ID: 1022258044

View in Genome Browser
Species Human (GRCh38)
Location 7:28678844-28678866
Sequence TTATTAAGAGGGTTTCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022258044_1022258048 17 Left 1022258044 7:28678844-28678866 CCTTGCAGAAACCCTCTTAATAA 0: 1
1: 0
2: 2
3: 20
4: 179
Right 1022258048 7:28678884-28678906 TCTCTGCTCAGTGTAAGAGAAGG 0: 1
1: 0
2: 1
3: 25
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022258044 Original CRISPR TTATTAAGAGGGTTTCTGCA AGG (reversed) Intronic
900817056 1:4856316-4856338 ATATTAAGAGATTTACTGCAAGG + Intergenic
901618605 1:10562868-10562890 TTATTATGAGGATTGCTGAATGG + Intronic
903538170 1:24081173-24081195 TTATAGAGTGGGTTTGTGCAAGG + Intronic
904020413 1:27460168-27460190 TTATTAACAGGATTTCTACAAGG - Intronic
904532660 1:31179842-31179864 TTTATAAGATGGTTTTTGCAAGG - Exonic
905625283 1:39486085-39486107 CTATTAATAGGGTTTCTGCGCGG + Exonic
908992268 1:70106614-70106636 TTAGTAAGAAGGTTTATGAAAGG + Intronic
910413602 1:86973065-86973087 TTGTTAAGGTGGTTTCTGCTGGG + Intronic
911283336 1:95958714-95958736 ATATTTAAAGGGTTTTTGCAGGG + Intergenic
911561118 1:99406142-99406164 TGATTAAGATGGTGTCTGCCAGG - Intergenic
912653632 1:111464890-111464912 TTTTTAAGAGACTTTATGCAAGG + Intergenic
913091807 1:115481200-115481222 TTATTAAGTGGGATTCTGTGTGG + Intergenic
915223139 1:154390909-154390931 TTATTATGAGAGTTTCTGTAAGG - Intergenic
917836488 1:178945674-178945696 TGAGCAAAAGGGTTTCTGCAAGG + Intergenic
918534983 1:185564210-185564232 CAATGAAGAGTGTTTCTGCAAGG + Intergenic
919658039 1:200216129-200216151 CAATTAAGAAGGGTTCTGCATGG - Intergenic
919721918 1:200846463-200846485 TTATAAAAAGAGTTTCTGCTGGG - Intronic
1064740373 10:18427271-18427293 TTATTAATAGATTTTCTACATGG + Intronic
1067201083 10:44172662-44172684 TTATTAATAGAATTTCTGTATGG - Intergenic
1069969665 10:72155784-72155806 TTTTTAATTGGGTTTCAGCATGG - Intronic
1070055088 10:72926533-72926555 CCATTAAGAGGTTTTCAGCAGGG - Intronic
1070130075 10:73649707-73649729 TTAGTAACAGGGTCTCTGCAGGG - Intronic
1070560167 10:77560310-77560332 ATATTAAAAGGGTTGCTGCATGG + Intronic
1071344151 10:84675439-84675461 TTATTAACAAGGTTTCTTAAAGG - Intergenic
1078039065 11:7840551-7840573 TCTGTAAGAGGATTTCTGCAAGG - Intergenic
1078980592 11:16528413-16528435 TTATTCAGAGGGTGTGTGAAGGG + Intronic
1080382357 11:31786976-31786998 TTATCAATGGGGTATCTGCAGGG - Exonic
1080804720 11:35641999-35642021 TTATTAATAGTGTTCTTGCAAGG - Intergenic
1082943537 11:58734076-58734098 TTATTAAGAGTCTTTTTGCAAGG - Intergenic
1085782885 11:79425279-79425301 CTATTAAGAAGCTTCCTGCAGGG - Intronic
1085976754 11:81664672-81664694 TTATTATGAGTGTTTTTCCATGG + Intergenic
1086511577 11:87563772-87563794 TTAATACTAGGGGTTCTGCAGGG + Intergenic
1087535786 11:99443335-99443357 TTATTCAGAAGGATGCTGCATGG + Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1091617759 12:2062656-2062678 TTATTCCCAGGGTTTCTGCCAGG + Intronic
