ID: 1022256167

View in Genome Browser
Species Human (GRCh38)
Location 7:28660779-28660801
Sequence ACTTCCCAGAATGAGTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022256167_1022256169 -8 Left 1022256167 7:28660779-28660801 CCTCACAACTCATTCTGGGAAGT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1022256169 7:28660794-28660816 TGGGAAGTGCTGGAATCCAAAGG No data
1022256167_1022256171 11 Left 1022256167 7:28660779-28660801 CCTCACAACTCATTCTGGGAAGT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1022256171 7:28660813-28660835 AAGGAAAAAGCCATCCTCCTTGG No data
1022256167_1022256173 24 Left 1022256167 7:28660779-28660801 CCTCACAACTCATTCTGGGAAGT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1022256173 7:28660826-28660848 TCCTCCTTGGCACTGCCTGCAGG No data
1022256167_1022256175 25 Left 1022256167 7:28660779-28660801 CCTCACAACTCATTCTGGGAAGT 0: 1
1: 0
2: 0
3: 19
4: 186
Right 1022256175 7:28660827-28660849 CCTCCTTGGCACTGCCTGCAGGG 0: 1
1: 0
2: 3
3: 31
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022256167 Original CRISPR ACTTCCCAGAATGAGTTGTG AGG (reversed) Intronic
901844283 1:11972115-11972137 AGTTGCCAGAAAGGGTTGTGAGG + Intronic
901849805 1:12008307-12008329 ACTTCCCAGAAGGGGTGGTTGGG + Intronic
903601171 1:24541884-24541906 ACTTCGGAGACTGAGTTGGGAGG - Intergenic
905120945 1:35681417-35681439 ACTTCCCAGGCTGAGGTGGGCGG + Intergenic
905484384 1:38285131-38285153 ACTTCCCAGAAGCTGTTCTGGGG + Intergenic
905519734 1:38588771-38588793 ACTTCCCAGGGTGGGTGGTGGGG - Intergenic
906314551 1:44777799-44777821 ACTTCCCTGTAGGGGTTGTGGGG + Intronic
906379711 1:45324776-45324798 ACCTCCCAGAAGGTGTTGTGTGG - Intergenic
908860003 1:68473691-68473713 ACCTCTCAGAATGTGTAGTGAGG - Intergenic
908992802 1:70113904-70113926 ATTTCCCAAAATGTGTTGTGTGG - Intronic
909511964 1:76463748-76463770 AAGGCCCAGAATGAGTTGGGAGG - Intronic
911097828 1:94069632-94069654 ACATCCCAGAATGAGTTTCCTGG + Intronic
912856977 1:113178071-113178093 CCTTCCCAGACTGATTTTTGTGG - Intergenic
916124566 1:161557722-161557744 ACTTCCCAGAGGGAGTTTGGAGG + Intergenic
916134456 1:161639072-161639094 ACTTCCCAGAGGGAGTTTGGAGG + Intronic
916538437 1:165728031-165728053 ACTTCCCAGAAGGAGGTGGTGGG + Exonic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
917637608 1:176952176-176952198 AATTCCCAGAGTGTGTTCTGGGG + Intronic
919490769 1:198202628-198202650 ACTTTCCACCATGAATTGTGAGG - Intronic
920607283 1:207401317-207401339 ACTTCCCTGAGTGAGCTTTGGGG + Intergenic
920969335 1:210729652-210729674 ACTTTTCATAATAAGTTGTGAGG - Intronic
