCAGAAGG - Intronic
1038040329 8:23718673-23718695 AATGAGGGGAAGAGGGAAGAGGG + Intergenic
1038426655 8:27468324-27468346 GCTGAGGGCCAGAGGGAAGCAGG - Intronic
1038676944 8:29631464-29631486 GCTGAGAGGCCGAGGGAGGCAGG + Intergenic
1038689481 8:29748141-29748163 ACAGAGAGAGAGAGAGAAGAGGG + Intergenic
1038970879 8:32633749-32633771 ACTGAGAGAAAGAGGAAGGAAGG - Intronic
1039569442 8:38575395-38575417 AATGAGAGGCAGAGCCAGGAGGG - Intergenic
1039729094 8:40255432-40255454 ACGGAGGGGCAGAAGGCAGAAGG + Intergenic
1039789942 8:40867512-40867534 ACGAAGAGGCAGAGGGTGGAGGG - Intronic
1039953917 8:42192984-42193006 GCAGAGAGGCACAGGGACGAGGG - Intronic
1040334434 8:46408879-46408901 ACGGAGAGGCAGAGTGAAGTGGG + Intergenic
1040391013 8:46950561-46950583 ACTCAGAGTCAGGAGGAAGATGG - Intergenic
1040577941 8:48670648-48670670 TCCAAGAGGCACAGGGAAGATGG - Intergenic
1040640265 8:49325782-49325804 AGTGAGGGAGAGAGGGAAGAAGG + Intergenic
1040743526 8:50611261-50611283 ACTCAGAGGCAAAGGGAAGAAGG - Intronic
1041021476 8:53642918-53642940 ACTGAGGGGCAGGGCCAAGATGG - Intergenic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041375103 8:57204606-57204628 ACTGAGGGGCACAAGGCAGAGGG + Intergenic
1041742843 8:61175614-61175636 ATTTAAAGGCACAGGGAAGAAGG + Intronic
1042014525 8:64293336-64293358 TCTGAGAGGCAGTGGGAAGAAGG - Intergenic
1042263589 8:66885764-66885786 ACTGATTGGAAGAGGGAAGGAGG - Intronic
1042455660 8:68999518-68999540 TCTGAAAGGTAGAGAGAAGAAGG - Intergenic
1043400867 8:79882947-79882969 AAAGAGAGAGAGAGGGAAGAGGG - Intergenic
1043474330 8:80591541-80591563 AGAGAGAGGCAGAGGGCAGTGGG + Intergenic
1043524779 8:81084148-81084170 TCTGAAAGGTAGAGGAAAGATGG - Intronic
1043599581 8:81920666-81920688 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1043668493 8:82849177-82849199 ACTCAGAAGCAGAGGGAATGAGG + Intergenic
1043950162 8:86299780-86299802 ACTCAAAGGCAGAGAGAAGAAGG - Intronic
1044085511 8:87937765-87937787 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045884098 8:107075919-107075941 ACTGCATGGAAGAGGGAAGAAGG + Intergenic
1046010413 8:108539591-108539613 ACACAGACACAGAGGGAAGATGG + Intergenic
1046494779 8:114999025-114999047 AAAGAGAGGTAGAGTGAAGAAGG - Intergenic
1046538401 8:115547338-115547360 ACGGAGAGGCAGAGGGAGAGAGG - Intronic
1046555283 8:115766869-115766891 AATGAGAGGGAAGGGGAAGAGGG - Intronic
1046723642 8:117651323-117651345 GCTGAGAGAGAGAGAGAAGATGG + Intergenic
1046766347 8:118074151-118074173 ACGGGGAGGGGGAGGGAAGAAGG + Intronic
1047079597 8:121444851-121444873 AGAGAGAGGGAGAGGGAATAAGG + Intergenic
1047175706 8:122538365-122538387 ACTCACAGGCAGAGGTGAGAGGG + Intergenic
1048048562 8:130796050-130796072 ACAGGGAGGCAGAGGGAGGGAGG - Intronic
1048863155 8:138738840-138738862 ACCAAGGGGCAGAGAGAAGAGGG - Intronic
1049028219 8:140012425-140012447 ACTGAGAATGAGAGGGAAGAAGG + Intronic