1092797375 12:12126036-12126058 ATTTTCAGAGGGTTTTTGCAAGG + Intronic
1093797804 12:23334470-23334492 TTATTAAGAAGGTTTGTATATGG + Intergenic
1093868729 12:24260669-24260691 TTGTGAAGAGGTTTTCTGCAAGG + Intergenic
1095503059 12:42861595-42861617 TTATTTATAGGGTTTCTGCCTGG - Intergenic
1096527288 12:52218183-52218205 TGATTAAGATGGTGTCTGCCAGG + Intergenic
1097051983 12:56229157-56229179 TTACTAACAGGGTTGCTGGAAGG - Exonic
1097399660 12:59113786-59113808 TTATTAAGAATTTTTATGCATGG + Intergenic
1098707544 12:73709538-73709560 TTATTTGGAAGGTTTCTACATGG + Intergenic
1099522342 12:83680395-83680417 TTATTATGAGTTTTACTGCAAGG - Intergenic
1101525666 12:105526860-105526882 TTATTTAGATTTTTTCTGCAAGG + Intergenic
1107332618 13:39318325-39318347 GGATTAGGAGGGTTTCAGCATGG - Intergenic
1109641503 13:65198037-65198059 TTTTTAAGAAGGTTTCAGGAAGG + Intergenic
1110909126 13:80933333-80933355 TTATTAAGATTTCTTCTGCAAGG + Intergenic
1111395115 13:87656606-87656628 TCATCAAGAGGGTTCCTGCCAGG - Intergenic
1112701268 13:102011697-102011719 TTTAGAAGAGGGTTTCTGGAAGG + Intronic
1114230068 14:20773329-20773351 TCATTAAGAATGTTTCTGCCAGG + Intergenic
1114615423 14:24065487-24065509 CTCTTCAGAGGGTCTCTGCAGGG + Intronic
1115953041 14:38743306-38743328 TAATTAAAAGGGTTTCTTCTGGG + Intergenic
1116588349 14:46738953-46738975 TTATTATGAGTGTTTCTGTGAGG + Intergenic
1117357520 14:54939225-54939247 TGATTAAGATGCTTTCTACATGG + Exonic
1120741561 14:88114384-88114406 TTATTAATAGGCTTTCTCCAAGG + Intergenic
1120945357 14:89989954-89989976 TTGTGCAGAGGGTTTCTGTAAGG - Intronic
1122153911 14:99738978-99739000 TTAGTAACAGGGTATCTGCAGGG - Intronic
1122814340 14:104304922-104304944 TATTCAAGAGGGTTACTGCAAGG - Intergenic
1125194225 15:37028369-37028391 GGATTATGAGGGCTTCTGCATGG - Intronic
1127471070 15:59290679-59290701 TTTTTCTGAGGATTTCTGCAAGG - Intronic
1127543676 15:59968683-59968705 TTATTACCAGGGCTCCTGCAAGG - Intergenic
1128390962 15:67182080-67182102 TTATTTAGAGGATTTCAGCCAGG - Intronic
1133436622 16:5785468-5785490 ATATTATCAGGGTCTCTGCATGG + Intergenic
1140955968 16:79865744-79865766 TTCTTCATAGGGTTTATGCAAGG - Intergenic
1141208314 16:81952924-81952946 TGATTAAGATGGTAGCTGCAGGG - Intronic
1141212054 16:81990535-81990557 TAATTAATAGTGTTTCTGCTGGG - Exonic
1143127559 17:4653339-4653361 TTATTCAGAAGTTTTCTACAAGG - Intergenic
1144403708 17:14932059-14932081 TTATTTAGAAGGTTACTTCAAGG - Intergenic
1146478354 17:33181377-33181399 TTATTACTAGGGTTGCTGAAAGG - Intronic
1150553552 17:66233048-66233070 TAATTAAGATGGTGTCTGCCAGG - Intronic
1151077814 17:71294413-71294435 TTATTAACATGGTTGTTGCAAGG - Intergenic
1153825117 18:8868004-8868026 TTGTTAAGATTGTTTCTGCACGG - Intergenic
1156121580 18:33849171-33849193 TTCTTAAGAAAGTTTCTGAAAGG - Intergenic
1156377629 18:36529032-36529054 CTACAAAGAGGGTTTCTGGAGGG + Intronic
1157189184 18:45566429-45566451 TTATTAAGAGAGTTTTTAAATGG - Intronic
1157269692 18:46262952-46262974 TGATTCAGAGTGTTTCTTCATGG + Exonic
