ID: 1022259446

View in Genome Browser
Species Human (GRCh38)
Location 7:28690294-28690316
Sequence CTCTGTGTCTGGTGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 479}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022259446 Original CRISPR CTCTGTGTCTGGTGGGCAGA GGG (reversed) Intronic
900092641 1:927101-927123 TTGTGTGTCAGGTGGGCACATGG - Intronic
900266941 1:1762154-1762176 TTGTGTGGCTGCTGGGCAGATGG - Intronic
900744978 1:4354962-4354984 CTCTGTGCCTGGTGAGCACAGGG + Intergenic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901190944 1:7409395-7409417 CTTAGTGGCTGGTGGCCAGAGGG - Intronic
901293849 1:8145678-8145700 CTCTCTTCCTGGTGTGCAGATGG - Intergenic
901748952 1:11394092-11394114 GGCTGGGTCTGCTGGGCAGAGGG - Intergenic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902087429 1:13874284-13874306 CTCTTTTCCTGGTGGGCAGGTGG + Intergenic
902148982 1:14426952-14426974 CTCTGTGCCTGGTGTACAGTAGG - Intergenic
902220748 1:14963079-14963101 CTCTGTGCCTTGTGGGCTAAAGG - Intronic
902300132 1:15495795-15495817 ATTTGTGCCAGGTGGGCAGAGGG - Intronic
902817898 1:18926538-18926560 CTCTGAGGCTGGTGGCCAGGAGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903060282 1:20664308-20664330 CTCTGTGGCAGGTGAGCAGACGG + Exonic
903342313 1:22662132-22662154 GACTGTATCTGGTGGGCAGTGGG - Intergenic
903360053 1:22771443-22771465 GGCTGTGTCCAGTGGGCAGAGGG + Intronic
903680503 1:25093277-25093299 CTCTGGGACTGGTGGGCTGGGGG - Intergenic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904257145 1:29260928-29260950 CTCAGTCTCTGGTGGGCCCAGGG + Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904337112 1:29805171-29805193 CTCTGTGTCTGGCAGCCTGATGG + Intergenic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
904375935 1:30082554-30082576 CTCAGTGCCTGGAGGGCTGATGG + Intergenic
904414569 1:30350336-30350358 CTCTGTTTCTGGTTTGAAGATGG + Intergenic
904676505 1:32202016-32202038 CGCTGTGGCTGGTAGGCACAGGG - Exonic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
904924303 1:34034251-34034273 CTCTGTGGCTAGTGGGTAGGTGG - Intronic
906746619 1:48226417-48226439 CTCTGTGTTTGGGGCGCAGTGGG - Intronic
906812251 1:48839823-48839845 CCCAGTGTGTGGTGGACAGAGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907897414 1:58704698-58704720 CTTTGTCTCAGGTGAGCAGAGGG - Intergenic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
910000013 1:82330631-82330653 CTCTGTGTGTGGCTTGCAGATGG + Intergenic
911043164 1:93607881-93607903 TGCTGTGTCTGGTGGGCGGATGG - Intronic
911155163 1:94629379-94629401 CCCTCTGTCAGGTGGGGAGAGGG + Intergenic
911368134 1:96964886-96964908 CTCCCTGTCTGATGGGCGGATGG + Intergenic
912680407 1:111725560-111725582 TGCTGTGTCTAGTGGGGAGAAGG + Exonic
913162416 1:116156238-116156260 ATCTGTGTTTGGTGAGTAGAAGG - Intergenic
913997967 1:143667042-143667064 TTCTGTGTCTGGTGGTCAAGTGG - Intergenic
914195257 1:145445217-145445239 GTCTGTGGCTGTTGGGCTGATGG - Intergenic
914804620 1:150983108-150983130 GTCTGTGACTGGCGGGAAGATGG + Exonic
915071969 1:153277327-153277349 CTCTCTTTCTGGTTTGCAGATGG - Intergenic
915721490 1:157988964-157988986 CTCTGTCTCTGGTAAGCAGCAGG + Intergenic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
917451755 1:175153024-175153046 CTCGATGCCTGGTGTGCAGAAGG + Intergenic
918301902 1:183212316-183212338 CTCTGTGAGTGGTCAGCAGAAGG - Intronic