1049145819 8:141000795-141000817 ACTGGGAGGCTGAGGGACGTGGG - Intronic
1049188557 8:141272686-141272708 ACTGAGGGGCAGCGGGCAGAGGG - Intronic
1049331249 8:142054934-142054956 CCTGAAAGGTTGAGGGAAGAAGG - Intergenic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1050013269 9:1207493-1207515 AAAGAGAGGCAGAGGAGAGATGG + Intergenic
1050051068 9:1602142-1602164 ACTGAGAGGCAAAGGAAGGCTGG - Intergenic
1050748354 9:8905309-8905331 ACTGAGAGCCTACGGGAAGAAGG - Intronic
1051209279 9:14724511-14724533 TTTGGGAGGCAGAGGCAAGATGG - Intergenic
1051441663 9:17090150-17090172 TTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1051944472 9:22550266-22550288 CCAGAGAGGAAGAGGAAAGAAGG - Intergenic
1052152850 9:25140452-25140474 ACTGAGAAGGGGAGGGAAGAGGG + Intergenic
1052709756 9:32039056-32039078 CCTGAGAGGCAGAGGTCACAGGG + Intergenic
1053278564 9:36801536-36801558 AGTGTGAGACAGAGGCAAGAAGG - Intergenic
1053282943 9:36832829-36832851 CTTGAGAGGCTGAGGCAAGAGGG + Intergenic
1053802188 9:41771603-41771625 CCTGAGAGGCTTAGGGGAGACGG - Intergenic
1054143083 9:61543686-61543708 CCTGAGAGGCTTAGGGGAGACGG + Intergenic
1054462791 9:65474567-65474589 CCTGAGAGGCTTAGGGGAGACGG + Intergenic
1054647898 9:67604828-67604850 CCTGAGAGGCTTAGGGGAGACGG + Intergenic
1055030355 9:71767804-71767826 ACAGAGAGGCAGGGGGCGGAGGG + Intronic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055508235 9:76969841-76969863 ACTCAGAGCCTGAGAGAAGAAGG + Intergenic
1055554996 9:77464925-77464947 ACACAGACACAGAGGGAAGATGG + Intronic
1055698047 9:78909848-78909870 ACAGAGAGAGAGATGGAAGAGGG + Intergenic
1055862409 9:80768406-80768428 TCAGAGAGTCAGAAGGAAGACGG + Intergenic
1056089192 9:83187736-83187758 AATGGAAGGTAGAGGGAAGAAGG - Intergenic
1056152324 9:83803239-83803261 ACCGAGAGGGAGAGGGGAGAGGG - Intronic
1056524984 9:87434742-87434764 ACACAGAGTTAGAGGGAAGATGG + Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1057763280 9:97893264-97893286 ACCTAGAGGCAGAGGACAGAGGG + Intergenic
1057916867 9:99063387-99063409 GGAGAGAGGCAAAGGGAAGATGG + Intronic
1057939311 9:99266937-99266959 GCTAGGAGGCAGAGGAAAGAAGG - Intergenic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058354010 9:104061228-104061250 CCTGAGAAGCAGAGAAAAGAGGG + Intergenic
1058453643 9:105119465-105119487 CCTGAGAACCACAGGGAAGAAGG - Intergenic
1058618891 9:106863089-106863111 AGTGAGAGGGAGAGGGAGGGAGG + Exonic
1058757474 9:108096688-108096710 ACTGAGAGCCAGTGTGAACATGG + Intergenic
1058842937 9:108927896-108927918 AGTGAGGGGCTGAGGGAAGTTGG + Intronic
1059285220 9:113166537-113166559 AGCGAGAGGAAGTGGGAAGAAGG + Intronic
1059965462 9:119609506-119609528 AGAGAGAGAAAGAGGGAAGAAGG - Intergenic
1060704054 9:125781529-125781551 ACCGAGAGGGAGAGGGGAGAGGG + Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061428675 9:130517483-130517505 ACTTCGGGGCAGAGGGGAGAGGG - Intergenic
1061673748 9:132203800-132203822 CCTGGGAGTCAGAGGGAAGGGGG + Intronic