922903269 1:229154820-229154842 GCTTCCCACAATGAGTGGAGGGG - Intergenic
1063017311 10:2091745-2091767 ACTTCCCCAAGTGAGCTGTGTGG - Intergenic
1064072355 10:12241765-12241787 TCTTCTCTGAATGAGTTTTGAGG - Intronic
1065829686 10:29603372-29603394 ATTTCCAAGAAAGAGTTCTGTGG + Intronic
1069106782 10:64393105-64393127 ACTTCCCAGACTGTGATGGGAGG + Intergenic
1069620353 10:69833767-69833789 ATTTCCCAGAGTGGGGTGTGGGG - Intronic
1069827815 10:71265108-71265130 ACCTACCAGAAAGAGTTGCGGGG + Intronic
1070504577 10:77101914-77101936 CCTTCCCAGAAAGAGTCGAGAGG + Intronic
1071199489 10:83203023-83203045 GCTTCACAGAATGAGTTAGGGGG + Intergenic
1072532138 10:96329731-96329753 TCTTCCCAGAAGGAGTTGGAGGG + Intronic
1075931116 10:126296866-126296888 AATTCACAGAATAAGTTGTTAGG - Intronic
1079073568 11:17368788-17368810 AGTTCCCAGCAGCAGTTGTGTGG + Intronic
1080199030 11:29647002-29647024 ATTTCCCAAAATGGGTTCTGTGG - Intergenic
1087519436 11:99212349-99212371 AATCCCCAGCATGGGTTGTGGGG + Intronic
1088077576 11:105870132-105870154 AATCCCCAGCATGAGTTCTGTGG - Intronic
1088468486 11:110167815-110167837 ACCACTCAGAATGGGTTGTGTGG - Exonic
1090253167 11:125264904-125264926 ACTTCCCAGAGTGGGCTCTGGGG + Intronic
1091063455 11:132486735-132486757 ATTTCCCAAAATATGTTGTGAGG - Intronic
1092191417 12:6523861-6523883 AAGTGCCAGAATGAGTTGTACGG + Intronic
1092804346 12:12205847-12205869 ACTACCCAGAATGAGCGGTATGG + Intronic
1093061751 12:14614588-14614610 GCTTCCCTGAATCAGATGTGGGG - Intronic
1094479725 12:30872008-30872030 ATTTCAGAGAATGAGTTGGGAGG - Intergenic
1095377078 12:41542779-41542801 ACTTCCTAGAATTATTTGGGAGG - Intronic
1095846164 12:46747239-46747261 GCCTCATAGAATGAGTTGTGGGG - Intergenic
1098509582 12:71295987-71296009 ATTTCTCAGAATGGCTTGTGTGG - Intronic
1098557162 12:71832409-71832431 GCTTCATAGAATGAGTTTTGAGG + Intergenic
1098982375 12:76971058-76971080 GCTTCATAGAATGAATTGTGGGG + Intergenic
1099660407 12:85551217-85551239 ATTTCCCACAATCTGTTGTGAGG + Intergenic
1100577186 12:95903892-95903914 GCTTCACAGCATGAGTTGTGAGG + Intronic
1101405097 12:104421585-104421607 ACTTACCATAGTGGGTTGTGAGG + Intergenic
1102898068 12:116614550-116614572 AATTCCCGGCATGAGTTCTGGGG + Intergenic
1103351037 12:120283711-120283733 ACTTCCCAGGCTGAGGTGGGTGG + Intergenic
1103898657 12:124291776-124291798 TTTTCCCAGAATGCTTTGTGTGG - Intronic
1104351671 12:128049450-128049472 TCATCCCAAGATGAGTTGTGAGG + Intergenic
1105252959 13:18716958-18716980 ACTTCCCAAAATGCCTTGTGGGG + Intergenic
1106301917 13:28474527-28474549 ACTTAGCACAATGATTTGTGGGG - Intronic
1106829365 13:33562814-33562836 ACTTCCTAGCATTAGTTGAGGGG + Intergenic