918395590 1:184110696-184110718 CTCTGTGTGTGGTGGGTTGTGGG - Intergenic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921581904 1:216905166-216905188 TTCTGTGTGTGATGGGCAGCCGG - Intronic
923339706 1:232996880-232996902 CTTTGTCTCAGGTGAGCAGATGG - Intronic
923986756 1:239390546-239390568 CTCCGTGGAGGGTGGGCAGAGGG - Intronic
924753280 1:246917676-246917698 CTCTCTGCCTGCTGGGAAGATGG + Intronic
1063914171 10:10864548-10864570 CTCTCTTTCTGGTTTGCAGAAGG + Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064535612 10:16354670-16354692 CATTGTGTCTGGTGGGCTGGAGG - Intergenic
1065072204 10:22037153-22037175 TTCTGTGTCTGATGCACAGAAGG - Intergenic
1066476762 10:35754657-35754679 CCCTGTGTCTGATGGGCTGCAGG + Intergenic
1066662262 10:37748129-37748151 CTCTGTGTATGGTGAGCATGTGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067055486 10:43047463-43047485 CTGGGTGTTTGGTGGGCACATGG - Intergenic
1067173398 10:43925603-43925625 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1067242517 10:44508584-44508606 GCCTGTGTCTGCTGGGGAGAAGG + Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067561601 10:47308508-47308530 CTTTGTTTCTGTTGGGAAGAAGG - Intronic
1067824434 10:49559820-49559842 CTTTGTCTCAGGTGGGCAGAGGG + Intergenic
1068978232 10:63034049-63034071 TTCTGAGTCTGGTGGGGAGGTGG + Intergenic
1069215248 10:65811842-65811864 CTCTGTATCTGGTGGGGACTTGG - Intergenic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071576360 10:86729636-86729658 CCCTGTGCTGGGTGGGCAGAAGG + Intronic
1071591768 10:86881522-86881544 CTCTGTATGTTGTGGGCAGGAGG - Intronic
1072449835 10:95531141-95531163 CTCGCAGTTTGGTGGGCAGAGGG - Intronic
1072626649 10:97116541-97116563 CTCTATGCCTGGTGAGCAGTGGG + Intronic
1073518896 10:104106572-104106594 ATTTGTGTCAGGTGAGCAGAGGG + Intergenic
1073596076 10:104801487-104801509 ATCTGTGGCTGGTGGGGAGCTGG - Intronic
1074346657 10:112692864-112692886 CTCACTGTCTGGTGGGGAGATGG - Intronic
1075200630 10:120400714-120400736 CTCTCTTTCTGGTTTGCAGATGG - Intergenic
1076284129 10:129276963-129276985 CTCTGTGGCTGCTGGAGAGACGG + Intergenic
1076896989 10:133317810-133317832 CTCTGTGTCTGGGGGGGGGGGGG - Intronic
1077117043 11:889893-889915 ATCTCTGACAGGTGGGCAGAGGG - Intronic
1077672454 11:4168255-4168277 CACTTTATCTGGTGGGCAGTGGG - Intergenic
1078216204 11:9314255-9314277 CTGTGTGTCGGGTGGGGAAAAGG - Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1079128175 11:17733388-17733410 ATCTGTGTGTGGTGGGTAAAAGG - Intergenic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1080639117 11:34148558-34148580 CACTCTGTCTGGGGGCCAGATGG - Intergenic
1081323377 11:41717414-41717436 ATCTGTCTCAGGTGGGAAGAGGG - Intergenic
1081548631 11:44091850-44091872 CTCTTTTTCTGGTTTGCAGAGGG - Intergenic
1081622603 11:44627855-44627877 CTCTGTGTCTGGCAGGTAGGGGG + Intergenic
1083776000 11:64894638-64894660 TTCTGTGTCTGGGGGGAGGAGGG - Exonic
1084006355 11:66325572-66325594 CTCCCTTTCTTGTGGGCAGATGG - Intergenic
1084042489 11:66550359-66550381 CTGTGTGTCTGTTGGGGATAGGG - Intronic
1084548759 11:69828232-69828254 CTTGGGGTCTGATGGGCAGACGG + Intergenic
1085289469 11:75387433-75387455 TTCTCTGTCTGGTGTGGAGAAGG - Intergenic
1085309728 11:75509080-75509102 CTGGGTGGCTGGTGGGCATAGGG - Intronic
1086403714 11:86482349-86482371 CTCAGTGTCTGGTGTACAGCAGG + Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1087311092 11:96545050-96545072 TTCTGTGTCTGGTGTGTAGCTGG - Intergenic
