ID: 1022257838

View in Genome Browser
Species Human (GRCh38)
Location 7:28677092-28677114
Sequence TTTTATCTTAAAATAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 801}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022257835_1022257838 23 Left 1022257835 7:28677046-28677068 CCAATGTCTAAAGGCTTGATCAC 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG 0: 1
1: 0
2: 3
3: 62
4: 801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022257838 Original CRISPR TTTTATCTTAAAATAGAAGA GGG Intronic
901829035 1:11880910-11880932 GTTTATCTGAACACAGAAGATGG - Intergenic
902421285 1:16282524-16282546 TTTTTTTTTAAAAGAGAAAATGG - Intronic
903892505 1:26579053-26579075 TTTTTTCTTTAAATAGAAACGGG - Intergenic
904550204 1:31310195-31310217 ATTTATGTTAAAATAGATTAAGG + Intronic
904966056 1:34373604-34373626 TTTCTTTTTAAAAGAGAAGAAGG - Intergenic
904982068 1:34513792-34513814 GCTTATATTAAAAAAGAAGAGGG + Intergenic
906625752 1:47324184-47324206 TTTTTTTTTAAAAAAAAAGATGG + Intergenic
907811344 1:57873523-57873545 TTTAATCTTGAAATTGTAGATGG + Intronic
908229700 1:62091744-62091766 TTTTTTTTTAAAATAAGAGATGG - Intronic
908278215 1:62499353-62499375 TTTCATGTAAAAATAAAAGATGG + Intronic
908311746 1:62891133-62891155 ATTTATCTTAAGGTAGTAGATGG - Intergenic
908343810 1:63210780-63210802 TTTTCTTTTAAAAGAGAGGAGGG + Intergenic
908356582 1:63329268-63329290 TTTTATGTTAAAATGGGGGAGGG - Intergenic
908522813 1:64961024-64961046 TTTTATCTTAGAAGTGAATAAGG - Intronic
908861029 1:68490011-68490033 TTTTATATTAAAATAAAAGGAGG - Intronic
909095393 1:71280775-71280797 TTTTTTCTCAAAACAGCAGATGG - Intergenic
909104855 1:71394510-71394532 TTTTATTTTAAAATATGGGAAGG + Intergenic
909346020 1:74588599-74588621 TTTTATCTTAAAATCAAGAATGG + Intronic
909546079 1:76848525-76848547 CTTTTTATAAAAATAGAAGAGGG - Intergenic
909835434 1:80248643-80248665 TTTTATTGTCAAATGGAAGAAGG + Intergenic
910135485 1:83963540-83963562 CTTTATTTTAAAATAAAAAATGG - Intronic
911313693 1:96329591-96329613 TTTTAGCATAAAATCTAAGACGG + Intergenic
911353244 1:96782234-96782256 TTTTATTTTAACATATAAGTGGG + Intronic
911496221 1:98634811-98634833 TTTTTACATAATATAGAAGAGGG + Intergenic
911506970 1:98765342-98765364 TTTTATCTTAAAACATGACAGGG + Intergenic
911711281 1:101076554-101076576 TTTTATGTTATATTAGAAAATGG - Intergenic
911755960 1:101557134-101557156 TTTTATTTTAAAAAAAAAGGGGG - Intergenic
912530398 1:110316790-110316812 ATTTATCTCAAGATAGAACATGG + Intergenic
912969675 1:114269007-114269029 TTTGAACTTAAAATAAAAGTAGG + Intergenic
912989042 1:114465628-114465650 TTTTATTTTAAAATTAGAGATGG - Intronic
913692518 1:121292863-121292885 GTTTCTCTTAATATAGAAGAAGG + Intronic
914145038 1:144987231-144987253 GTTTCTCTTAATATAGAAGAAGG - Intronic
914422836 1:147545011-147545033 ATTAATCTTAAAAAAAAAGATGG - Intronic
916164634 1:161955081-161955103 TTTTATGACAAAATAGAACATGG - Intronic
916448071 1:164892240-164892262 ATTTACCTTAAAAGAGCAGATGG + Intronic
916780022 1:168015694-168015716 TTATACATTAAAAAAGAAGAAGG - Intronic
916856379 1:168754539-168754561 TTTTAAGTTAAAAAAGAAGTAGG - Intergenic
917570834 1:176263536-176263558 TTTAGTCTTAAAATAGATAAAGG + Intergenic
918355315 1:183702389-183702411 CTTCATTTTAAAATAGAAGAAGG - Intronic
918551749 1:185750235-185750257 TTCTTTCTTTAAATAAAAGAAGG - Intronic
918600513 1:186353492-186353514 GTTTCTATTAAGATAGAAGAGGG - Intronic
918684038 1:187392691-187392713 TATTTTTTTAAAATATAAGATGG - Intergenic
918743954 1:188174335-188174357 TGTTATTTCAAATTAGAAGAAGG + Intergenic
918748137 1:188232837-188232859 TTTTATTTTAAAAGCTAAGATGG - Intergenic
919195881 1:194285524-194285546 TTTCTTCTTAAAATAAAAGCAGG - Intergenic
919211680 1:194495205-194495227 TTGTATTTTAAAATGGGAGAAGG - Intergenic
919380925 1:196860097-196860119 TTTTATTTTTAAATAAAATATGG + Intronic
920235760 1:204503403-204503425 TTTTATGCTAAAGTACAAGATGG + Intergenic
920392509 1:205617916-205617938 TTTAATCTTTAATTAAAAGAGGG + Intronic
920447545 1:206030338-206030360 TTTGTTCTTACAATAAAAGAAGG - Intergenic
920479837 1:206311220-206311242 ATTTCTCTAAATATAGAAGAAGG + Intronic
920774311 1:208921312-208921334 TTTTACTATAAAATAAAAGAGGG + Intergenic
921146194 1:212359692-212359714 GGTTATCTTAAAGTAGAAAATGG + Intronic
921575013 1:216824819-216824841 TTTTATCTGAGAAATGAAGATGG + Intronic
922007358 1:221545327-221545349 TTTTATTTTAAAATAGAAAGGGG + Intergenic
922260863 1:223944838-223944860 TTTTATATCTAAATAGAAGCTGG - Intergenic
922401088 1:225256890-225256912 TTTTTTTTTAAAATAGCAAATGG - Intronic
922509102 1:226148368-226148390 GTTTATTTTAAAAAAGCAGATGG + Intronic
922736205 1:227980892-227980914 TTTTATATCTAAATAGAAGCTGG + Intergenic
922944430 1:229499595-229499617 TTTTATTTTTAAATAGAGGTGGG - Intronic
923206387 1:231762905-231762927 TCTTATTTTAAAAATGAAGAAGG + Intronic
923346733 1:233060890-233060912 TTTTGTATTAACATAAAAGAGGG - Intronic
923584924 1:235260083-235260105 TTTTGTCTTAATATAGAAAAAGG - Intronic
923613701 1:235518652-235518674 TTTAATCTTAAAAGATAAAAGGG + Intergenic
923693373 1:236220015-236220037 TTTTTTTTTAAAAGAGATGAGGG - Intronic
923921468 1:238569049-238569071 TTTTAACTTCTAAAAGAAGAAGG - Intergenic
924275608 1:242383587-242383609 TTTTATCTTTAAATGAAAGCTGG + Intronic
924293240 1:242559673-242559695 GTTTATCTCAAGAAAGAAGAAGG + Intergenic
924342037 1:243047025-243047047 TTTTATATCTAAATAGAAGCTGG - Intergenic
924592531 1:245417306-245417328 TTTTTTCTTAAATTAGAAGAGGG + Intronic
1063429960 10:5979260-5979282 TTTAATATTAAAATAATAGAGGG - Intergenic
1064083715 10:12328952-12328974 TTTTATCTTTAAATACATGTTGG - Intergenic
1064626600 10:17267438-17267460 GTTTATTTTAAAAGAGAAGAAGG - Intergenic
1065495824 10:26326878-26326900 TTTTTTCTTAAAAAATAAAAAGG + Intergenic
1065635765 10:27731673-27731695 TTTTATTTAAAAATAGAATTTGG + Intronic
1065995262 10:31053892-31053914 TTTTATCTTATAAAATAAAATGG - Intergenic
1066175608 10:32901793-32901815 GTTTATATAAAAATAGAAAATGG + Intronic
1066210452 10:33232369-33232391 CTTTATTTTTAATTAGAAGATGG + Intronic
1066283225 10:33938709-33938731 TTTTGCTTTAAATTAGAAGACGG + Intergenic
1066429761 10:35340471-35340493 TTTTACCTTAAAATGGTTGATGG + Intronic
1066634198 10:37484901-37484923 TTTTATCTTTAAATACATGCGGG - Intergenic
1066734444 10:38458515-38458537 TTTTATATCTAAATAGAAGCTGG + Intergenic
1067197142 10:44131798-44131820 CTCTTTCATAAAATAGAAGAGGG + Intergenic
1068188657 10:53620209-53620231 TTTTTTTTTAAAAAAAAAGAGGG + Intergenic
1068277673 10:54823528-54823550 TTTTATGTTAAATTAAATGAAGG + Intronic
1068362973 10:56004055-56004077 TTTAAATTTAAAATGGAAGAAGG - Intergenic
1068454287 10:57235129-57235151 TTGTATCTTCACATAGCAGAAGG - Intergenic
1068544468 10:58330302-58330324 TTTTTTCTTAAATTATATGATGG - Intergenic
1068582510 10:58758057-58758079 TTTTTTTTTAAGATAGTAGAAGG - Intronic
1068736252 10:60416268-60416290 GTTTCTATTAAAATAGAAGATGG + Intronic
1068953291 10:62799837-62799859 TTTTATATTAGTATAGAACATGG - Intergenic
1069078406 10:64062884-64062906 TTATTTCTTAAAATTGAAAATGG + Intergenic
1070204062 10:74238165-74238187 CTTGCTCTTAAAAAAGAAGACGG - Intronic
1070447367 10:76520411-76520433 CGTCATCTTGAAATAGAAGAGGG - Intronic
1070857294 10:79616092-79616114 TTTTTTCTTAATTTTGAAGAAGG - Intergenic
1071026212 10:81117015-81117037 TTTCATCTTAAAATATCAGGGGG + Intergenic
1071164863 10:82793909-82793931 TTTTATATTAAAGTATAATATGG + Intronic
1071238506 10:83677726-83677748 TTTTATCTTAAAAGCAGAGATGG + Intergenic
1071379836 10:85047470-85047492 TTTTCTTTGGAAATAGAAGAAGG + Intergenic
1072257616 10:93635361-93635383 GTTTTTCTTAAATTAAAAGAAGG + Intronic
1072330747 10:94349009-94349031 TTATATTTTAAAATAAAAAATGG - Intronic
1072387731 10:94948787-94948809 TATAATCTTGAAATATAAGATGG - Intronic