1159600597 18:70425264-70425286 ATATTAAGAGGCTTATTGCAGGG + Intergenic
1160251372 18:77206190-77206212 TTACTAAGAGGTTTCCTGAAAGG + Intergenic
1160445300 18:78922823-78922845 TTAGCAAAGGGGTTTCTGCATGG + Intergenic
1166081554 19:40446737-40446759 TTATTTTGAGGATTTATGCAAGG - Intergenic
1168713738 19:58515619-58515641 ATAGTGAGGGGGTTTCTGCAGGG - Intronic
926482389 2:13415385-13415407 TTCTTGACAGGGTTTTTGCAAGG - Intergenic
928899011 2:36297884-36297906 TTTTTAAGAGGCTGTCTGGAAGG - Intergenic
929057861 2:37894021-37894043 TTATTAAGTGGTTAACTGCAAGG - Intergenic
930361185 2:50382018-50382040 TTCTGAAGAGGGATTCTGCAAGG + Intronic
930718253 2:54613569-54613591 TTATTAAAAGGGTTTCCCAAAGG - Intronic
930983956 2:57562103-57562125 GTATTTAGAGCATTTCTGCATGG + Intergenic
937041366 2:118823250-118823272 TTCTTAAGAGGTTTTAAGCATGG - Intergenic
937186914 2:120052414-120052436 TGATTAAGATGGTGTCTGCTAGG + Intronic
937827616 2:126384093-126384115 TAATTGAGAGAGTTCCTGCAAGG - Intergenic
939866153 2:147475014-147475036 TTATTGACAGGGTTTCTGCAGGG - Intergenic
940938903 2:159534136-159534158 TTATAAAGTGTGTTTCTGAAGGG + Intronic
941266230 2:163366451-163366473 TTCTTAAGGAGGTTTCTGCTAGG + Intergenic
943727140 2:191263585-191263607 TTCTTAATCGGGTTTCTACAAGG + Intronic
943740428 2:191401155-191401177 TTTTTTAGAGGTTTTCTGGAGGG + Intronic
945697241 2:213122622-213122644 TTGGTAAGAGTGTTTCAGCAAGG - Intronic
947224698 2:227828648-227828670 TGATTAAGAGGGAGTTTGCAGGG + Intergenic
1170420269 20:16185693-16185715 AGAATAGGAGGGTTTCTGCAGGG + Intergenic
1171062616 20:21981167-21981189 TTAATAAGAGGGGCTCTGCAAGG - Intergenic
1172459900 20:35109713-35109735 TTATTCTGAGTATTTCTGCAAGG - Intergenic
1174314570 20:49688254-49688276 CTATTCAGAGGCTTTCTGCTTGG - Intronic
1174397748 20:50258445-50258467 TCATTCTGAGGGTTTCTGGAAGG + Intergenic
1175205766 20:57309982-57310004 TTATTCAGAGGGTTTCTCCTAGG - Intergenic
1175292031 20:57882385-57882407 TTGTTAAGTGGGTTAGTGCAGGG + Intergenic
1175978676 20:62726221-62726243 GTTTTAACTGGGTTTCTGCAAGG - Intronic
1178149799 21:29781411-29781433 TTATAAAGAGGGATATTGCATGG - Intronic
1179006665 21:37521300-37521322 TGATTCAGAGTGTCTCTGCAGGG - Intergenic
949824916 3:8155265-8155287 TTAATAATAGTGGTTCTGCATGG - Intergenic
950831991 3:15884053-15884075 TTATTAAGTGGAAATCTGCATGG - Intergenic
952483755 3:33788812-33788834 TTGCCAGGAGGGTTTCTGCATGG - Intergenic
953153238 3:40344277-40344299 TTATTAAGAGGGTGTTTGCCTGG - Intergenic
954441994 3:50527029-50527051 TTCTTAAGGGGGTCTCAGCAGGG + Intergenic
955244977 3:57216768-57216790 TGATTAAGATGGTGTCTGCCAGG + Intronic
959969493 3:112393322-112393344 GTTTTAAGAGGGTTTTTTCAGGG + Intergenic
960803665 3:121562749-121562771 CTATTAACAGGGTTTCTTAAGGG - Intergenic
961093756 3:124137638-124137660 TTCTTAAAAGAGTTTCTCCAAGG + Intronic
963369833 3:144384832-144384854 TGATTAATAGGGTTTTTGTAAGG - Intergenic