1088495437 11:110427323-110427345 ATTTGTGTTTGGTGGGCAGCAGG - Intergenic
1089821744 11:121234687-121234709 ATATGTGTCTGGTGGGCTGGGGG - Intergenic
1089836424 11:121374448-121374470 CTTTGTGTCAGGTAGGCAGAGGG + Intergenic
1090568476 11:128021573-128021595 ATGTGTGTCTGCTGGGCAGCAGG + Intergenic
1090875803 11:130787691-130787713 CTCTGTATATAGTGGGCAGCCGG - Intergenic
1091184869 11:133638043-133638065 TTTTGTGTCTGGTGGGCGAAGGG + Intergenic
1091609721 12:1995638-1995660 GTCTGTGTATGCTGGGCAGGAGG - Intronic
1094034619 12:26054608-26054630 CTCTTTGTCCTGTGGGGAGAGGG + Intronic
1094525225 12:31226879-31226901 CACAGGGTCTGGTGGGCAGGAGG + Intergenic
1094707576 12:32929252-32929274 ATTTGTGGCTGGTGGGCAGGGGG - Intergenic
1094772797 12:33684898-33684920 CTTTGTCTCAGGTGAGCAGAGGG - Intergenic
1095304226 12:40621072-40621094 TTCTGAGTCTGGTGGGGACATGG + Intergenic
1095998652 12:48111076-48111098 CTTTATGTCTAGTGGGCAGTTGG - Intronic
1097021055 12:56021080-56021102 CTCTTTGTCTGCTGGGCACGAGG + Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098872867 12:75836234-75836256 CACTGTGCCTGGTGTGGAGAGGG - Intergenic
1099447027 12:82764958-82764980 ATTTGTGTCTGGTGGGCGGGGGG + Intronic
1101523274 12:105504486-105504508 CTCTGTGTTTAGTGGCCAGGGGG - Intergenic
1102038704 12:109786954-109786976 CCCTGTGTCTAGTGGGGAGTAGG - Intronic
1102101247 12:110280903-110280925 CTCTGGGGCCGGTGGGCGGATGG - Intronic
1103202136 12:119096492-119096514 CTCAGTGTCTGGTGTGCAGGAGG + Intronic
1104167422 12:126247066-126247088 CTCTGTGCCTGGTACTCAGATGG - Intergenic
1104509494 12:129364294-129364316 CTCTGGGTATAGTGTGCAGATGG + Intronic
1104640965 12:130466801-130466823 CTTTGTCTCGGGTGAGCAGAGGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106032381 13:26014904-26014926 CTCTGTGTCTGGCATACAGAAGG - Intronic
1106437742 13:29738833-29738855 CTCTCTCTTTGGTGTGCAGAAGG + Intergenic
1106636427 13:31533555-31533577 CTCTTTCCCTGGTGTGCAGATGG + Intergenic
1106699106 13:32209889-32209911 GCCTGTGTCTAGGGGGCAGAAGG - Intronic
1107229965 13:38097060-38097082 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1108170800 13:47739969-47739991 CCCTTTGTCAGGTGGGTAGATGG - Intergenic
1109004839 13:56859415-56859437 CTCAGTGGCTAATGGGCAGATGG + Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1112262373 13:97888680-97888702 ATCTGTGTCTGGTGGGCCTGGGG + Intergenic
1113578801 13:111413880-111413902 CTGGGTGTGTGGTGGGCATATGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1117581614 14:57157158-57157180 CTCTGTGTCAGTTTAGCAGAAGG - Intergenic
1118279054 14:64412011-64412033 ATTTGTGTCTGGTGGGCTGGGGG + Intronic
1119407268 14:74406661-74406683 CTCAGTGGCTGGTGAGCTGAGGG + Exonic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119649314 14:76372430-76372452 CTCTTTACCTGGTGGACAGAGGG - Intronic
1119772005 14:77225879-77225901 CTCAGTGCCTGGAGAGCAGAGGG + Intronic
1119895788 14:78218941-78218963 CTCTCTCCTTGGTGGGCAGATGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120218621 14:81707333-81707355 CTCTTTGTCAGATGGGTAGATGG + Intergenic
1120617833 14:86729948-86729970 CTCTCTTTCTGTTTGGCAGATGG - Intergenic
1122499154 14:102184560-102184582 CTCTGCATCGGGTGGGGAGAGGG - Intronic
1122692600 14:103538340-103538362 CTCTGTGGCTGGTGAGGACAGGG - Intergenic
1202889612 14_KI270722v1_random:143671-143693 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1127289770 15:57559837-57559859 CTCTGGGTCTGTTGGGGGGATGG + Intergenic