1072553741 10:96498551-96498573 GGTTCTCTTAAAATGGAAGAAGG - Intronic
1072628117 10:97127371-97127393 TTATAGCTTAAAAGAGAAAAGGG + Intronic
1072975566 10:100054541-100054563 TTTTATCTTCACAAAGATGATGG + Intronic
1072976646 10:100064707-100064729 TTTTATATTAATATATAAAATGG - Intronic
1073165855 10:101450501-101450523 GTTTATCTTAAAAGAGCAGGAGG + Intronic
1073413238 10:103359862-103359884 TTTTATATTTAAAAATAAGATGG + Intergenic
1073614648 10:104981245-104981267 TTTTAAATTAAAATGCAAGATGG - Intronic
1073737830 10:106370007-106370029 TTTAATAATAAAATAGAAAAAGG + Intergenic
1073868912 10:107838930-107838952 TTTTATCTTGGTACAGAAGAAGG + Intergenic
1074285016 10:112089941-112089963 TTTAATCTGTAAAAAGAAGAGGG - Intergenic
1074502383 10:114038181-114038203 TTTTTTTTAAAAAAAGAAGAGGG + Intergenic
1074620861 10:115119306-115119328 TTTTATCTAAAAGTAGATAATGG + Intronic
1074664073 10:115697869-115697891 TTGTAAATTAAAATAGATGAAGG + Intronic
1075432115 10:122394386-122394408 TTTTATCTTCAAATAAAAATTGG + Intronic
1075878730 10:125830546-125830568 TTTTCTTTTAAAATAGCAAACGG + Exonic
1076632671 10:131860679-131860701 TTTTATTTCAAAAAAGAAAATGG + Intergenic
1077522461 11:3044415-3044437 TTTTATCTAAAAAAAAAAAAGGG - Intronic
1077574084 11:3366510-3366532 TTTGATTTAAAAATAGATGAAGG + Intronic
1078273021 11:9814284-9814306 TTTAATCTTAGAAAAGCAGATGG - Intronic
1078325570 11:10378269-10378291 TATTATCTTAAAAAAACAGAGGG + Intronic
1079200365 11:18372037-18372059 TTTTTTCTTTAAATAGAAGTTGG + Intergenic
1079214055 11:18490604-18490626 TTTCATTTTCAAATAGAAAATGG + Intronic
1079453256 11:20615945-20615967 TTCTATTTTACAATAAAAGATGG + Intronic
1079554940 11:21748059-21748081 TTCTGTGTTAAAATAGCAGATGG - Intergenic
1079926569 11:26500991-26501013 TTTAATGTTAAATTAAAAGATGG - Intronic
1080008570 11:27434879-27434901 TATGATCTTACAATAAAAGATGG + Intronic
1080496632 11:32827171-32827193 TTATAACTTTAAATAGCAGATGG + Intergenic
1081240384 11:40698521-40698543 CTTTATCTTCAAATGGAAAATGG + Intronic
1081345327 11:41978726-41978748 ATTTATCTTTACATAGGAGAAGG - Intergenic
1082871275 11:57945422-57945444 ATTTCTGTTATAATAGAAGAGGG + Intergenic
1085072352 11:73558772-73558794 TTATTTTTTAAAAAAGAAGAAGG + Intronic
1085469072 11:76745316-76745338 TTTTATTTTAAAATAAAGTATGG - Intergenic
1085538422 11:77242677-77242699 TTTTTTTTTCAAATAGAAAATGG - Intronic
1085715995 11:78873916-78873938 TTTTTTCTTAATAGAGAAGGTGG - Intronic
1085831166 11:79902261-79902283 TTTTATCAACAAAGAGAAGATGG + Intergenic
1085984713 11:81771624-81771646 ATTTATCTTAGAAAAGAATAAGG + Intergenic
1086925621 11:92637332-92637354 TGTTATCTTAGAAGAGAGGATGG + Intronic
1087515263 11:99152133-99152155 TTTTACCATTAAATAGAAAAAGG - Intronic
1087671184 11:101108724-101108746 TTATATCTGAAAAAAGGAGATGG + Intronic
1087731749 11:101786390-101786412 TATTATCTTAATATATAAGGTGG + Intronic
1088507989 11:110544624-110544646 TTTTATATTAAAATATAGCAGGG + Intergenic
1089410720 11:118240104-118240126 TCTCATCTTAGAGTAGAAGATGG - Intronic
1089761185 11:120725112-120725134 TTTTATTTCAGAATAGAAAAGGG + Intronic
1089805331 11:121082665-121082687 TTTCTTCTTAAAATAGCTGATGG - Intronic
1090169701 11:124589894-124589916 TTTTATTTTCAAATACTAGAAGG - Intergenic
1090624808 11:128597423-128597445 TTTTATCTTTCATCAGAAGATGG + Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1091126430 11:133103326-133103348 TTTAATCTCAAAATACAACATGG - Intronic
1091152197 11:133339291-133339313 TTTCATCTTTAAATTGGAGAAGG - Intronic
1092403141 12:8194920-8194942 TTTTATTTTAAAGTTGTAGAGGG + Intergenic
1093357394 12:18183494-18183516 TTTTCTCTCAAAAGAGAAAATGG - Intronic
1093697304 12:22175917-22175939 ATTTATCTCAGAATAGAAGGAGG - Intronic
1093766943 12:22974904-22974926 TTTCTTCTTAAAATATAAGTGGG - Intergenic
1093900838 12:24630246-24630268 TTTTATATAAAATTAGAAGAGGG - Intergenic
1094028090 12:25980306-25980328 ATTTATCTTAGAATAGATTACGG - Intronic
1094165312 12:27437102-27437124 TTTTAACTTAAAACATAAGTGGG + Intergenic
1094379760 12:29830501-29830523 TTGTATTTTACAATATAAGAAGG - Intergenic
1095315933 12:40761303-40761325 TTTTCTCATAAAATAGTAGTGGG + Intronic
1095433657 12:42163905-42163927 TTTTCTCATCAAATAGAAAAGGG - Intronic
1095516955 12:43016410-43016432 TTTTATTTTGAAATATGAGAAGG + Intergenic
1095647816 12:44569846-44569868 TTTTCTCTTTAAAAAGAATAAGG + Intronic
1096064287 12:48727128-48727150 TTTTAATTTAAAATTGAAAATGG + Intergenic
1096682497 12:53265779-53265801 TTTTAGCCTCAAATAGAAGAAGG - Intergenic
1097043786 12:56172380-56172402 TTTTCTCTGAAAACAGAAGTGGG - Intronic
1097255362 12:57669708-57669730 TTTTTTAATAAAAAAGAAGATGG - Intergenic
1097289516 12:57902633-57902655 TTTTACCCTTTAATAGAAGATGG - Intergenic
1098368314 12:69730455-69730477 GTTTATCATAAAAGAGAAGGTGG - Intergenic
1098561736 12:71880924-71880946 TTTTATCCTAAAGTAACAGAGGG + Intronic
1098785855 12:74754151-74754173 TTTTTTGTTAAAAAAGATGATGG - Intergenic
1099322890 12:81173607-81173629 TTTTTTCTTAATTTAGAAAAAGG - Intronic
1099625317 12:85065442-85065464 TTTTATAATAAAATATAAAATGG + Intronic
1099679621 12:85808795-85808817 TTTTATTTTAAAATAAATAATGG + Intronic
1100085196 12:90902008-90902030 TTTTATATCAAAGAAGAAGAAGG - Intergenic
1100244679 12:92745376-92745398 TTTTATCATTAACTAGAACAGGG - Intronic
1100621665 12:96281923-96281945 TTTTACTTTAAAATAGAGTAAGG - Intronic
1101206799 12:102496375-102496397 GTTTATCCTACAATACAAGAGGG + Intergenic
1101371503 12:104135609-104135631 TTTTCTCATAAAATTAAAGAGGG + Intronic
1101492686 12:105223767-105223789 TATTATCATAAAACAGAAGACGG + Intronic
1101896327 12:108759768-108759790 TTCTATCTAAAAATAAAAAAAGG + Intergenic
1102542605 12:113633398-113633420 TTTTATTTTAAAATAGAGATGGG - Intergenic
1103250410 12:119495005-119495027 TTTCATCATAAAACAGTAGATGG - Intronic
1103465272 12:121137520-121137542 TTGTATTTTAAAATATAAAATGG + Intronic
1104135353 12:125932519-125932541 TTTGATCTTACATTACAAGAGGG + Intergenic
1104338754 12:127927415-127927437 TTTTATTCTAAAATATGAGAAGG + Intergenic
1106082247 13:26510296-26510318 TTTTCTCTTAACATTGAATATGG + Intergenic
1106345744 13:28875731-28875753 TTATATCTTTAAATAAAAAATGG + Intronic
1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG + Intergenic
1107183454 13:37489133-37489155 TTTTATCCTGTAAAAGAAGAAGG - Intergenic
1107211512 13:37861996-37862018 TTTAATCTTGAAAATGAAGAAGG - Intronic
1107387444 13:39927397-39927419 TTTTATCTTAAAGGACAAGAAGG - Intergenic
1107477367 13:40751928-40751950 TTTTATTTTAAAAAGTAAGATGG + Intronic
1107705594 13:43100511-43100533 GTCTATGTTAAAAAAGAAGACGG - Intronic
1107870503 13:44742303-44742325 TTTTACGCTAAAATAGAATACGG - Intergenic
1108937897 13:55908253-55908275 TTTTATTTTTAAATAGAAATTGG + Intergenic
1109329341 13:60908798-60908820 ATTTATTTTTAAATAGAGGAGGG - Intergenic
1109474453 13:62860880-62860902 TTTTATTTTAAAATATTATATGG - Intergenic
1109524625 13:63558784-63558806 TTTTAGTTTAATATATAAGAAGG + Intergenic
1109818841 13:67624371-67624393 TTTTATCTGAAGCTAGTAGAAGG - Intergenic
1110232356 13:73180290-73180312 TTTTTTTTTAAAAAAGTAGAAGG - Intergenic
1110255360 13:73427658-73427680 TTTTTTGATAAAATAGATGAAGG + Intergenic
1110262271 13:73499034-73499056 TTTTTTCTTAAGTTAGAAGAAGG - Intergenic
1110428161 13:75392638-75392660 CTGTCTCTTAAAAAAGAAGAAGG - Intronic
1110709236 13:78631799-78631821 TTTTAAGTTAAAATTGAGGAAGG + Intronic
1111145814 13:84177814-84177836 TTTTAGCTGAATATAGAAAAGGG - Intergenic
1111568104 13:90043087-90043109 TTTCCTCTTAAAATAAAGGAAGG - Intergenic
1111793353 13:92886377-92886399 TTTTTTCTAAGAATAGAAAAGGG + Intergenic
1111816174 13:93156239-93156261 TTATATTTTAAAAGAGAGGAAGG + Intergenic
1111822527 13:93230311-93230333 TTCTATCCTAGAATAGAAAAGGG - Intronic