1107776100 13:43843570-43843592 ACCTCCTAAAATGAGTTGGGAGG + Intronic
1108191984 13:47951024-47951046 ACTCTCCAGAATGAGGTGAGAGG - Intronic
1111251441 13:85606885-85606907 ACTTCCCAGAATGAGTGTGGTGG - Intergenic
1111713357 13:91846091-91846113 TCTTTGCAGAAAGAGTTGTGGGG + Intronic
1113128503 13:107007885-107007907 ACTTCTCAGATTGAGTGCTGAGG + Intergenic
1116414483 14:44664078-44664100 ACTTCCCAGAATAAGTTTCTCGG - Intergenic
1116493120 14:45528994-45529016 GCTTCATAGAATGAGTTATGAGG - Intergenic
1117756107 14:58975847-58975869 ACTTCCCAGAATGAGATTTTAGG - Intergenic
1120531659 14:85639488-85639510 ACGTCTCAGAATGACTGGTGGGG - Exonic
1121725985 14:96150213-96150235 AATTCCCACAATGACTTATGAGG + Intergenic
1122310842 14:100793071-100793093 ACTTCCCTGGGTGAGATGTGAGG + Intergenic
1123780030 15:23617167-23617189 ACTTGAATGAATGAGTTGTGTGG + Intronic
1123819652 15:24015250-24015272 ACTTGCCAGAATGTATTCTGAGG + Intergenic
1126408120 15:48343929-48343951 AGTTCCCAGCATGAATTTTGGGG + Intergenic
1126773911 15:52083237-52083259 ATTTCTCAGAATCAGTTGTCAGG - Intergenic
1127341887 15:58054572-58054594 GCTTGCCAGAAAGAGTTGGGTGG - Intronic
1129454013 15:75666965-75666987 ACTTCCCAGAACGAGTCATTGGG - Intergenic
1129869204 15:78929924-78929946 ACTTCCCAGCTTTAGCTGTGTGG - Intronic
1135547499 16:23375841-23375863 ACTTCCCAGACTGGGGTGAGCGG + Exonic
1136044472 16:27604340-27604362 ACTTCACAGGCTGAGTTGGGAGG - Intronic
1137341335 16:47609397-47609419 ACCTCTTAGAATGAGTTGGGAGG + Intronic
1137844882 16:51677519-51677541 ACTTCCCAGAAAGAGGTGGAGGG - Intergenic
1139214723 16:65116132-65116154 ACTTTCCAGAATGAGTTTATGGG + Intronic
1140021416 16:71242603-71242625 ACTTCCCAAAGTGAGTTGTAAGG - Intergenic
1140856614 16:78983530-78983552 AGATCTCAGAATGAGTTGTGGGG + Intronic
1141850594 16:86642660-86642682 ATGTCCCTGAATGAGGTGTGAGG - Intergenic
1143396168 17:6599389-6599411 TATTACCAGAATGACTTGTGTGG + Intronic
1143958296 17:10692881-10692903 GCTCCCCAGTATGAGTTGTGAGG + Exonic
1146130825 17:30273466-30273488 ATTTTTCAGAATGAGTTTTGAGG - Intronic
1151991174 17:77575368-77575390 ATTTCCCAAAATGTGTTTTGTGG + Intergenic
1154031779 18:10759504-10759526 ACTTCCCAGATTTCATTGTGCGG - Exonic
1155251147 18:23954291-23954313 ACTTGGCAGACTGAGGTGTGAGG + Intronic
1155366306 18:25052191-25052213 ACTTCCCAGAGAGAATTGTGAGG - Intergenic
1155398184 18:25408506-25408528 ACTTCACTGAAGGAGATGTGGGG - Intergenic
1156468511 18:37362809-37362831 ATTTGTCAGAATGAGATGTGAGG - Intronic
1157368613 18:47089570-47089592 ACTGCTCAGAATGAGAAGTGGGG + Intronic
1161344176 19:3759794-3759816 ACTCCCCAGAATGGGTGGAGGGG - Exonic