1127295385 15:57604504-57604526 CTCTCTGTCTTCTGGGAAGACGG - Intronic
1127377917 15:58402057-58402079 TTGTGTGTCTGGTGGGGTGAGGG + Intronic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1129373164 15:75110451-75110473 CTCTGTGTCAGGTGGGAAGCCGG - Intronic
1130055389 15:80519511-80519533 TTTTGTGTCAGGTGAGCAGAAGG + Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131403639 15:92145966-92145988 CTCTGTGTTCTGTGGGGAGAGGG + Intronic
1131731514 15:95287030-95287052 CTTTCTGTCTGGTAGGCAGGGGG - Intergenic
1132007175 15:98238510-98238532 CTTTGTGTATGGTGTGCACATGG - Intergenic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1133129028 16:3664797-3664819 GTCAGTCTCTGGTGGGCACACGG + Exonic
1133567962 16:7012936-7012958 CTCTCTTTGTGGTTGGCAGATGG + Intronic
1133677203 16:8085121-8085143 ATCTGTGCCTGGTTGTCAGAGGG - Intergenic
1134067829 16:11240657-11240679 CTCTGTGCCTGGCATGCAGAAGG + Intergenic
1135111703 16:19695377-19695399 CTCTTTCTCTGGTGGAGAGAGGG + Intronic
1135517813 16:23149698-23149720 CTCTGTCTTTGCTGGTCAGATGG + Intergenic
1135588793 16:23690867-23690889 CTCTGAGTCTGGCGGGTAGTAGG + Exonic
1136136376 16:28259089-28259111 CGAGGTGGCTGGTGGGCAGACGG - Intergenic
1136578869 16:31140313-31140335 CTCTGTGTCCTGTATGCAGAGGG - Exonic
1137068519 16:35877104-35877126 CTCAGTGTCTGGCTGGCAGTGGG - Intergenic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1138433451 16:56983861-56983883 TTCTGTGGCTGGCGGGTAGAGGG + Intergenic
1139126519 16:64084901-64084923 CACTGTGCCTGGGGGCCAGATGG - Intergenic
1140834734 16:78782562-78782584 CTCTTTGGCTGGTGGACGGAAGG - Intronic
1141480005 16:84300161-84300183 ATCTGTGTCTGCTGGCCTGAAGG + Intronic
1142148685 16:88503254-88503276 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142148710 16:88503333-88503355 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142148732 16:88503408-88503430 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142148745 16:88503446-88503468 ATCTGTGTCTGGGGGGCCCACGG + Intronic
1142186575 16:88697689-88697711 CTGTGTGGGTGATGGGCAGAGGG - Intronic
1142278165 16:89133709-89133731 TTCTGACTCTGGTGGGGAGAAGG - Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1143157410 17:4846932-4846954 CTCTGTTTCTGGTGGGGACTGGG - Intronic
1143674008 17:8417586-8417608 CTCTGTGTATGGTGATCAAATGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144706622 17:17372681-17372703 ATTTGTCTCCGGTGGGCAGAAGG - Intergenic
1144830065 17:18126332-18126354 ATGTATGTCTGCTGGGCAGACGG - Exonic
1145053620 17:19683314-19683336 CTCTTTGTTTGGTGGGGGGAGGG - Intronic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1146615711 17:34355789-34355811 CTCTGGGCCTGAGGGGCAGAAGG + Intergenic
1146677115 17:34781329-34781351 CTCTGTGGCTTGTGGGCTGTTGG - Intergenic
1146745110 17:35321816-35321838 TGCTCTGTCTGGTGGGGAGAGGG - Intergenic
1147312510 17:39603966-39603988 CCCTGCCTCCGGTGGGCAGAGGG + Intronic
1147896337 17:43754203-43754225 GTCCGTGAGTGGTGGGCAGAAGG + Exonic
1147914808 17:43879913-43879935 CTTTGTGTCCCGTGGGGAGATGG - Exonic
1148805445 17:50261530-50261552 CTTGGTGACTGATGGGCAGAAGG + Intergenic
1148814618 17:50318657-50318679 CTATTTGTCTGGTGGCCAGGAGG - Intergenic
1148869605 17:50648747-50648769 CTCTGTGTGTTGGGGGCAGGTGG - Intronic
1149070109 17:52531012-52531034 CTCTGTGTCTTTGAGGCAGATGG + Intergenic