1111989962 13:95106700-95106722 TTTTATATTAAGATAAAGGAGGG + Intronic
1112616770 13:101014555-101014577 GTTTATCTAAACATAGAAAAGGG - Intergenic
1112747829 13:102547415-102547437 TTTTTTCTTAAGATGGAAGAAGG - Intergenic
1112866040 13:103899394-103899416 TTTGATATTCAAATACAAGAAGG + Intergenic
1112884210 13:104148309-104148331 ATTTATAGTAAAATACAAGAAGG - Intergenic
1113172755 13:107523890-107523912 TTTCATTTTAAAATATAATAAGG + Intronic
1114161030 14:20167762-20167784 TGTTGTCTTAAAATCTAAGAGGG + Intergenic
1114466279 14:22925158-22925180 TTTTTTTTTAAAAAAAAAGATGG + Intronic
1115170449 14:30499019-30499041 TATTATCTGTAGATAGAAGATGG - Intergenic
1115750905 14:36488819-36488841 TTTCATCTTGAAATAGAAACTGG - Intronic
1115805133 14:37042462-37042484 TTCTATTTTAAAAAAGAAAATGG - Intronic
1116045403 14:39736744-39736766 TGCTATCTTAAAATAAAAGTTGG - Intergenic
1116178540 14:41506189-41506211 TATTATATTAAGATAGAACATGG + Intergenic
1116964931 14:51004261-51004283 TCTTCTCTTAAAATACAAGGGGG + Intronic
1117471341 14:56049176-56049198 ATATATCTTAAAATAGTAGAAGG + Intergenic
1117736074 14:58770191-58770213 TTTAATTTTAAAAAAGAAAATGG + Intergenic
1118134969 14:63013909-63013931 TTTAATTTTAAAAGAGAATAAGG + Intronic
1118189757 14:63569872-63569894 TTTTATATAAAAAATGAAGATGG + Intergenic
1118355778 14:65012443-65012465 TTTTACGTTTAAATAGAAAAAGG - Intronic
1118554475 14:67000336-67000358 TTTTCTTTTGAAATAGAAAATGG - Intronic
1119065121 14:71517964-71517986 TTTTATTTTAACATAGAATGAGG + Intronic
1119085828 14:71738068-71738090 TTTTACTTTAAAAAAGAAAATGG - Intronic
1119329275 14:73782057-73782079 TTTTATTTAAAAATAGAATCTGG - Intronic
1119447005 14:74673456-74673478 TTCTAACATAAAATATAAGAAGG + Intronic
1120006489 14:79363585-79363607 TTTTTTCTTAAGAAAGTAGAAGG - Intronic
1120279943 14:82426587-82426609 TTTTATAAGAAAATAGATGATGG - Intergenic
1120571352 14:86120374-86120396 TTTTCTTTTAAAATTAAAGATGG - Intergenic
1121231340 14:92361010-92361032 TTTAATCTTTAAAAAGGAGAGGG + Intronic
1121457958 14:94050873-94050895 TTTTTTTTTTAGATAGAAGATGG - Exonic
1121746776 14:96302156-96302178 TCTTATTTTTAAAGAGAAGAAGG - Intronic
1121805901 14:96822342-96822364 TTTTATTTTAAATTTTAAGAGGG + Intronic
1121938037 14:98038553-98038575 TTCTATCTGGAAATGGAAGATGG - Intergenic
1122189001 14:100025114-100025136 TCTTATCTTAAAAAGGAAAATGG - Intronic
1123504241 15:20923009-20923031 TTTTATAGTAAAATAAAATAAGG + Intergenic
1123561486 15:21496706-21496728 TTTTATAGTAAAATAAAATAAGG + Intergenic
1123597730 15:21933986-21934008 TTTTATAGTAAAATAAAATAAGG + Intergenic
1124631080 15:31337703-31337725 TTGTATCTAAATATAGAAAAAGG + Intronic
1124648281 15:31455999-31456021 TTTTTTTTTAAAGAAGAAGATGG + Intergenic
1124817399 15:33009012-33009034 TTTAATTTAAAAATGGAAGAAGG + Intronic
1124939902 15:34208662-34208684 ATTTATCTTAAAATAGTCAATGG + Intronic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125208647 15:37184330-37184352 TTTTATATTAAAATATTTGATGG - Intergenic
1126275949 15:46881253-46881275 TTTTAAATTAAAATACAAAAAGG + Intergenic
1126377212 15:48008233-48008255 ATTTAACTCATAATAGAAGAGGG - Intergenic
1126546073 15:49875972-49875994 TTTTTTCTTCAAATACAAGAAGG + Intronic
1126964954 15:54041152-54041174 CTATATTTTAAAATATAAGATGG + Intronic
1127161654 15:56193351-56193373 TTTTATTCAAAAATAGAAAATGG - Intronic
1127542947 15:59960879-59960901 TTTTATATTCAAATAAAAAATGG - Intergenic
1128508618 15:68299424-68299446 TTTTTTTTTAAATTATAAGAAGG + Intronic
1129774068 15:78222895-78222917 ATTTTTATTTAAATAGAAGATGG + Intronic
1130144145 15:81260224-81260246 TATTAGCTGAAAATAGAAGATGG + Intronic
1130240160 15:82180668-82180690 TTTTATGTTAAAAGGGGAGAGGG - Intronic
1130451708 15:84060879-84060901 TTTTATTTAAAAATAAAATATGG - Intergenic
1130877978 15:88030755-88030777 TTTTTTTTTAAAAAGGAAGAAGG - Intronic
1131088621 15:89600415-89600437 TTATATCTTTAAAAAGAACATGG - Intronic
1131623337 15:94090559-94090581 ATCTTTCTTAAAATAGAAGGTGG - Intergenic
1131637963 15:94257884-94257906 TTCCATCTTAAAAAAGAAAATGG - Intronic
1131691784 15:94835216-94835238 TCTTATTTTAAAATTGAGGACGG + Intergenic
1131803357 15:96095762-96095784 GTTTATAGGAAAATAGAAGAAGG + Intergenic
1131901212 15:97089770-97089792 TTTTTTCTTAAAAAAGAAATAGG + Intergenic
1202969831 15_KI270727v1_random:223830-223852 TTTTATAGTAAAATAAAATAAGG + Intergenic
1133260076 16:4543495-4543517 ATTTATATTAAAATAGAAACAGG + Intergenic
1133647397 16:7777016-7777038 TTTTAACTTAAAAAAAAAGTAGG - Intergenic
1133962936 16:10510355-10510377 CTCTGTCTTAAAAAAGAAGAGGG + Intergenic
1134484363 16:14645692-14645714 TTTAATCTTAAATTAAAGGAGGG + Intronic
1134657898 16:15961016-15961038 TTTTTTTTTAAAATAGATGGGGG + Intronic
1135798497 16:25469972-25469994 ATTTATCTTAGAATACATGAAGG + Intergenic
1135965397 16:27030991-27031013 TTTTAAAATAAAATACAAGAGGG + Intergenic
1136319361 16:29472611-29472633 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1136433932 16:30211955-30211977 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1137313219 16:47287250-47287272 TTTTTTCTTAAATTAGAGGTGGG + Intronic
1137839678 16:51628725-51628747 TTCTATATTAAAATGGAAGCTGG + Intergenic
1137879582 16:52032202-52032224 TTTATTCGTAAAATAGAAGCTGG + Intronic
1137930292 16:52580775-52580797 TTTTCTCTTAAAAAAAAAAAAGG + Intergenic
1138041407 16:53673592-53673614 TTTTTTTTTAAAATAAAAAAAGG + Intronic
1138482664 16:57314142-57314164 TTTTATAATAAAAAAGAAGCTGG + Intergenic
1138755675 16:59481589-59481611 ATTTATCTTAAAACAGGAAATGG - Intergenic
1138912475 16:61418215-61418237 TTTTTTCTTCAAATAAAACATGG - Intergenic
1139353915 16:66355708-66355730 GTTTAACCTAAAATAGAACAGGG - Intergenic
1139768448 16:69252851-69252873 TTTTCTTTTAAAATAGCAGTAGG + Intronic
1139929753 16:70516728-70516750 TTTTTTTTTTAAATAGAAGCTGG + Intronic
1140310700 16:73845531-73845553 TTTTTTCTAAAAAATGAAGATGG - Intergenic
1140346535 16:74218967-74218989 TTTTATCTTAAATCAGACCAAGG + Intergenic
1140853714 16:78958777-78958799 TTTAATCTGAAAATAGGACATGG + Intronic
1141059183 16:80849392-80849414 TTATATCTTAAAATGGAATATGG + Intergenic
1141385247 16:83616548-83616570 TATTATCTTTGAATAGAAGGAGG - Intronic
1142945000 17:3418762-3418784 TTGTATCTGAAATCAGAAGATGG - Intergenic
1145925182 17:28641634-28641656 TTTTTTTTTAAAAAAAAAGATGG - Intronic
1146148798 17:30448195-30448217 TTTTATTTTAAAATAAAACCAGG + Intronic
1146316404 17:31810547-31810569 TTTTCTCTTCAAAAAGAAAAAGG - Intergenic
1147678794 17:42225903-42225925 TTTTATCTTTAAAAAGCAGGGGG + Intronic
1148528596 17:48366791-48366813 ATTTATATTAAATTAGAAGTTGG - Intronic
1148702635 17:49598938-49598960 TTTTATATTTAGTTAGAAGAAGG + Exonic
1149026566 17:52034486-52034508 TTATTTCTTAAAAGAGAAGAGGG + Intronic
1149218088 17:54382148-54382170 TTTTATATAAAACTATAAGATGG + Intergenic
1149506927 17:57202169-57202191 TTTTTTTTTTTAATAGAAGAAGG + Intergenic
1149598412 17:57877456-57877478 TTTTTTCTTTAAATAGAAACAGG - Intronic
1149920213 17:60650950-60650972 TTTTATTTTTAAAGAGATGAGGG - Intronic
1151050829 17:70977695-70977717 TTTTCTCTTTTAATGGAAGAAGG - Intergenic
1151127278 17:71858764-71858786 TTTGATCTAAAAATATTAGAGGG - Intergenic
1153490454 18:5641864-5641886 TTTGATAGAAAAATAGAAGAAGG + Intergenic
1153827949 18:8894392-8894414 ATTTATCTTAAAATAATAGTTGG - Intergenic
1153897402 18:9578581-9578603 TATTATCTTAAACTTGAAAAAGG - Intronic
1154400046 18:14027988-14028010 TTTTATTCTAAAATAGATCAAGG + Intergenic
1155031089 18:21984475-21984497 TTTTTCCAGAAAATAGAAGAGGG + Intergenic
1155298362 18:24406295-24406317 TTTTCTGTTAAAATGGAAGAGGG + Intergenic
1155352691 18:24922400-24922422 TTTTATTTAAAAAAAGAACAGGG - Intergenic
1155455783 18:26011430-26011452 TTTTATCCTCAAAGAAAAGATGG + Intergenic
