ID: 1022258044

View in Genome Browser
Species Human (GRCh38)
Location 7:28678844-28678866
Sequence TTATTAAGAGGGTTTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022258044_1022258048 17 Left 1022258044 7:28678844-28678866 CCTTGCAGAAACCCTCTTAATAA No data
Right 1022258048 7:28678884-28678906 TCTCTGCTCAGTGTAAGAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022258044 Original CRISPR TTATTAAGAGGGTTTCTGCA AGG (reversed) Intronic