1149655964 17:58309724-58309746 CGCTGTATCTGGTGGGCTGGAGG + Intronic
1150212194 17:63447286-63447308 CTCGGTGCCTGGAGGGCAGGTGG - Intergenic
1150321325 17:64216868-64216890 CTGGGTGTCAGGTGGCCAGATGG + Intronic
1150348930 17:64426730-64426752 ATCTGTCTCAGGTGAGCAGAGGG - Intergenic
1151345430 17:73498486-73498508 CTCTGTGCCGGGCAGGCAGAAGG + Intronic
1151683690 17:75634836-75634858 CTCAGGCTCAGGTGGGCAGAAGG + Intronic
1151930289 17:77227874-77227896 CTCTGCGGCTGGTGGGGAGAAGG + Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152126034 17:78447456-78447478 CTCTGTCTCAGATGGGCAGCAGG + Intronic
1152240633 17:79159109-79159131 CTCTGTGGCAGGTGGGTAGTGGG + Intronic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1153915905 18:9743869-9743891 GTCTGTGCCTGTTGGGAAGATGG + Intronic
1154424018 18:14258414-14258436 CTCAGTGGCTCATGGGCAGAAGG + Intergenic
1155488335 18:26371702-26371724 CTCTAGGTCTGGTGAACAGATGG + Intronic
1156405919 18:36782580-36782602 CTCTTTTTTTGGTGGGGAGATGG + Intronic
1157397793 18:47357184-47357206 CTCTCTGCCTGGTGTGCAGATGG + Intergenic
1157551907 18:48588107-48588129 CTCTGTGCCTTGTGGGGAGCCGG + Intronic
1157552807 18:48593094-48593116 CTCTGTATCTGGTGGGAGCATGG + Intronic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160053407 18:75457029-75457051 CTCTGAGTCTCCTGGGCAGAAGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160186784 18:76682094-76682116 CTCTGTGTTTCGTGGGGACAGGG - Intergenic
1160431591 18:78816790-78816812 CTGTCAGCCTGGTGGGCAGAAGG - Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1160984742 19:1833417-1833439 CTCTGCGCCTGCTGGGCACATGG - Intronic
1161249095 19:3270871-3270893 CTCTGTGGCGGGTGGGGAGATGG + Intronic
1161460155 19:4391809-4391831 CTCTGTTTCTGGCTTGCAGACGG - Intronic
1161602570 19:5193482-5193504 CTCTTTGTCTGGGGGGCTGTGGG + Intronic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162043736 19:7985493-7985515 CTCTGCCACTGGTGGGCAGGAGG - Intronic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1162439203 19:10682352-10682374 CACTGTGGCTGGCAGGCAGAGGG + Intronic
1163112323 19:15169282-15169304 CTCTCTTCCTGGTGTGCAGATGG - Intronic
1163263917 19:16207065-16207087 CTCTCTGGCTGCTGAGCAGAAGG + Intronic
1163756803 19:19111232-19111254 CTCTGAGCCTGGTGGGGACAGGG - Exonic
1164051248 19:21586983-21587005 CGCAGTGGCTGGTGGGCAGTGGG + Intergenic
1164598866 19:29547940-29547962 CTCTTTCTCCTGTGGGCAGAGGG + Intronic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1167052315 19:47086733-47086755 CTGTGTGTCTGGGGTGCTGAGGG - Intronic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167332747 19:48866611-48866633 CTCTTTTTTTGATGGGCAGAGGG + Intronic
1167710763 19:51109079-51109101 CCCTGTGTCTAGGGTGCAGACGG - Intergenic
1167793772 19:51695923-51695945 CTCTGTGCCTGTTGGGCGGTGGG + Intergenic
1168557050 19:57351919-57351941 CTCTGTGCCTGGTGAGAACAGGG + Intronic
1202665014 1_KI270708v1_random:110438-110460 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
925117333 2:1390931-1390953 CTCTTTGTCAGATGGGTAGATGG + Intronic
925483248 2:4300134-4300156 CTCTTCATCTGGAGGGCAGAAGG + Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926210431 2:10865311-10865333 CTCTGTGTCTGCTAGCCAGCAGG - Intergenic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
927097699 2:19760125-19760147 TTCTGTGTCTGGCTGACAGATGG - Intergenic
927352133 2:22128099-22128121 ATTTGTGTCTGGTGGGAAGGGGG - Intergenic