1155671533 18:28377733-28377755 TTTTCCCATAAAATAGAAAATGG - Intergenic
1156049723 18:32917869-32917891 TTCTTTCTTAAAAAAGAAAAAGG + Intergenic
1156283174 18:35661881-35661903 TTTTATACTAAAATAGAGCATGG + Intronic
1156819304 18:41353124-41353146 TTTTATCTCAAAAAAAAAAAAGG + Intergenic
1157043628 18:44068721-44068743 TTTTTTAATAAAACAGAAGAAGG - Intergenic
1157078686 18:44497511-44497533 TTGTAACTTAAAATAGATGGAGG - Intergenic
1157090456 18:44630751-44630773 TTTTATTACAAAATAGAAGATGG + Intergenic
1157136585 18:45062907-45062929 TTTTATTTTAATAAAGAAAAAGG + Intronic
1157532957 18:48437821-48437843 TTGTATAATAAAATAGCAGAGGG + Intergenic
1157596275 18:48865811-48865833 TTTTTTTTTTAAATGGAAGAAGG - Intergenic
1157624945 18:49043429-49043451 TCTTTTCTTAAAAAAGAATATGG - Exonic
1157824945 18:50804318-50804340 TTTCATCTTAACAGAGAAGTGGG - Intronic
1157955145 18:52088581-52088603 CTTTATCATAAAATAGAAGAGGG + Intergenic
1158004372 18:52655129-52655151 TTTTTTTTTAAGAGAGAAGAGGG + Intronic
1158240998 18:55378041-55378063 TTTTATATTAAAAGAAAACAAGG - Intronic
1158253355 18:55515851-55515873 TCCTATCTTAAAATTAAAGATGG - Intronic
1158375514 18:56858920-56858942 TTTTATAATATATTAGAAGATGG + Intronic
1158649222 18:59272109-59272131 TCTAAACTCAAAATAGAAGATGG - Intronic
1159191990 18:65058216-65058238 GTTTATCTTAACATAGATAAAGG + Intergenic
1159269158 18:66126743-66126765 TTGTTTCTCAAAATATAAGAAGG + Intergenic
1159973271 18:74679089-74679111 TTTTAGCTGACAATAAAAGAGGG - Intronic
1160196151 18:76757234-76757256 ATCTATCTTAAAATGGAAAATGG - Intergenic
1161292493 19:3502517-3502539 TGTTGTCTTAAAATAGAAGTTGG - Intergenic
1161525185 19:4750422-4750444 ATTTCTCTTACACTAGAAGAAGG - Intergenic
1162409281 19:10495306-10495328 TTTCATTTTAAAAAACAAGATGG - Intronic
1163887791 19:19983323-19983345 CTTGATCCTAAAATAGAAGTTGG + Intergenic
1164899192 19:31903814-31903836 TTTTATATTTACGTAGAAGATGG - Intergenic
1165604719 19:37091987-37092009 TTTTATTGTAAAATAGTTGAGGG + Intronic
1166424698 19:42666962-42666984 TCTCATATTAAAAAAGAAGAAGG - Intronic
1167020439 19:46870837-46870859 TTTTTTCTTAAAAAAAAATAAGG + Intergenic
924984948 2:262845-262867 TTTTAACTTACAAAAGATGAGGG + Intronic
925249060 2:2414255-2414277 TTTTTTTTTAAAAAAAAAGAAGG + Intergenic
926546453 2:14246910-14246932 TGTTATCTTAAAATTCAATACGG - Intergenic
926668406 2:15550298-15550320 TTTTATCTTAAAACAGTATTAGG - Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
928031100 2:27780135-27780157 TTTCCTTTTAAAATAAAAGAAGG + Intronic
928222002 2:29411471-29411493 TTTTTTCTTAAAAAAGAAAAAGG - Intronic
928506034 2:31953993-31954015 TTTTGTCTTAGAATTTAAGATGG - Intronic
929099503 2:38297007-38297029 TGATATCTTCTAATAGAAGATGG - Intronic
929301279 2:40306333-40306355 ATTTATCTTAATATAGAGGCAGG + Intronic
930024020 2:47019360-47019382 TTTTTTTTAAAAATAGAAAATGG - Intronic
930388935 2:50736016-50736038 TTTTATTTTAAAATTGCAAAGGG - Intronic
930550510 2:52829078-52829100 TTACTTCCTAAAATAGAAGAAGG + Intergenic
930792310 2:55347029-55347051 GTTAATTTTAAAATAAAAGATGG + Intronic
930892085 2:56401700-56401722 TGATATGTTAAAATATAAGAAGG - Intergenic
930949672 2:57125005-57125027 TTTCATTTTAAAATATAAGTGGG + Intergenic
931847155 2:66216006-66216028 TTTTATATTTAAATACAAAATGG + Intergenic
932919893 2:75900135-75900157 TTTAATATTAGAATTGAAGATGG + Intergenic
933071049 2:77858130-77858152 TTGTATTTTAAAATATGAGAAGG + Intergenic
933287438 2:80399726-80399748 TCTTTGCTAAAAATAGAAGAAGG - Intronic
933434692 2:82233650-82233672 TTTTATCTAAAAAAACTAGAAGG + Intergenic
933873708 2:86596834-86596856 TTTTATCTAAAAAAAAAAAAAGG - Intronic
935168996 2:100595490-100595512 TTTTATCCCACAATAGATGAAGG + Intergenic
935352486 2:102164757-102164779 ATTTATCTTTAAAAGGAAGAAGG - Exonic
935381728 2:102458685-102458707 TTTTTTCAGAAAACAGAAGAAGG + Intergenic
935551274 2:104458871-104458893 TTTTTTCAGAAGATAGAAGAGGG - Intergenic
935570551 2:104656110-104656132 TTTAATGTTATTATAGAAGATGG - Intergenic
936715990 2:115188236-115188258 TTTTATCCTAAAAAATACGAAGG - Intronic
936806772 2:116342778-116342800 AGTTATCTTTAAATAGAAAAGGG + Intergenic
937187411 2:120057334-120057356 TTAGATTTTAAAATAGACGATGG - Intronic
937393402 2:121513435-121513457 TTTTTTTTTTAAAGAGAAGAAGG + Intronic
937587731 2:123574286-123574308 TTATATCTTTCAATAGAATAAGG + Intergenic
937590692 2:123610008-123610030 TTTTATTTTTAAAAGGAAGAAGG - Intergenic
937760854 2:125601993-125602015 TTTCAGGTTAAAATAGAACATGG - Intergenic
938044773 2:128108640-128108662 TTTTATTATAAAATAAAACATGG + Intronic
938679682 2:133676887-133676909 GATAATTTTAAAATAGAAGATGG - Intergenic
938713775 2:134000043-134000065 TTTTATGTAAAAATACAAAAAGG + Intergenic
939189199 2:138896613-138896635 GTTTCTCTTTAAATAGAGGAAGG + Intergenic
939357303 2:141119996-141120018 TTTTATTTTTAAATAAAAGCTGG + Intronic
939456369 2:142442210-142442232 TTTTCTCTTAAAGGAGAAAAGGG + Intergenic
939581411 2:143952578-143952600 TGTTATCTTAAAAGAACAGATGG + Intronic
939746434 2:145976060-145976082 TAACATCTTAAAATACAAGATGG - Intergenic
939858074 2:147384654-147384676 TTATATCTTAATGGAGAAGATGG - Intergenic
940094229 2:149956014-149956036 TTTTATCTTACAAAATAAAATGG + Intergenic
940498263 2:154461590-154461612 TGTAATCTTCAAATAGAATAAGG + Intergenic
940990296 2:160089148-160089170 TTTGATTTTAAAATGGAGGATGG + Intergenic
941443876 2:165575663-165575685 TTTTATTGTAAAATAGAGGGGGG + Intronic
941480030 2:165996171-165996193 TTCAATGTTAAAATAGAAAATGG + Intronic
941772485 2:169360437-169360459 TATTATCATAGAATGGAAGATGG + Intronic
941775864 2:169393124-169393146 TTTTATCTAGAAATGGAAGGAGG - Intergenic
942436455 2:175982693-175982715 TTTTATTTAAAAATATAAAAGGG - Intronic
942725811 2:179006249-179006271 TTTTATCTTAACATACACGGGGG + Intronic
942993673 2:182234918-182234940 TTTTATATTAAAATTATAGAGGG + Intronic
943277971 2:185892523-185892545 TATTATCTGAACCTAGAAGAGGG + Intergenic
943721881 2:191213112-191213134 TATTATCTGAATATTGAAGAAGG - Intergenic
943899569 2:193415208-193415230 TTTTATCATAAAAAAGAACCAGG + Intergenic
944323149 2:198372326-198372348 TTTTATCTAAGAAAAGAATATGG - Intronic
944569920 2:201033963-201033985 TTTTTTTTTAAACTAGAGGATGG - Intronic
945376746 2:209085923-209085945 TTTTATTATTAAATAGTAGATGG + Intergenic
945647227 2:212512788-212512810 TTTTTTCTTAAAATAATTGATGG - Intronic
945659162 2:212663969-212663991 TTTTATTTTAAATTGGAAAAGGG - Intergenic
945747351 2:213734447-213734469 TTTTATCTTATTTTGGAAGAAGG - Intronic
945813143 2:214572320-214572342 TTTAATCTAGAAAGAGAAGATGG - Intronic
946951488 2:224880276-224880298 ATTTCTCTTGAAATAGAAGAAGG - Intronic
946998878 2:225429639-225429661 ATTTATCTTAAAATAGTCAATGG - Intronic
947041415 2:225925159-225925181 TTGTATCTAAAAGTAGAAGAAGG - Intergenic
947050841 2:226041002-226041024 ATAAATATTAAAATAGAAGATGG + Intergenic
947074758 2:226330435-226330457 TTCTTTCTTAAAATAGAGAAGGG + Intergenic
948070487 2:235117931-235117953 TTTTGTATTCTAATAGAAGATGG - Intergenic
948207410 2:236169451-236169473 TTTTGTTTGAAAATGGAAGAGGG - Intergenic
949083340 2:242123108-242123130 TTTTATATCTAAATAGAAGCTGG + Intergenic
1168780556 20:485732-485754 TCTTTTCTTAAAAAAGAGGAGGG + Intronic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1170012753 20:11744951-11744973 TTTTACATTAAAATAGATGTTGG + Intergenic
1171246277 20:23612275-23612297 TTTTATTTTAAAATAAAATCAGG + Intergenic
1173007893 20:39155175-39155197 TTCTATCTTAAAAACGAGGATGG - Intergenic
1173368962 20:42417466-42417488 TTCTAACTTAAAAGAGGAGAAGG - Intronic
1173528132 20:43748376-43748398 CTGTTTCTTAAAATAAAAGAGGG - Intergenic
1174741177 20:53015642-53015664 TTCTATGTTAAAATATAGGAGGG + Intronic
1175649009 20:60700663-60700685 CTTCACCTTAGAATAGAAGAGGG - Intergenic