964400905 3:156297284-156297306 TTACTCAGAGGGTTTGTACAGGG + Intronic
965920045 3:173902400-173902422 TTTTTAAGAGAGTTTATGTAAGG + Intronic
968314294 3:197709854-197709876 TTATTAAGAGTGTTTTCCCATGG - Intronic
970831477 4:20345418-20345440 TGAATAGCAGGGTTTCTGCAGGG - Intronic
971896439 4:32603001-32603023 TTATTAAAAGTGTTACTGCTGGG + Intergenic
972127161 4:35782886-35782908 TTATTTGGGGGGTTTCTGTAAGG - Intergenic
973259657 4:48149743-48149765 TTCTTAAGATGTTTTCTACAAGG + Intronic
977629931 4:99231458-99231480 TGACTTATAGGGTTTCTGCAGGG + Intergenic
977859800 4:101943260-101943282 ATATTAAAGGGGTTTATGCAGGG + Intronic
978707947 4:111739005-111739027 TTATTTTGAGTGCTTCTGCATGG - Intergenic
979483498 4:121245115-121245137 TAATTAAGAGTGTTTCTGATAGG + Intergenic
979490114 4:121316281-121316303 TGATTGAGAGAGTTTCTGAATGG - Intergenic
979513261 4:121577884-121577906 TTATTAATTGGCTTCCTGCAAGG - Intergenic
979722630 4:123919790-123919812 TTTTTAACAGGGTTTATGGAAGG + Intergenic
980350243 4:131675028-131675050 TTACAAATAGGGTTTCTGCCTGG - Intergenic
980385059 4:132078375-132078397 TTGTTTAGAGTTTTTCTGCAAGG + Intergenic
982522885 4:156441406-156441428 TTAGTAAGTGCTTTTCTGCATGG + Intergenic
983157633 4:164370546-164370568 TTATTTAGAGCCTTTCTCCATGG - Intronic
984469381 4:180147293-180147315 TTGTTAAGAGGGTTAATGGAAGG - Intergenic
986090139 5:4496317-4496339 TGGTTAAGGTGGTTTCTGCAAGG + Intergenic
986770415 5:10967754-10967776 TTATTCAGAGAGTTTCTGATTGG - Intergenic
987855053 5:23410810-23410832 TTATGATGAAGGTTTATGCAAGG - Intergenic
988829791 5:34976411-34976433 TTCTTAAAAGGGAATCTGCAGGG + Intergenic
990297635 5:54419654-54419676 TTATTTAGGGGATTTCTGCCAGG - Intergenic
991479278 5:67059695-67059717 TTTTTAAAAGGGTTTCTGTAAGG + Intronic
995113076 5:108448982-108449004 TGATTAACATGGTGTCTGCAGGG + Intergenic
995619354 5:114006855-114006877 ATATTAAGATGCTTTCTCCAAGG - Intergenic
996672306 5:126133048-126133070 TTATCAAGAGACTTTCTGCAGGG - Intergenic
996814372 5:127558653-127558675 TTATAAAGAGGTTTTCTTCAGGG - Intergenic
997341700 5:133150224-133150246 CTCTTGAGAGGGTTGCTGCATGG + Intergenic
997504017 5:134401651-134401673 TTCTTAAGAGGCTATGTGCAAGG + Intergenic
997871820 5:137512742-137512764 TGGTTAAGGTGGTTTCTGCAAGG - Intronic
999914635 5:156244031-156244053 TAATTAGGGGAGTTTCTGCAGGG - Intronic
1000672617 5:164080986-164081008 TCATTTAGAGGGTTTCATCAAGG - Intergenic
1000763736 5:165258649-165258671 TTATTACCAGTTTTTCTGCAAGG - Intergenic
1002056839 5:176602932-176602954 TTATAAAGAGAATTTCTGGATGG + Intronic
1002546301 5:179947627-179947649 TTAATAAGAGGGTTGTTGCAAGG + Intronic
1003120408 6:3314764-3314786 TTTTTCTAAGGGTTTCTGCACGG + Intronic
1003315143 6:5004721-5004743 TTATTAAAAGCGGTTCTGAAGGG - Intergenic
1004522589 6:16376051-16376073 TTATTATTAGATTTTCTGCATGG + Intronic
1006819005 6:36875532-36875554 TTGTTAGGAGGGTTTGCGCAGGG + Intronic
1008180254 6:48319492-48319514 GTAACAAGATGGTTTCTGCAAGG + Intergenic