1061765176 9:132877447-132877469 TCTGAGAGGCAAGGGGAAGCTGG - Intronic
1061864100 9:133483664-133483686 ACTCAGAGACCCAGGGAAGATGG + Intergenic
1061957469 9:133971158-133971180 ACTGAGGGTCAGAGGGCACACGG - Intronic
1062207073 9:135343103-135343125 GCTGAGAGGCAGGAGGAAGCTGG - Intergenic
1062525381 9:136976181-136976203 CCTGAGAGGCAGGGAGAAGGAGG - Intergenic
1062707870 9:137955186-137955208 ACAGACAGGGACAGGGAAGAAGG - Intronic
1185619532 X:1444992-1445014 ACAGAGAGAGAGAGAGAAGAGGG - Intronic
1185626663 X:1487433-1487455 ACTGAGGGGCAGAGGGCATAAGG + Intronic
1185772188 X:2773265-2773287 ACTGAGGGGAGGAAGGAAGAAGG + Intronic
1185918118 X:4058788-4058810 AGGGAGTGACAGAGGGAAGAAGG + Intergenic
1185979558 X:4761740-4761762 AGTGAGAGAGAGAGAGAAGAAGG + Intergenic
1186348336 X:8717633-8717655 ATAGAAAGGGAGAGGGAAGAGGG + Intronic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186785119 X:12949923-12949945 TCTGTGAGCCAGTGGGAAGACGG - Intergenic
1186917073 X:14234378-14234400 AATGTGAGGAAGAGGGAAGTAGG - Intergenic
1186942800 X:14529295-14529317 ACGGAGAGGGTGAGGGAAGTGGG - Intronic
1186965524 X:14782673-14782695 ATTGAAAGCCACAGGGAAGAAGG + Intergenic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1187020219 X:15373757-15373779 GCTAAGAGGTAGAGGGAACATGG - Intronic
1187343321 X:18440989-18441011 TGTTAGAGGAAGAGGGAAGAGGG + Intronic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1187471081 X:19570283-19570305 TCTGTGAGGCAGAGGGTAGTGGG + Intronic
1187509941 X:19908636-19908658 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1188025817 X:25208244-25208266 ACTGAGAGGCTGAGTTAATAAGG + Intergenic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1188225381 X:27591479-27591501 AGAGAGAGGTAGAGGGAAGGGGG - Intronic
1188284490 X:28311498-28311520 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1188368150 X:29335266-29335288 ACGGAGACGGAGAGGGGAGAGGG + Intronic
1188506312 X:30888874-30888896 CCCGAGAGGCCGAGGGGAGAGGG - Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1188883345 X:35518061-35518083 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1189094581 X:38124762-38124784 ACTTTGAGGGACAGGGAAGATGG + Intronic
1189214370 X:39310592-39310614 ACTGAGAGGAACAGGGAAGGTGG + Intergenic
1189442340 X:41048667-41048689 ACTGAAAGGCAGAGAGAAAAAGG - Intergenic
1189511466 X:41666428-41666450 AGAGAGAGACAGAGGGAGGAAGG - Intronic
1190158863 X:48016258-48016280 AGGGAGAGGGAGAGGGATGAGGG - Intronic
1190174560 X:48138529-48138551 AGGGAGAGGGAGAGGGATGAGGG - Intergenic
1190711709 X:53076469-53076491 ACAGAGAGACAGAGAGATGAGGG - Intronic
1191226848 X:58053214-58053236 AAAGAGAGGGAGAGGGAAAAGGG - Intergenic
1192197349 X:69037367-69037389 TGTGAGAGACAGAGGGGAGAGGG - Intergenic
1192334174 X:70203793-70203815 ACATAAAGACAGAGGGAAGAAGG + Intronic
1192448027 X:71224807-71224829 AGAGAGAGGGAGAGGGAAGAGGG - Exonic