1175846552 20:62062674-62062696 ACTGATCTTAAAACAGAAGATGG + Intronic
1176330181 21:5541441-5541463 TTTTTTTTTGAAATAGAAAAAGG + Intergenic
1176397576 21:6279510-6279532 TTTTTTTTTGAAATAGAAAAAGG - Intergenic
1176417924 21:6489496-6489518 TTTTATCTTCAAAGATAAAAAGG - Intergenic
1176439581 21:6709594-6709616 TTTTTTTTTGAAATAGAAAAAGG + Intergenic
1176463843 21:7036663-7036685 TTTTTTTTTGAAATAGAAAAAGG + Intergenic
1176487404 21:7418442-7418464 TTTTTTTTTGAAATAGAAAAAGG + Intergenic
1176974965 21:15310033-15310055 TTTTATTTTAGAATAGACAAAGG - Intergenic
1176988668 21:15467436-15467458 TCTTATCTTAAAGTCAAAGAAGG - Intergenic
1177021921 21:15872252-15872274 TTTTATCTTAGATAAGAATATGG + Intronic
1177380678 21:20338926-20338948 TTTTTTATTAAAAGAAAAGAAGG - Intergenic
1177444497 21:21175050-21175072 TTTTTTCTTTAAAAAGAAAAAGG + Intronic
1177713111 21:24805582-24805604 TTTTATAAGAAAATACAAGAAGG - Intergenic
1177887986 21:26769142-26769164 TTTTATTTTTAAATAGAAATGGG - Intergenic
1177911000 21:27031750-27031772 CTTTATGTTGAAATATAAGATGG - Intergenic
1177938436 21:27379307-27379329 TTTTATATTAAAACCTAAGAAGG - Intergenic
1178159285 21:29893055-29893077 TTTTATATTATAATAAAAGTAGG - Intronic
1178576803 21:33800083-33800105 TTTTCTATTAAAATGAAAGATGG + Intronic
1178613737 21:34111458-34111480 ATTTCTCTTCAAATAGAAGTGGG - Intronic
1179111432 21:38449195-38449217 TTTTATAGTAACATAGAAGCAGG - Intronic
1179329652 21:40386873-40386895 TTTTATCTTAAAATCCTAGAGGG - Intronic
1179693419 21:43097826-43097848 TTTTATCTTCAAAGATAAAAAGG - Intronic
1182909132 22:33965980-33966002 TTTTATCAGCAAGTAGAAGAGGG - Intergenic
1183275859 22:36897298-36897320 TTGTATTTTAAAATGCAAGACGG + Intergenic
1183915893 22:41118779-41118801 TTTTCCCCTTAAATAGAAGATGG - Intronic
1184050426 22:41999758-41999780 TCCTGTCTTAAAATAAAAGATGG + Intronic
1184755063 22:46511195-46511217 TTTTGTTTTTACATAGAAGATGG + Intronic
949275848 3:2280129-2280151 TTTTATCTTTAAATAGAGACAGG + Intronic
949336847 3:2984292-2984314 TCTTATCTCATTATAGAAGAAGG + Intronic
949442440 3:4096902-4096924 TTTTATCTTTAAAGAGAAACTGG + Intronic
949707288 3:6833866-6833888 TTTCATCTGAAAATTGGAGAAGG - Intronic
949914312 3:8945771-8945793 CTTTTTCTTAAAAATGAAGATGG - Intronic
950529019 3:13541824-13541846 TTCTATCTTGGAATAGAGGAAGG + Intergenic
950907004 3:16547843-16547865 TTTTCTATTAACAAAGAAGAAGG - Intergenic
951096784 3:18641608-18641630 TTTTGACTTAAAGTGGAAGATGG + Intergenic
951437806 3:22685272-22685294 GTTTATCTGAAAATTGCAGATGG + Intergenic
951903429 3:27679879-27679901 TTTTGTATTAAAACAGATGAGGG + Intergenic
952727926 3:36608015-36608037 TTAGAGCTTAAAATAGCAGAAGG - Intergenic
953396707 3:42578699-42578721 AATTATCTTAAAATAAAAGCTGG + Intronic
953590617 3:44249383-44249405 TTTTAGATTAACAAAGAAGAAGG + Intronic
954988649 3:54818800-54818822 TTTTCTGTTAAAATAGAGAAAGG + Intronic
955085574 3:55699316-55699338 TTTTATCTTAAAATATCTAAAGG + Intronic
955178333 3:56640310-56640332 TTTTATGTTAATTTAGAACAGGG + Intronic
956163542 3:66379488-66379510 TTTTATCATAAAATAAGAGGAGG + Exonic
956308987 3:67858427-67858449 TTTTATCTCTGAATAGATGAAGG - Intergenic
956454949 3:69411269-69411291 TTGTTTCTCAAAATTGAAGAAGG + Intronic
956649216 3:71488265-71488287 TTTAATCTTAAAATAGGAGTTGG + Intronic
957145373 3:76416325-76416347 TTTCCACTTAAAATGGAAGATGG - Intronic
957176220 3:76813638-76813660 TTTTATTTTAACATAGAGTAAGG - Intronic
957320457 3:78623529-78623551 ATTTTTCTTAAAATAAAAGCAGG - Intronic
957376129 3:79360441-79360463 TTTTTTATTAAAAAAGAAGGTGG - Intronic
957585784 3:82129927-82129949 ATTTAAGTTAAAATAGAAGCTGG - Intergenic
957828790 3:85487857-85487879 TTGTATCTTAGAAAAGAATAAGG - Intronic
958034338 3:88152113-88152135 TTGTATTTTAAAATACAAGTGGG + Intronic
958612708 3:96448138-96448160 TTTTTTCTTAAAAAAAAAAAAGG + Intergenic
958628802 3:96661583-96661605 TTTTATCTTTGCATACAAGAAGG - Intergenic
959212537 3:103405685-103405707 TTTTATATTCAGATAAAAGATGG + Intergenic
959283284 3:104374705-104374727 TTTAATATTAAAATATAATATGG - Intergenic
959344513 3:105176459-105176481 TGTTTTCTTAAAATAGAACATGG + Intergenic
959561607 3:107788920-107788942 TTTTAACTTAGAAAAGAAAAAGG - Intronic
959632497 3:108523310-108523332 GATTATCTTAAAATAAAATAAGG + Intronic
960009217 3:112815027-112815049 TTTTATCTTTATATAGCAGTGGG + Intronic
960015181 3:112879270-112879292 TCTGAACCTAAAATAGAAGATGG - Intergenic
960062293 3:113336095-113336117 GTTTATATTACAAAAGAAGAAGG + Intronic
960102034 3:113753909-113753931 TTTTTTCTTAAGATACATGATGG - Intronic
960346999 3:116545405-116545427 TTTTCTTTTAAAAAAGAAGAAGG + Intronic
960568537 3:119161977-119161999 TTTATTCTTTAAATGGAAGAAGG - Intronic
960661304 3:120062392-120062414 TTTTATCTTTAAATATTAGTGGG - Intronic
960912011 3:122658690-122658712 TTTGGTTTTAAAATATAAGAAGG + Intergenic
961970424 3:130958646-130958668 TTTTATCTTTGAAAAGAATAGGG - Intronic
962393890 3:134997888-134997910 ATTTTGCTTAAAATAGAATAGGG - Intronic
963394048 3:144709179-144709201 TTTTATTTAAAATCAGAAGATGG + Intergenic
963602939 3:147393005-147393027 TTTTTTTTTGAAAGAGAAGAAGG - Intronic
964093927 3:152909623-152909645 TGTTATCTAGAAATAGCAGAGGG + Intergenic
964769167 3:160206422-160206444 TTTTATATTTTAATAGAAGAAGG - Intergenic
964803373 3:160579378-160579400 TATTAGCTTAAAAGAAAAGATGG - Intergenic
964830027 3:160873967-160873989 TTTTATATCAAAATTGTAGAGGG + Intronic
965308230 3:167095473-167095495 TTGTATCCTGAAATAGAAAAAGG + Intergenic
966024281 3:175257181-175257203 TTTTTTTTTTAAATAGAAAAAGG - Intronic
966043076 3:175515979-175516001 TTTTATTTTAAAATAAATAAAGG + Intronic
966231207 3:177654239-177654261 TTTTATTTTAAAAAATAAAATGG - Intergenic
966447718 3:180021953-180021975 TTAACTCTTAAAATAGAAGATGG + Intronic
966467889 3:180252188-180252210 TTATGTATGAAAATAGAAGATGG - Intergenic
967250814 3:187536329-187536351 TTTTATTTTAAAATATTAGACGG - Intergenic
967430765 3:189382850-189382872 TTTTACCTTTACTTAGAAGAGGG + Intergenic
967672840 3:192259709-192259731 TTGTATCTTATAAAAAAAGAGGG - Intronic
967720983 3:192816215-192816237 TTTTTTTTTAAAAAAAAAGATGG + Intronic
969763339 4:9208266-9208288 TTTTATCTTCAAATAACAAAAGG - Intergenic
970653490 4:18203682-18203704 TTTTTTCTTAAAAGGGATGAAGG - Intergenic
970703033 4:18765713-18765735 TGGTGTCTTGAAATAGAAGAAGG + Intergenic
970785921 4:19795971-19795993 TTTTATTTTCAAAAAGAAAATGG - Intergenic
970983636 4:22129959-22129981 TTTTATTAGAAAAAAGAAGAGGG - Intergenic
971704828 4:30027559-30027581 TTTTCTCTTATAATAGATTACGG + Intergenic
972126627 4:35774792-35774814 ATTTATCTGAAAATATAATAGGG + Intergenic
972421402 4:38890558-38890580 TTTTTACTCAAAAGAGAAGAAGG - Intronic
972471715 4:39411813-39411835 TTTTTTCTTTAAATAGAGAAGGG - Intronic
972889540 4:43539616-43539638 TTTTATCTTACTTTAGATGATGG + Intergenic
973051328 4:45601769-45601791 ATTTTTCATACAATAGAAGAAGG + Intergenic
973335833 4:48955468-48955490 CTTTGTCTGAAAATAGAAGAGGG - Intergenic
973547186 4:51993688-51993710 AGTTATGTTAAAAGAGAAGAGGG - Exonic
973750107 4:54007523-54007545 TTATATATTAAAATATAACAGGG + Intronic
974163902 4:58175259-58175281 TTTTATCTTTGAGTAGAATAAGG + Intergenic
974191553 4:58510606-58510628 TTTTTTCTTAAAATATAAAAAGG + Intergenic
974273622 4:59686377-59686399 TTTTATTAGAAAATAGAATAAGG + Intergenic
974348526 4:60714562-60714584 TTTTATGATAGAATAAAAGAAGG - Intergenic
974442466 4:61937927-61937949 TTTTGTTTTAATAGAGAAGAGGG + Intronic
974549587 4:63353847-63353869 TTATATTTTAAGATAGGAGAGGG - Intergenic
974735316 4:65923014-65923036 TTTCTTCTAAAAATTGAAGAAGG - Intergenic
975333577 4:73149217-73149239 TATTCTGTTAACATAGAAGAGGG + Intronic
975574570 4:75849945-75849967 TTTTATTTTAAAAGAAAACACGG + Intergenic
975842135 4:78486351-78486373 TTGTATCCTAAAATAGATTATGG - Intronic