1008643095 6:53484757-53484779 TTATTAAGGAGGTTTCTTCTGGG + Intergenic
1013527578 6:110988897-110988919 TTATTCTGAGGGCTTCTGCCTGG - Intronic
1013867720 6:114719168-114719190 TTATAAAGAAGGTTACTGAATGG + Intergenic
1021444741 7:20720420-20720442 TAATTAAGATGGTTTCTTCCAGG - Intronic
1022258044 7:28678844-28678866 TTATTAAGAGGGTTTCTGCAAGG - Intronic
1023328727 7:39089844-39089866 TTATTAACAGTGTTTCTCCTGGG + Intronic
1023336742 7:39178511-39178533 CAATTGAGAGAGTTTCTGCATGG - Intronic
1023926488 7:44673605-44673627 CTATGAAGAGGGCTTCTGCCTGG + Intronic
1024132333 7:46366806-46366828 TAGTTAAGAGGGTATCTGCCAGG + Intergenic
1024332446 7:48169675-48169697 TTATTCTGGGAGTTTCTGCAAGG + Intergenic
1025782467 7:64613974-64613996 TTAATAAGACAGTTTCTGCCTGG + Intergenic
1026016603 7:66676413-66676435 TTATAAGCAGGGGTTCTGCAGGG - Intronic
1027824380 7:83092197-83092219 TTATTCAGGAGGGTTCTGCAGGG - Intronic
1028426862 7:90699417-90699439 TACCTAAGAGGGTTGCTGCAGGG - Intronic
1031177684 7:118373327-118373349 TAATTATGAGGATTTCTCCATGG - Intergenic
1031738464 7:125397328-125397350 TTATTTAAAGGTTTTGTGCAAGG + Intergenic
1031858621 7:126952566-126952588 TGATTAAGGTGGTTTCTGCTGGG - Intronic
1032484518 7:132274977-132274999 TGGTTAAGATGGTTTCTGCTAGG + Intronic
1033890547 7:146007665-146007687 TTGTAGAGAGGTTTTCTGCAGGG - Intergenic
1036102466 8:5802111-5802133 TTATTAGGAAGGGGTCTGCAGGG + Intergenic
1037015885 8:13905596-13905618 TAATTAAGTGTGTTGCTGCAAGG - Intergenic
1037080092 8:14774044-14774066 TTATTCCGAGTGTTTTTGCACGG + Intronic
1039378423 8:37061036-37061058 GTATTTGAAGGGTTTCTGCATGG + Intergenic
1043624632 8:82240928-82240950 TTTTTAAAAGGGTTTCTATAAGG + Intergenic
1044305687 8:90638119-90638141 TTTTTAAAAAGATTTCTGCAGGG - Intronic
1046550147 8:115705696-115705718 TTAATCAGAGGGTTCCTTCAAGG - Intronic
1046668435 8:117031757-117031779 TTATTAAGAAGATTTCGGCTGGG - Intronic
1047889865 8:129295766-129295788 TGATGAAGAGTGTTTTTGCAAGG + Intergenic
1050573356 9:6965846-6965868 TTATTCTGAGTGTTTCTGTAAGG - Intronic
1052383136 9:27793433-27793455 TTTTTCAGAGGCTTTCTGCTTGG - Intergenic
1052968269 9:34359423-34359445 TAAATAAGAGGGTTTTTCCATGG - Intergenic
1060262330 9:122087156-122087178 TATTTTAGAGGGTTTTTGCAAGG + Intronic
1185935396 X:4251194-4251216 TAATTTAGGGGGTTTTTGCATGG - Intergenic
1187026308 X:15438879-15438901 CTATTCAGAGGCTGTCTGCAGGG + Intronic
1187651831 X:21418072-21418094 TTATTAAGATAGTATTTGCAAGG - Intronic
1189147595 X:38671311-38671333 TTAAGAAGAGGGCTTCTTCAGGG - Intronic
1191223866 X:58019052-58019074 TTACTCATAGGGTTTCTGCTGGG - Intergenic
1192304586 X:69945163-69945185 TTATTAAGGTGGTTTCTGTATGG + Intronic
1193292050 X:79786326-79786348 TTATTAATAGGTTTTGAGCAGGG - Intergenic
1195003653 X:100666415-100666437 TTATTAAGAGGAATTCTGCAAGG + Intronic
1195287818 X:103402504-103402526 TTATTCTGAGTGTTTCTGTAAGG - Intergenic
1197947495 X:131856027-131856049 TTGTTAAGATGGTGTCTGCCAGG - Intergenic