1192768346 X:74165699-74165721 ACCGAGAGGGAGAGGGGAGAGGG - Intergenic
1192843075 X:74877975-74877997 ACTGACAAGCTGAGAGAAGAAGG - Intronic
1193192831 X:78592939-78592961 ACTGAGAGCCATAAGGCAGAGGG - Intergenic
1193201608 X:78697948-78697970 ACTAAAAGGAAGAGGGAAGATGG + Intergenic
1193238863 X:79142798-79142820 ACAGAGTGGCAGAGGGCTGATGG - Intergenic
1193732330 X:85116229-85116251 ATTGAGAGGCATAAGGCAGAAGG + Intergenic
1193968693 X:88022865-88022887 ACTGAGAGGCGTAAGGTAGAAGG + Intergenic
1194046781 X:89016959-89016981 ACTGGGAGGCTGAGGCAGGAGGG - Intergenic
1194161921 X:90464674-90464696 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1194215237 X:91123336-91123358 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1194627595 X:96243664-96243686 ACTGAGGGGCATAAGGCAGAAGG + Intergenic
1194652368 X:96531294-96531316 AAAGAGAGTCAGTGGGAAGATGG + Intergenic
1195294550 X:103463090-103463112 ACTGAGTGGCAGAGAGAATAAGG + Intergenic
1195299201 X:103510263-103510285 ACTGAGGGACAGAGAGAATAAGG - Intronic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1195641787 X:107183492-107183514 TCTGAAAGGTAGAGAGAAGAAGG + Intronic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1196864705 X:120060341-120060363 GCTGGGAGCCAGAGGGGAGAGGG - Intergenic
1196878396 X:120175990-120176012 GCTGGGAGCCAGAGGGGAGAGGG + Intergenic
1197158014 X:123291413-123291435 ACTGAGAGAGGGAGAGAAGAAGG + Intronic
1197694333 X:129534866-129534888 TCTGAGAGGAAGAGGCAAGCAGG + Intergenic
1197837688 X:130712842-130712864 ACTGAGGGGCATAAGGAAGAAGG - Intronic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1198039086 X:132831546-132831568 ACTGAGAGGCAGTGTCCAGAAGG - Intronic
1198381622 X:136089169-136089191 AATGAGAGACAGAGGGAACAAGG + Intergenic
1198388542 X:136150345-136150367 AAGGAGAGGCATGGGGAAGAAGG - Intronic
1198608360 X:138369533-138369555 ACTGAAAGGAAGAGCGAACAAGG + Intergenic
1198703556 X:139422540-139422562 ACTTAGGGGCAGAGGGCAAATGG - Intergenic
1198957790 X:142150665-142150687 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1199511897 X:148631678-148631700 ATTGAAAGGCAGGGGGAGGAGGG + Intronic
1199578242 X:149335019-149335041 ACTGACAAGCTGAGAGAAGAAGG + Intergenic
1199586257 X:149420108-149420130 AGGGAGAGGCAGAGGGGAGAGGG - Intergenic
1200071510 X:153531587-153531609 ACTCAGGGGCAGAGGGCAGGAGG - Intronic
1200411966 Y:2869737-2869759 CCTAAGAGACAGATGGAAGAAGG + Intronic
1200464184 Y:3494605-3494627 ACTGAGGGGCATAAGGCAGAAGG - Intergenic
1200508202 Y:4042419-4042441 ACTGAGAGGCATAAGTCAGAAGG + Intergenic
1201240711 Y:11954611-11954633 AGAGAGAGACAGAGGGATGAGGG - Intergenic
1201417482 Y:13761860-13761882 AAAGAGAGGGAGAGGGAAAAGGG - Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1201907435 Y:19100196-19100218 AATAAGAGGAGGAGGGAAGAAGG - Intergenic
1201910024 Y:19124528-19124550 ACTGAGAGGCATAAGGCAGAAGG + Intergenic