976329718 4:83815351-83815373 TTGTCTTTTAAAATAGGAGAAGG + Intergenic
976632267 4:87251188-87251210 TTTTATTTTGAAGTAGAAGCTGG + Intergenic
976842774 4:89451272-89451294 TTTGATCTTAAATAAGAGGAAGG + Intergenic
976958181 4:90931548-90931570 TTTTTCCGTAACATAGAAGATGG + Intronic
977112285 4:92973290-92973312 CTTGATGTTTAAATAGAAGAGGG + Intronic
977279320 4:95019787-95019809 TTTTATCTGAAAAATGAACATGG - Intronic
977423716 4:96837919-96837941 CTGTATCTTAACATGGAAGAAGG - Intergenic
977670732 4:99692320-99692342 TTTTATTTTATAATTGAACAAGG + Intergenic
978035071 4:103982746-103982768 AAGTATCTTAAAATAGAAAAGGG + Intergenic
978455496 4:108885685-108885707 TTTTATGTTAAAAAAGTATAAGG + Intronic
978764115 4:112386845-112386867 TTTTATTTTTAAATAAGAGAGGG - Intronic
978961494 4:114685086-114685108 TTTCATCTTAAAATATGAAAAGG + Intergenic
979027779 4:115598455-115598477 TTTTATTTTGAAATATGAGAAGG + Intergenic
979260793 4:118641505-118641527 TTTTATATCTAAATAGAAGCTGG + Intergenic
979419387 4:120485224-120485246 TTTTATTTGAAAATGGAACATGG + Intergenic
980475398 4:133307832-133307854 TTTTAAATAAAAAAAGAAGAGGG - Intergenic
980704191 4:136471793-136471815 TAATATCTTAAAATAGCAAAAGG - Intergenic
981158888 4:141473322-141473344 TTTTATCATACTAAAGAAGAAGG + Intergenic
981679369 4:147377713-147377735 TATTTTCTTAAACTAGAAGTAGG - Intergenic
981736167 4:147953304-147953326 TTCTTCCATAAAATAGAAGAGGG - Intronic
982225886 4:153166103-153166125 TTTTTTTTTAAAAAAGAACAAGG - Intronic
982572484 4:157067708-157067730 TTTTATCTTAACAGAATAGAAGG + Intergenic
983037355 4:162884015-162884037 TTTTAGCCTAAATTGGAAGAAGG + Intergenic
983191831 4:164762346-164762368 GTATTTGTTAAAATAGAAGAAGG - Intergenic
983345132 4:166519831-166519853 TTTTCTCATAAAAGAAAAGAAGG - Intergenic
983357038 4:166675811-166675833 TTTTATATTAAAAAAAAAAAAGG - Intergenic
983765630 4:171479044-171479066 TTTTATCATAAAATATAATATGG + Intergenic
983786123 4:171731961-171731983 TTTTATCTTATATTACAAAATGG - Intergenic
983891984 4:173038925-173038947 CTTGATCTTAAAATATAAGCAGG + Intronic
985985665 5:3514118-3514140 TTTTTTCTAAAAAAAAAAGACGG - Intergenic
986483895 5:8216263-8216285 TTTTACCTTACAGTAGAGGAAGG - Intergenic
986656676 5:10019832-10019854 GTTTAAATTACAATAGAAGAGGG + Intergenic
986835759 5:11635265-11635287 TGTTATCTTTAGAAAGAAGAAGG + Intronic
986877476 5:12129096-12129118 TTTTATATGAAAAGTGAAGAAGG - Intergenic
987288083 5:16479765-16479787 TCTTATTTTAAAATATAATACGG - Intronic
987516765 5:18920083-18920105 TTTTACCTCAAAACAGAAAATGG - Intergenic
987544706 5:19298473-19298495 TTTTATTTTAATATACAACAAGG - Intergenic
987701968 5:21412016-21412038 TTTTATCTCATAAAAAAAGATGG - Intergenic
987741783 5:21917958-21917980 ATTTATCTTAATATAGAAGAGGG - Intronic
988007842 5:25441590-25441612 TTATATATTAATATAGAATAAGG + Intergenic
988556772 5:32243594-32243616 TGTTATCTGAAAAAAGAAAAAGG + Exonic
988691872 5:33580586-33580608 TAATATTTTAAAACAGAAGATGG + Intronic
988972231 5:36480867-36480889 TTTTTTTTTAAAAAAGAGGAGGG + Intergenic
989419715 5:41222958-41222980 TTTAAGTTTAAAATGGAAGAGGG - Intronic
989471995 5:41831004-41831026 TTTTACTTTACAATAGAAGGTGG - Intronic
989823910 5:45830692-45830714 TTGCATCTTAAAATGGAATAGGG + Intergenic
990078255 5:51878676-51878698 ATTTATATTAAAATAGAACAGGG - Intergenic
990268338 5:54104642-54104664 TTATATGTTAAAAAAGAATAGGG - Intronic
990826343 5:59903320-59903342 TACTAGTTTAAAATAGAAGATGG + Intronic
991020668 5:61976857-61976879 TTTTATTGTACAAGAGAAGAAGG - Intergenic
991115401 5:62948571-62948593 TTTTGTCTTGGAATAGAAGGCGG + Intergenic
991138456 5:63211113-63211135 TTTTCTCTTAAACAAGAAGTGGG + Intergenic
991289449 5:65018620-65018642 TTTTACCCTAAAATATATGAAGG + Exonic
991516476 5:67441688-67441710 TTGTATCTTACATTAAAAGAAGG - Intergenic
991629712 5:68644365-68644387 TTTCTTTTTAAAATAAAAGAAGG + Intergenic
991724482 5:69522611-69522633 ATTTATCTTAAAAAACAAGGGGG - Intronic
991902260 5:71472722-71472744 TTATTTCAGAAAATAGAAGAGGG - Intronic
992275578 5:75114456-75114478 TTTTATTATAAAAGATAAGATGG - Intronic
993035469 5:82751296-82751318 TTTTCTGTTAAAATGGAAAAAGG - Intergenic
993061723 5:83046814-83046836 TTGTTTCTTAAAATTTAAGATGG + Intergenic
993150635 5:84157175-84157197 TTTTCTCTTTAAAAAGAAGTGGG + Intronic
993564542 5:89457176-89457198 TTGGATTTTAAAATAGAAAAGGG + Intergenic
993825498 5:92680734-92680756 ATTCATTTTAAAATGGAAGATGG - Intergenic
993827856 5:92714651-92714673 TTTTATGTTAAATGAGGAGATGG + Intergenic
994066175 5:95545271-95545293 ATTAATCTTGATATAGAAGAAGG - Intronic
994677368 5:102841750-102841772 ATTTATTTTGAAATAGAAGCTGG + Intronic
995142855 5:108752468-108752490 TGTTACCTTAAATTAGAAGAGGG + Intronic
995250244 5:109984780-109984802 TTTTGTCACAAAAAAGAAGAAGG + Intergenic
995447264 5:112259192-112259214 CCTTAGCTTAAATTAGAAGAGGG - Intronic
995458306 5:112375358-112375380 TTTTTTTTTTAAATAGAGGAAGG - Intronic
995580679 5:113598257-113598279 TTCTAACTTAAAATGAAAGAGGG + Intergenic
995678192 5:114686870-114686892 TAATGTCTTAAAATTGAAGACGG + Intergenic
995820504 5:116224934-116224956 TTTTACATTTAAATAAAAGATGG + Intronic
995925859 5:117372695-117372717 CTTTTTCAGAAAATAGAAGATGG - Intergenic
996105584 5:119498420-119498442 TTTTATTCTAAAGTAGAAGTTGG - Intronic
996180425 5:120411844-120411866 TCTTACCTTAAATTAGAATAGGG - Intergenic
996307258 5:122061742-122061764 TTTTTTTCTAAAATAGAACATGG + Intronic
996481416 5:123979636-123979658 TGTTATTGGAAAATAGAAGAAGG + Intergenic
996514234 5:124352057-124352079 ATTTATCTTAAAGGAGGAGAAGG - Intergenic
996673060 5:126141946-126141968 TATTATTTAAAAAGAGAAGAGGG + Intergenic
997110491 5:131068966-131068988 TTTGTTCTTAAAACAGTAGATGG - Intergenic
998319777 5:141218271-141218293 CTTTATCTTAACATTGTAGAGGG + Exonic
998924730 5:147109762-147109784 TTTTATTTTGAAATAGATGTAGG - Intergenic
999235694 5:150091767-150091789 TTTTATCTCAAAAAAAGAGAAGG + Intronic
999884370 5:155904519-155904541 TTTTATTTTAAAATATATAATGG + Intronic
1000071130 5:157742103-157742125 TTTTATATCAAAATACAAGTAGG + Intergenic
1000250172 5:159486796-159486818 TTTTATAATACAATAGAATAGGG - Intergenic
1000467770 5:161601024-161601046 TTTTATTTTAAAATTTAAAATGG + Intronic
1000717381 5:164662599-164662621 TTTTATCTTGAATGAGATGATGG - Intergenic
1000814850 5:165908461-165908483 TTTTATGTAAAAATAAAATAAGG + Intergenic
1001014937 5:168131920-168131942 TTTTCACTTAAAATAAAAAAAGG - Intronic
1001459992 5:171903407-171903429 TTTTAAGTAAACATAGAAGATGG - Intronic
1001701093 5:173706917-173706939 TTGTATTTTAAAATAGAAATAGG + Intergenic
1002332101 5:178450265-178450287 GTTTTTCTTACCATAGAAGAAGG - Intronic
1002897361 6:1387424-1387446 TATTTTCATAAAATAGAAGCTGG - Intergenic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1003043529 6:2712045-2712067 TTTTGTTTTAAAGCAGAAGACGG + Intronic
1003480023 6:6522698-6522720 TTAATTCTTAAAATAAAAGAAGG + Intergenic
1003485837 6:6578673-6578695 TTTGATTTTATAATAGAAAATGG + Intergenic
1003694495 6:8389853-8389875 TTTTATCATAAAGTAGAAAAAGG - Intergenic
1003917829 6:10804170-10804192 TTTTTTCTTAATATATCAGATGG - Intronic
1004554024 6:16678410-16678432 TTCTATCTTATATTAGAAGATGG + Intronic
1004666568 6:17753376-17753398 TTTTCTCTTAAAAAATAAAAAGG - Intergenic
1004787393 6:18984453-18984475 TTTTATTTTAAAATTGGGGAAGG + Intergenic
1004873418 6:19930765-19930787 TTTTATCTAAAGATATAAAATGG + Intergenic
1005215455 6:23522122-23522144 TTTAATATTAAAATTGAAGAAGG - Intergenic
1006174367 6:32113078-32113100 TTTAATTTAAAAATAGAAGTGGG - Intronic
1006703403 6:35995809-35995831 TTTCATCTAAAAAAGGAAGAGGG - Intronic
1006863597 6:37190484-37190506 TTTTATTTTTAAATAGAAATGGG - Intergenic
1007102973 6:39262921-39262943 TTTTTTCTTTAAATAGAAATGGG - Intergenic