926805368 2:16705694-16705716 ACAACCCAGAAAGAGTTGTCTGG + Intergenic
927461364 2:23301147-23301169 AGTTTTCAGAATGAGTTCTGTGG + Intergenic
928680306 2:33694423-33694445 GCCTCACAGAATGAGTTGGGGGG + Intergenic
931072813 2:58673244-58673266 ACTGCCCAGGATGGGTTGTGTGG - Intergenic
933991464 2:87637232-87637254 TCTTCTGAGACTGAGTTGTGAGG - Intergenic
936302379 2:111313590-111313612 TCTTCTGAGACTGAGTTGTGAGG + Intergenic
937735194 2:125279408-125279430 TCTTGCCAGCATGAGTTGGGAGG + Intergenic
938151343 2:128887343-128887365 ACCTCACAGAATGAGTAGAGAGG + Intergenic
943471477 2:188299512-188299534 ATTTCCCAGAATGAGAAGGGGGG - Intronic
943775130 2:191757071-191757093 ATTTCCCATAATGAATTGTGTGG + Intergenic
944038232 2:195323913-195323935 AGTTTCCAAAATGAGTTTTGGGG - Intergenic
944473307 2:200078740-200078762 ACGGCCCAGAATGTGTTGGGTGG - Intergenic
945557994 2:211302687-211302709 TCTTCCCAGAGTGCGATGTGAGG - Intergenic
945692095 2:213049707-213049729 ACTTACCAGAATGGGTCCTGAGG + Exonic
948317082 2:237036183-237036205 ACTTTGCAGAAAGAGCTGTGGGG - Intergenic
1170160509 20:13305449-13305471 GCTTCCCAGGAAGTGTTGTGGGG + Intergenic
1172643630 20:36456528-36456550 CCTTCCCAGAATGAATAATGAGG + Intronic
1173179812 20:40797461-40797483 AGTTAACAGAATGAGTTTTGTGG - Intergenic
1173616769 20:44408275-44408297 TCTTCCAAGGATCAGTTGTGGGG - Intronic
1176838464 21:13816841-13816863 ACTTCCCAAAATGCCTTGTGGGG + Intergenic
1183230442 22:36578723-36578745 TCTTCCCAGAATGAGGTCAGAGG - Intronic
1184436354 22:44480228-44480250 ATTTCCCAGCATGAATTCTGAGG + Intergenic
950125653 3:10508273-10508295 ACTTCGAAGAATGAGTAGGGTGG - Intronic
951866654 3:27316173-27316195 ACTGGCCAGAATTAGCTGTGGGG + Intronic
953916663 3:46924912-46924934 ACTTCCTGGCATGAGTGGTGTGG + Intronic
954100922 3:48372071-48372093 AAATCCCAGAATGAGTTGTCAGG + Intergenic
954765499 3:52912156-52912178 AATTCACAGAATCAGTTCTGTGG - Intronic
955066319 3:55536370-55536392 ACTTCCCAGACGTAGCTGTGCGG + Intronic
957512370 3:81205804-81205826 ACTTATTAGAAAGAGTTGTGGGG - Intergenic
959388993 3:105749620-105749642 ACTTCCTAGAATGAGCAGTTAGG + Intronic
960344910 3:116519395-116519417 ACTTCCCAGACAGGGTGGTGGGG - Intronic
960778523 3:121290540-121290562 GCTTCACAGAATGATTTGGGGGG - Intronic
960848276 3:122024334-122024356 ATTTCCCAAAATAAGTTCTGTGG - Intergenic
961643494 3:128379892-128379914 ACTCCCAAGAATGAGTCATGTGG + Intronic
961907332 3:130276554-130276576 ACATCCCAGATTTAGTGGTGGGG - Intergenic
962989860 3:140567993-140568015 ACTTCACAGGATTTGTTGTGAGG - Exonic
964928793 3:161989980-161990002 CATACCCAGAATGAGCTGTGAGG + Intergenic