927481106 2:23454832-23454854 CATAGTGTCTGGTGGGCAGGAGG - Intronic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
929446327 2:42004115-42004137 CTTTGTGTGTGGTGAGCAGCAGG - Intergenic
929450093 2:42030994-42031016 CTCTGGGTCTGCTGGGCACTGGG - Intergenic
931257686 2:60587721-60587743 CTCTGTGGGTTGTGGGTAGATGG + Intergenic
931835166 2:66091523-66091545 CTCTTTGATTGATGGGCAGATGG - Intergenic
931882926 2:66585691-66585713 CCCAGTGTCTGGTGTCCAGAAGG - Intergenic
932459902 2:71875479-71875501 CTCTGTTGCTGGTGGGCTCAAGG - Intergenic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932929005 2:76011568-76011590 ATTTGTGTCAGGTGGGCAGGGGG + Intergenic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
933993889 2:87653414-87653436 CTCTGTGTCTGGTGGCTATAGGG + Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934576452 2:95404717-95404739 CACTGTGCCTGGTGCACAGAAGG - Intronic
934638677 2:96012883-96012905 CACTGTGCCTGGTGTACAGAAGG - Intergenic
934665257 2:96164910-96164932 CTCTGCGTCTGGTAGGGAGGAGG - Intergenic
934794971 2:97092519-97092541 CACTGTGCCTGGTGCACAGAAGG + Intronic
935936438 2:108189499-108189521 CACTGTGTCTGCTGCCCAGAAGG + Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936299974 2:111297469-111297491 CTCTGTGTCTGGTGGCTATAGGG - Intergenic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
936959617 2:118059206-118059228 CTCTGTGCCTTGTGGTCACAGGG + Intergenic
938714894 2:134010197-134010219 TTCTGCATCTGGTGGGCAGGTGG - Intergenic
941383292 2:164822360-164822382 CTCTGTGTCTGCTGAGCTGGGGG + Intronic
943494660 2:188606294-188606316 TTCTGAGTCTGGTGGGGAGGTGG - Intergenic
944423810 2:199558224-199558246 CTCTGTGTTTGGTGGTGAGTGGG + Intergenic
944477324 2:200120214-200120236 CTTTGGGTCTGGTGGGTAAAAGG + Intergenic
944942127 2:204640171-204640193 CTCTGTGTCTGGGAGGTTGAGGG + Intronic
945715639 2:213354764-213354786 CTCTTTGTCAGATGGGTAGATGG + Intronic
945934218 2:215886706-215886728 ATCTGTCTCAGGTGAGCAGAGGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946315147 2:218906488-218906510 CCCAGTGTCTGGTGGGCTGGGGG + Intergenic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946474641 2:219995675-219995697 CTGCGTGTGTGGTGTGCAGAGGG + Intergenic
947164158 2:227244593-227244615 CTCTGTGTCTGATGAGATGATGG + Intronic
948004922 2:234600196-234600218 CTGTGTGTGTGGTGGGCGTAGGG - Intergenic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948322203 2:237079554-237079576 ATTTGTTTCAGGTGGGCAGAGGG + Intergenic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948990510 2:241551673-241551695 CCCTGTGCCTGGGAGGCAGATGG - Intergenic
1169118546 20:3082518-3082540 CTCAGTCTCTGGCGGGAAGAGGG - Intergenic
1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG + Intergenic
1169529315 20:6467127-6467149 CTTTGTGTCTTGTGGGAAGCAGG + Intergenic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1172084191 20:32366568-32366590 TTCTGTGTCTGGTAGTGAGATGG + Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1173228119 20:41173879-41173901 CTCTGTCCCTCGTGGGCTGAGGG + Intronic
1174368006 20:50068041-50068063 CGCTGTGTCTGCTGGGCCTAGGG + Intergenic
1176061327 20:63174177-63174199 CCCCGTGCCTGGTGGGGAGAGGG - Intergenic
1176302719 21:5106225-5106247 GCCTCTGCCTGGTGGGCAGAGGG - Intergenic
1177949181 21:27512341-27512363 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179044556 21:37832697-37832719 CTCTGTATCTGGTGGGGGGCGGG + Intronic