1007669535 6:43539950-43539972 TTATTTTTAAAAATAGAAGACGG + Intronic
1008199241 6:48565511-48565533 TTTTACTTTATAATATAAGAAGG + Intergenic
1008437499 6:51493759-51493781 TTTGATTTTAAAATAGAACATGG + Intergenic
1008463775 6:51806673-51806695 CGTTATCTAAAAATAGATGAGGG + Intronic
1008494357 6:52117572-52117594 TTTTAACTTAAAAAAGAATATGG + Intergenic
1008935242 6:56984894-56984916 TTTTATATCTAAATAGCAGAAGG - Intronic
1009420047 6:63455439-63455461 TTTTAAATGAAAAAAGAAGAGGG - Intergenic
1010223359 6:73467009-73467031 TTTTTTCTTAAAATATTAAAAGG + Intronic
1010665122 6:78619927-78619949 TTTTCTTTTAAGAAAGAAGAAGG - Intergenic
1011371042 6:86636783-86636805 TTCTATCATAAAATTGAATATGG - Intergenic
1012012097 6:93801895-93801917 TTTTATCTTTTCATATAAGATGG + Intergenic
1012128494 6:95460740-95460762 TTTTATCTAAAAATTTAAGTTGG - Intergenic
1012272132 6:97226421-97226443 TTTTATGTTTTAATAGAAGCAGG - Intronic
1012908247 6:105091926-105091948 TTTCATGCTAAAATAGAAAAAGG - Intergenic
1013283060 6:108656852-108656874 TTGTATCTTGCAATAGAAAACGG + Intronic
1013547030 6:111168278-111168300 TTTTATCTTAAAAATGCAAACGG - Intronic
1013827522 6:114231748-114231770 TTTTTTTTTTAAATAGAATAGGG - Intronic
1013831539 6:114278738-114278760 ATTTATATTAAAAAAGACGAAGG + Intronic
1013909793 6:115260824-115260846 TTTTATATTAAAATAGACATAGG + Intergenic
1014699411 6:124664922-124664944 GTGTATCTTTAAATAAAAGAAGG + Intronic
1014754300 6:125286676-125286698 GTTTATTTTAAAATAGAAAATGG - Intronic
1014875340 6:126652167-126652189 TTTCATCTTAAAAAACATGAAGG - Intergenic
1014936806 6:127395016-127395038 TTATATTATAAAATATAAGAGGG - Intergenic
1015083646 6:129260272-129260294 TTTTAAATTGAAATAAAAGATGG - Intronic
1015130672 6:129805157-129805179 TTTTTTTTTAAATCAGAAGAGGG + Intergenic
1015395422 6:132728542-132728564 ATTTATCATAAAACAGAATATGG - Intronic
1015505889 6:133987519-133987541 ATTTTTGTTAAAATAGAAAATGG - Exonic
1015682892 6:135827518-135827540 TTTTAATTTAAAATGGAATATGG + Intergenic
1016004156 6:139072011-139072033 TTTTATTTTAAAAAATAATAAGG - Intergenic
1017261265 6:152390495-152390517 CATTTTTTTAAAATAGAAGAAGG - Intronic
1017367909 6:153666971-153666993 TTTTGTCTTAAAGTGGAAGCTGG - Intergenic
1017681045 6:156864056-156864078 TTTTTTCTTCAAGTAGAAAATGG + Intronic
1017875138 6:158517894-158517916 TTGTATCTAAACATAGAAAAGGG + Intergenic
1018830523 6:167439350-167439372 TTTTACCTGGAAATAAAAGAGGG + Intergenic
1018950074 6:168373328-168373350 TTTTTTCTTTTAATTGAAGAAGG + Intergenic
1019950670 7:4369769-4369791 ATTTGTCTTAAAATTGAAGGAGG - Intergenic
1020392036 7:7668685-7668707 TTTTATCTTTATTTAGAAGTTGG - Intronic
1020408237 7:7861415-7861437 TTATATTTCAAAATAGAAGATGG - Intronic
1020524593 7:9243086-9243108 TTTTGTCTTACAACAGAATAGGG - Intergenic
1020525074 7:9249232-9249254 TTTTCTTTTAAATTAGAAAAAGG - Intergenic
1021010689 7:15461318-15461340 TTTTTTTTGAAAATAGAAAAGGG - Intronic
1021089188 7:16462224-16462246 TTATATTTTAAAACAGAAAAGGG - Exonic
1021149310 7:17129896-17129918 TTTTGCCTTAAAGTAAAAGATGG + Intergenic
1021254071 7:18368252-18368274 TTTCATCTTAGAATAAAATATGG - Intronic
1021587543 7:22225328-22225350 TTTTCTCTTTAATTATAAGATGG - Intronic
1021819825 7:24485703-24485725 TCATATCCTAAAATAGAAGATGG - Intergenic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1022269162 7:28788817-28788839 TTTTTTTTTAAACCAGAAGAGGG - Intronic
1022733802 7:33057184-33057206 TATTGTCTTAAAGTGGAAGAAGG + Intronic
1022759211 7:33328961-33328983 TTTTTTCTTAAAAAAGGATAAGG + Intronic
1023428396 7:40063959-40063981 AATTATTTTAAAATATAAGACGG - Intronic
1023469789 7:40504230-40504252 TTGTTTTTTAAAAAAGAAGAAGG - Intronic
1023994451 7:45150724-45150746 ATGTATCTTAAAAGAGGAGATGG - Intergenic
1024076500 7:45821752-45821774 TTTTATATCTAAATAGAAGCTGG + Intergenic
1024161990 7:46685581-46685603 TTAAATTTTAAAATAGTAGAAGG - Intronic
1024365327 7:48513769-48513791 TTTTCTTATAAAATAGGAGACGG + Intronic
1024862431 7:53861387-53861409 TTTTATCTTAGCAGAGCAGAAGG + Intergenic
1024864556 7:53889913-53889935 TTTTCCCTAAAAATAGAATAAGG + Intergenic
1025059701 7:55795228-55795250 TTTTATATCCAAATAGAAGCTGG - Exonic
1025127911 7:56359678-56359700 TTTTATATCTAAATAGAAGCTGG - Intergenic
1026426641 7:70301453-70301475 TTTTGGCTTAAAATAAAATAGGG + Intronic
1027241726 7:76334714-76334736 TTTTTTTTTAAAGAAGAAGAAGG - Intronic
1027389681 7:77692587-77692609 TGTTAGTTTGAAATAGAAGAAGG + Intergenic
1027670393 7:81089665-81089687 ATTTATCTTTCAACAGAAGATGG - Intergenic
1027688744 7:81313500-81313522 CTTTATCTTAAAATAAATTATGG - Intergenic
1027756940 7:82225792-82225814 TGTTATTTTAAAAGAGAATAGGG - Intronic
1027881888 7:83849925-83849947 TTTTATCTTTAAATTGAAAGGGG + Intergenic
1028751363 7:94386882-94386904 TTTTATTTTAATTTAAAAGAAGG + Intergenic
1028853289 7:95561207-95561229 GTTTATCTTGAAAAAGAAGACGG - Intergenic
1029150080 7:98474059-98474081 TTCTATCTAAAATTAGAAGTTGG + Intergenic
1029826409 7:103200219-103200241 TTTTTTTTTTAAATCGAAGACGG + Intergenic
1030399993 7:109037579-109037601 TATTCTCTGAAAATAGAAAATGG - Intergenic
1030428034 7:109405314-109405336 TCTTCTCTTAAAATTGAAAAAGG - Intergenic
1030517154 7:110552362-110552384 TTATCTGTTAAAATAGAAGAAGG - Intergenic
1030564443 7:111135894-111135916 TCTTATCTCAGAATAAAAGATGG + Intronic
1030837542 7:114308161-114308183 TTTTATCTTAAAGGGCAAGATGG + Intronic
1031210600 7:118821086-118821108 TTGTATTTTAAAATAGTAAAGGG + Intergenic
1031406635 7:121395456-121395478 TTTTTTCTTAAAAAAAAAAAAGG + Intronic
1031663028 7:124450906-124450928 AATTATCTTAAAATAGCATAAGG - Intergenic
1031739194 7:125407448-125407470 TTTTATGTTTAAATAGAATTAGG - Intergenic
1031897999 7:127375085-127375107 ATATATCTTAAAATATTAGAGGG - Intronic
1032249015 7:130237040-130237062 CTTGGTCTTAAAATTGAAGAGGG - Intergenic
1032559021 7:132868942-132868964 TTTCATCTTAATGGAGAAGATGG + Intronic
1032673645 7:134108303-134108325 TTTGATCTTAAAAAAGAACATGG + Intergenic
1033182031 7:139189455-139189477 TTTTATGTCAAAGTAGAAGCTGG - Exonic
1033193824 7:139309507-139309529 TTATATGTTAACATACAAGATGG - Intergenic
1033227358 7:139572621-139572643 TTTTATTTTAAAAAAGAAAAAGG - Exonic
1033373130 7:140730192-140730214 TTGGCTCTTCAAATAGAAGACGG - Intronic
1033440866 7:141377441-141377463 TGATTTCTTAAAATAGAAGCAGG - Intronic
1034144994 7:148861791-148861813 TTTTTTTTTTAAATAAAAGAAGG - Intronic
1034302675 7:150030267-150030289 TTTAAATTTAAAATAGATGAAGG + Intergenic
1034803386 7:154067031-154067053 TTTAAATTTAAAATAGATGAAGG - Intronic
1035347273 7:158210567-158210589 TTTTTTCTTAGACTAGAAAATGG - Intronic
1035415237 7:158678096-158678118 TTTTTTTTTAAAATAAAAAAGGG - Intronic
1035415673 7:158683485-158683507 TTTTCTCATGAAATATAAGATGG - Intronic
1035646976 8:1232080-1232102 TTTTAACTTTAATTTGAAGAAGG + Intergenic
1035901770 8:3464461-3464483 TTTTATTTTCAAATATAAAATGG + Intronic
1035988446 8:4460877-4460899 TTCTTTCCAAAAATAGAAGAGGG + Intronic
1036627098 8:10481166-10481188 ATTTTTCCTAAAATAGAATATGG - Intergenic
1036718985 8:11154780-11154802 TTTTCTCTTAAAAGAGTTGAAGG - Intronic
1036843600 8:12146139-12146161 TTTTATTTTAAAGTTGTAGAGGG + Intergenic
1036864972 8:12388458-12388480 TTTTATTTTAAAGTTGTAGAGGG + Intergenic
1037248065 8:16859813-16859835 TTCTATCTCAAAATAATAGATGG + Intergenic
1037469847 8:19196922-19196944 TTTTACATTAAACTAGAAGGGGG + Intergenic
1037839621 8:22234521-22234543 TTTCATTTTAAAATTTAAGAGGG + Intergenic
1037990910 8:23320609-23320631 CTTTATCTTAAAAAAGAGGCTGG + Intronic
1038036026 8:23687675-23687697 ATTTATCTTACCATTGAAGATGG - Intergenic
1038595946 8:28886628-28886650 TTATCTCTTAAAAAAAAAGAAGG - Intronic
1038993790 8:32899200-32899222 TTTTAACATCAAATTGAAGAGGG - Intergenic