972063879 4:34914864-34914886 GCTTCACAGAATGAGTTAAGAGG - Intergenic
972796645 4:42427916-42427938 ATTCCCCAAAATTAGTTGTGTGG - Intronic
973562190 4:52148464-52148486 ACTTCCCAGCTTGTGTGGTGAGG - Intergenic
975040695 4:69742376-69742398 TCCTCATAGAATGAGTTGTGAGG + Intronic
977281358 4:95043774-95043796 AATTCCTGGAATGAGCTGTGGGG + Intronic
979091717 4:116491861-116491883 GCTTTCCTGAATGAGTGGTGTGG - Intergenic
982352465 4:154430638-154430660 AATTCTAAGCATGAGTTGTGTGG + Intronic
983873421 4:172848723-172848745 AGTTCTCAGAATGAGTTATTTGG - Intronic
984474793 4:180222408-180222430 GCTTCATAGAATGATTTGTGGGG + Intergenic
986456092 5:7920594-7920616 ACCTCACAGAATGAGTTCTGGGG + Intergenic
986497707 5:8362892-8362914 ACTTCCCAGAATTTGCTGTCAGG - Intergenic
986841411 5:11701960-11701982 GCTTCCCATGATGAGTTATGTGG - Intronic
987243604 5:16026357-16026379 ATGTCCCAGCATGAGTGGTGAGG + Intergenic
988043616 5:25919128-25919150 GTCTCCCAGAATGAGTTGGGAGG - Intergenic
989456716 5:41652551-41652573 GCTTCCCAGCATGAGTGGAGAGG + Intergenic
991155359 5:63428061-63428083 GCTTCACAGAATGACTTGGGAGG + Intergenic
993438801 5:87929551-87929573 GCTTCACAGAATGAGTTGCCGGG - Intergenic
995881366 5:116847935-116847957 ATTTCCCAGAATTGGATGTGGGG - Intergenic
995967354 5:117923884-117923906 ACTGCCCATTATGACTTGTGAGG - Intergenic
997997915 5:138601348-138601370 ACTTTCTAGACTCAGTTGTGAGG + Intergenic
999535128 5:152507942-152507964 ATTTCCAAGAAAGAGATGTGAGG - Intergenic
999987101 5:157014519-157014541 ACTTCCCAGAAGGGGCGGTGGGG - Intergenic
1000799980 5:165713703-165713725 ACTTCCCTAAAGGAGTTTTGGGG - Intergenic
1000936339 5:167306697-167306719 AGTTCCCAGAATAATTGGTGTGG - Intronic
1003003050 6:2354691-2354713 ACTTCCCAAAATGTAATGTGTGG - Intergenic
1003194310 6:3901576-3901598 ACTTGAAAGAATGAATTGTGCGG - Intergenic
1003334736 6:5159724-5159746 ACTTCCCAGAATGTGATTCGAGG - Intronic
1004748166 6:18533700-18533722 ACTTCCCAAAATGTGATGTAAGG - Intergenic
1004923247 6:20396313-20396335 ATTTCTCAGAGTGTGTTGTGTGG + Intergenic
1007996865 6:46316927-46316949 TTTTCCCATTATGAGTTGTGTGG + Intronic
1008774796 6:55025158-55025180 ACTTGACAGAATGTGTTCTGTGG - Intergenic
1011954709 6:93012660-93012682 ACTTCCCAGAATGAGGAATGAGG - Intergenic
1012965923 6:105673026-105673048 GCTTCATAGAATGATTTGTGGGG - Intergenic
1016872579 6:148833376-148833398 ACTTGGGAGAATGAGTTGGGAGG + Intronic
1017870942 6:158486150-158486172 ACTTCCCAATATGAATTTTGGGG - Intronic
1017978935 6:159381687-159381709 GCTTCACAGAATGAGTTCTGTGG + Intergenic
1021906570 7:25339669-25339691 CCTTGCCAGAATCAGTTTTGTGG + Intergenic