1039303250 8:36233310-36233332 TTTTTTTTTTAAATAGAAGGTGG - Intergenic
1039334848 8:36577535-36577557 TTTTATCTTGGAATATATGAGGG - Intergenic
1039579517 8:38652441-38652463 TTTTTTCTTTTAATACAAGATGG - Intergenic
1040579332 8:48683504-48683526 TTATGTCTTAAAATTGGAGAAGG - Intergenic
1040720057 8:50309342-50309364 TTTTGTCTTAAAAAAGAAAGAGG - Intronic
1040957384 8:52993689-52993711 TTTAATCTTAAAATATGACATGG + Intergenic
1041224311 8:55683601-55683623 TTTTAAATTAAAAAAGAAAATGG + Intergenic
1041322383 8:56626641-56626663 TTTTATCCTCAAATGGTAGAAGG + Intergenic
1041932113 8:63298299-63298321 TTATATTTTATATTAGAAGATGG + Intergenic
1041941394 8:63391929-63391951 TTTTCTTTCAAAATAGAACAGGG + Intergenic
1043034604 8:75179719-75179741 TTTGATCTTCAAATAGTAGATGG - Intergenic
1043247896 8:78029283-78029305 TTTAATCTTTAAATAGAAGTTGG - Intergenic
1043623947 8:82231193-82231215 CTATATCTAAAAAAAGAAGAAGG + Intergenic
1043818709 8:84836714-84836736 TTTTATGATGAATTAGAAGAAGG + Intronic
1044343629 8:91076789-91076811 TAATATCTTAAAACACAAGATGG - Intronic
1044488691 8:92785977-92785999 TTTAATTTTACAATAGATGAAGG + Intergenic
1044725737 8:95192890-95192912 TTATGTCTTAAAAAAGGAGAGGG - Intergenic
1044910949 8:97057979-97058001 TTTTCTTTTGAAAAAGAAGAAGG + Intronic
1045316838 8:101050665-101050687 TTTATTCTTAAAAAAGAAAATGG - Intergenic
1045603808 8:103749410-103749432 GTTTTTCTTAAAATAGAAAGTGG - Intronic
1045622658 8:103999936-103999958 GTTTATATTAAAATATAACATGG + Intronic
1045685497 8:104707173-104707195 TTTTATCTTAAGGAAGAAGAGGG + Intronic
1045816913 8:106287367-106287389 TTTTAACTAAAAATAGAACAAGG + Intronic
1046015596 8:108601113-108601135 TTTTTTATAAAAAAAGAAGAAGG + Intergenic
1046320282 8:112565482-112565504 TTTTATATTCAAATTAAAGATGG - Intronic
1046389298 8:113547260-113547282 TTTTCTTTTAAAATAGATGCTGG + Intergenic
1046852468 8:118990638-118990660 TTTTCTCTTCAAAATGAAGATGG - Intergenic
1047093738 8:121601307-121601329 TGTTATTTTAAAGTAGAAAAAGG - Intergenic
1048164201 8:132048051-132048073 TTTTATCTTCACATGGCAGAAGG - Intronic
1049855555 8:144859547-144859569 CTTTATATTAAAGTAGAAGGTGG - Intergenic
1049986622 9:957700-957722 TTTTCTTCTAAAATAGAAGGAGG - Intronic
1051307474 9:15728387-15728409 TGTTAGCATAAAATAGAAGCAGG + Intronic
1052112984 9:24612443-24612465 TGTTATTTTAAAAGAGAACAAGG - Intergenic
1052159933 9:25245307-25245329 TTTTAGCTCAAAATAAAACAAGG - Intergenic
1052168289 9:25360596-25360618 ATTAATATTAAAATAGAAAAAGG - Intergenic
1053368264 9:37539254-37539276 TTTTATCTTTAGAGAGAAAATGG - Intronic
1054973622 9:71117449-71117471 TTGAATATTAAAATGGAAGAAGG - Intronic
1055114669 9:72593700-72593722 TTTTTTTTTAAAATAGAAATGGG - Intronic
1055990967 9:82105197-82105219 TTTGAACCTAAAATAGAAGTTGG - Intergenic
1056177976 9:84054024-84054046 TTTCACCTTGAAATAGAGGAAGG + Intergenic
1056231528 9:84550476-84550498 TTTTATTTAAACAAAGAAGAGGG + Intergenic
1056510554 9:87300776-87300798 TCTTGTCTTAAAATAACAGAAGG + Intergenic
1057267422 9:93628270-93628292 CTTTTTCAGAAAATAGAAGAGGG - Intronic
1057368225 9:94444413-94444435 TTTTTTCTAAGAATAGCAGAGGG + Intronic
1057568600 9:96186183-96186205 GTGTATCTAAACATAGAAGAGGG - Intergenic
1057959565 9:99441288-99441310 TTTTATCTTAAAATATCACTAGG - Intergenic
1057975549 9:99602274-99602296 CTTCATCTTAAAATATATGAAGG - Intergenic
1058751703 9:108045360-108045382 TCTTATGATAAAGTAGAAGATGG + Intergenic
1059792871 9:117659643-117659665 TTTTATCTCTAAGTTGAAGAGGG + Intergenic
1059973698 9:119693766-119693788 TTTTATTTTAATATAGAACCTGG + Intergenic
1060098784 9:120818936-120818958 TTTTATCTAAGAACAGAGGAAGG + Intronic
1060364667 9:122998776-122998798 TTTTCTATTAATATAGAAGGGGG + Intronic
1060435328 9:123587979-123588001 TTTTATCATAAAAAATAGGATGG + Intronic
1060680320 9:125557011-125557033 TTGAATTTTAAAATAGAAAAAGG + Intronic
1061729466 9:132602345-132602367 TTTGATCTGTAAATAAAAGATGG - Intronic
1062512502 9:136914548-136914570 TTTTCTCTTAAAATAAAGCAAGG - Intronic
1203431914 Un_GL000195v1:98885-98907 TTTTTTTTTGAAATAGAAAAAGG - Intergenic
1186130133 X:6457142-6457164 TTTTATGATAAATTAGAAGAAGG - Intergenic
1186439793 X:9575931-9575953 TTTTACCTTTAAATGGAGGAGGG + Intronic
1186513127 X:10145990-10146012 TGTTATTTTAAAATATAAGCAGG + Intergenic
1187543040 X:20217301-20217323 TTTGATCTTAAAATGTAAAAAGG + Intronic
1187857985 X:23655411-23655433 GTTTATTTTAAAGTAAAAGAGGG - Intergenic
1188131681 X:26442376-26442398 TTTCCTTTTAAAATAGAAGAAGG - Intergenic
1188890366 X:35604651-35604673 TTTTATATTAAGATTGATGAAGG - Intergenic
1189213474 X:39303858-39303880 TTGTATTTTGCAATAGAAGAAGG + Intergenic
1189288389 X:39867973-39867995 ATTTTTCTTGAAATAGGAGATGG - Intergenic
1190000109 X:46677752-46677774 TTCTTTCAGAAAATAGAAGAGGG - Intronic
1190002666 X:46704664-46704686 ATTTATTTTAAAACAGAACACGG + Intronic
1190424918 X:50326235-50326257 TTTTAACTAAAATCAGAAGAAGG - Intronic
1191022062 X:55872021-55872043 TTTTTTCTTAAACTAGCTGAGGG - Intergenic
1191088981 X:56600120-56600142 TTATATTTTTAAATAGAAAATGG + Intergenic
1191238898 X:58163037-58163059 TTTTTTCGTAAAATATATGAAGG + Intergenic
1191937387 X:66440131-66440153 TCTGAACTTAAAATAGAAGTTGG - Intergenic
1192627779 X:72748007-72748029 TTTTATCTGAAATAAGAAGAGGG - Intergenic
1192653929 X:72972802-72972824 TTTTATCTGAAATAAGAAGAGGG + Intergenic
1193921159 X:87428354-87428376 ATTTTTCTTAAAACAGCAGATGG + Intergenic
1193946129 X:87737716-87737738 TTCTATCCTAAAGTAGAAGCAGG - Intergenic
1193965633 X:87982899-87982921 TTTAATCTTGAAGTAAAAGATGG - Intergenic
1194125882 X:90015864-90015886 TTTTATTTTAAAATGTAAGAAGG - Intergenic
1194215043 X:91120056-91120078 TTTTTTCTATTAATAGAAGAGGG - Intergenic
1194227196 X:91275489-91275511 TGTTATCTTCAGTTAGAAGAAGG - Intergenic
1194385651 X:93251082-93251104 ATTTCTCTCAATATAGAAGAAGG - Intergenic
1194816296 X:98446167-98446189 TTTTACCTTGAAATATAAGGGGG - Intergenic
1195599873 X:106734103-106734125 ATGTATCTAGAAATAGAAGATGG + Intronic
1195604988 X:106795521-106795543 TTTTGTCTTAAAAGAGGAGAGGG + Intronic
1195629485 X:107039605-107039627 CTGTCTCTTAAAAAAGAAGAAGG + Intergenic
1195940851 X:110166763-110166785 TTTTTTCTTAAAGGAGAAAAAGG + Intronic
1196061260 X:111410602-111410624 ATTGATCTTAATAGAGAAGAAGG + Intronic
1196577233 X:117333522-117333544 TTTTATCTTAAATTCAATGAGGG - Intergenic
1196831648 X:119780495-119780517 CTTTATTTTAAAATAAAATAAGG - Intergenic
1198008009 X:132518665-132518687 TTTTAGCTTCAAGTAGAAAATGG - Intergenic
1198786436 X:140293496-140293518 TTCTTTCAGAAAATAGAAGAGGG - Intergenic
1198945391 X:142006823-142006845 TTTTTTCTTAAAAGAAAAAATGG - Intergenic
1199047203 X:143188962-143188984 TATTAACATAAAAGAGAAGAGGG - Intergenic
1199063717 X:143389424-143389446 TTGTGTTTTAAAATATAAGAAGG + Intergenic
1199193836 X:145003732-145003754 TTTTATCTTGACACTGAAGATGG + Intergenic
1199480248 X:148290357-148290379 TCTTATCTTGAAATTGAAGCAGG - Intergenic
1201249064 Y:12037591-12037613 TCTGATCCTAAAATAGAAGACGG + Intergenic
1201689424 Y:16746436-16746458 TTTTTTATTAAAACAAAAGATGG - Intergenic
1201908440 Y:19108289-19108311 ATTTTTCTTACAATAGAAGTTGG + Intergenic
1202129129 Y:21594332-21594354 TTTTACCTAAAAATATCAGAGGG - Intergenic
1202273317 Y:23091125-23091147 TTTTCTGTTAACAAAGAAGAAGG - Intergenic
1202292709 Y:23329557-23329579 TTTTCTGTTAACAAAGAAGAAGG + Intergenic
1202339097 Y:23841871-23841893 TTTTTTCTGATATTAGAAGATGG - Intergenic
1202382270 Y:24283911-24283933 TTTTATATCTAAATAGAAGCTGG + Intergenic
1202426314 Y:24724869-24724891 TTTTCTGTTAACAAAGAAGAAGG - Intergenic
1202444475 Y:24945217-24945239 TTTTCTGTTAACAAAGAAGAAGG + Intergenic
1202488514 Y:25386214-25386236 TTTTATATCTAAATAGAAGCTGG - Intergenic
1202531669 Y:25828201-25828223 TTTTTTCTGATATTAGAAGATGG + Intergenic