1022256167 7:28660779-28660801 ACTTCCCAGAATGAGTTGTGAGG - Intronic
1024357540 7:48430041-48430063 ACCTCATAGAATGAGTTGAGAGG + Intronic
1025008213 7:55371959-55371981 ACTTCTCAGAGTGAGGTTTGTGG + Intronic
1025734843 7:64137755-64137777 ACTTCCCAGAGTCTGCTGTGGGG - Intronic
1025856922 7:65289176-65289198 AGCTCCCAGAATGATTAGTGTGG - Intergenic
1029189811 7:98763603-98763625 ACTTCCCAGAAAATGTTGGGGGG + Intergenic
1030384670 7:108854269-108854291 ACTACTCAAAATGAGTTCTGTGG + Intergenic
1031290247 7:119925381-119925403 ATTACCTAGAATGAGTTCTGAGG + Intergenic
1033274843 7:139964026-139964048 AATTCCCAGAAAGAGTCATGAGG + Intronic
1034625846 7:152491764-152491786 ATTTCCCAGCATGGGTAGTGTGG - Intergenic
1036276535 8:7356318-7356340 ACTTACCAGAATAAAATGTGGGG + Exonic
1036754435 8:11463228-11463250 ACTTCCCAAATTTGGTTGTGTGG - Intronic
1036788433 8:11702851-11702873 TCTTCCCTGAATGAGAGGTGCGG - Intronic
1037134601 8:15446040-15446062 ACTTCTCAGAAGGGGTGGTGGGG + Intronic
1038528760 8:28299342-28299364 CCTTCCCAGACTGAGTCGTCTGG + Intergenic
1039881950 8:41630604-41630626 ACTTTCCAGAATGTGGGGTGGGG - Intergenic
1043622384 8:82211284-82211306 ATTACCCAGAATAAATTGTGAGG + Intergenic
1045421707 8:102022906-102022928 AGTTCTAAAAATGAGTTGTGAGG - Intronic
1047153200 8:122287610-122287632 ACTGCCCAGAATGAATTGTTAGG - Intergenic
1047775570 8:128067619-128067641 TCTTCCCAGAAGGAGGTGTGGGG + Intergenic
1048003444 8:130398873-130398895 TCTTTCAAGAATGAGTAGTGTGG + Intronic
1050144254 9:2549312-2549334 AGATGCCAGACTGAGTTGTGTGG + Intergenic
1050986379 9:12088468-12088490 ACTTCATAGAATGAGTTAGGGGG + Intergenic
1059996143 9:119912093-119912115 ATTTCACAGAATTGGTTGTGAGG + Intergenic
1186591867 X:10939141-10939163 ATTTCCCAAAATGAGTTCTATGG - Intergenic
1190164278 X:48059241-48059263 TCTTCCCAGTATGAGTTATCTGG + Exonic
1192100529 X:68259624-68259646 ACTTACCACATAGAGTTGTGGGG - Intronic
1194869249 X:99107611-99107633 ACTTGACAGGCTGAGTTGTGAGG + Intergenic
1195623389 X:106982212-106982234 ACTTCCCAAAATTTGTTCTGTGG + Intronic
1195706751 X:107742960-107742982 ACCTCCCAGAGTCAGTGGTGAGG + Intronic
1195901664 X:109804232-109804254 ATTTAGCAGAATGAGTTGGGAGG - Intergenic
1198343500 X:135737476-135737498 ACTTCCCAGAAAGAGAACTGTGG + Intergenic
1199023032 X:142904703-142904725 ATTTCCCTGGATTAGTTGTGGGG + Intergenic
1199668061 X:150117780-150117802 ATTTCCCAAAATGTGTTGTCTGG + Intergenic
1201576132 Y:15463386-15463408 GCTTTCCAGGATGAGGTGTGAGG + Intergenic
1201771794 Y:17622938-17622960 ACTTCTCAGAGCAAGTTGTGGGG - Intergenic
1201829761 Y:18283048-18283070 ACTTCTCAGAGCAAGTTGTGGGG + Intergenic