1179854305 21:44155698-44155720 GCCTCTGCCTGGTGGGCAGAGGG + Intergenic
1180200747 21:46222685-46222707 CTCTGTATCCGGCTGGCAGAGGG + Exonic
1180331739 22:11487358-11487380 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181515325 22:23407803-23407825 ATCTGTCTCAGGTGAGCAGAGGG + Intergenic
1181672079 22:24430375-24430397 CACTGAGGCTGGTGGGCAGCAGG + Intronic
1182648462 22:31829783-31829805 CCCTGTCTCTGCTGGGCAGCAGG - Intronic
1183315939 22:37136811-37136833 CTATGTGTCTGGGGAGCAGGAGG - Intronic
1184067952 22:42130835-42130857 CTCTGTGCCTGGTGGGGTGGGGG - Exonic
1184070689 22:42144508-42144530 CTCTGTGCCTGGTGGGGTGGGGG - Intergenic
1184072573 22:42155045-42155067 CTCTGTGCCTGGTGGGGTGGAGG - Intergenic
1184142082 22:42583797-42583819 ATCTGTGTCTCCTGTGCAGAAGG - Exonic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1184900625 22:47444411-47444433 CTGTATGTCTGATGGGCAGGTGG + Intergenic
1185285074 22:49996455-49996477 CTCAGTGGCTGGTGGGCAAAGGG + Exonic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
949587218 3:5453673-5453695 ATTTGTGTCAGGTGGGCAGAGGG + Intergenic
949845923 3:8370854-8370876 CTCTATGTCTTGGGAGCAGATGG - Intergenic
950631189 3:14283323-14283345 TGCTGTTTCTGGTGGGCACAGGG - Intergenic
950728452 3:14935172-14935194 CTCTGTGCCCAGTGAGCAGAGGG - Intergenic
950860324 3:16142084-16142106 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
951164001 3:19462542-19462564 CCCTTTGTCAGGTGGGTAGATGG + Intronic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
952967865 3:38632225-38632247 CTCTGTGTGTGGTGGGGATGGGG + Intronic
953090971 3:39725880-39725902 CTCTGTGTCCGGGGGAAAGAGGG - Intergenic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
955092859 3:55769447-55769469 CTCTGTCTGGGTTGGGCAGAAGG + Intronic
955266373 3:57449245-57449267 TTCTGAGTCTGGTGGGGACATGG - Intronic
956381394 3:68668067-68668089 CTCTGTTCCTGGTTTGCAGATGG + Intergenic
956731349 3:72199475-72199497 CCCTGTGTCTGGTGGTGAGTGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957090880 3:75728906-75728928 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090892 3:75729027-75729049 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090904 3:75729147-75729169 ATTTGTGTCAGGTAGGCAGAGGG + Intronic
957090917 3:75729267-75729289 ATTTGTGTCAGGTGGGCAGAAGG + Intronic
957702187 3:83728242-83728264 CTCATAGTTTGGTGGGCAGAAGG - Intergenic
960149711 3:114238189-114238211 TTCTGAGTCTGGTGGGGACATGG - Intergenic
961616160 3:128182853-128182875 CTCTGTGGCTGGTGGGAAGCAGG - Intronic
961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG + Intronic
962107583 3:132408072-132408094 CTCTCTTTCTGGTTGGTAGATGG - Intergenic
962178870 3:133184067-133184089 CCCGGTGTCTGGTGGGGAGTTGG - Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
968226466 3:196975507-196975529 CTCTGTGTCTGAGGGCCAGCAGG + Intergenic
968447387 4:658550-658572 CTCTCTGTGTGGTGGGGACACGG + Intronic
969107749 4:4820626-4820648 CTCTGTGGCTGGGGTGCAGCAGG - Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
969849573 4:9945651-9945673 CCCTGAGTCTGGTGGTCTGATGG - Intronic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
972782328 4:42296886-42296908 CTCAGTGCCTGGTGAGCAAATGG - Intergenic
973723217 4:53746280-53746302 GTTTGCGTCAGGTGGGCAGAGGG + Intronic
974023344 4:56711185-56711207 TTCTGAGTCTGGGGGGCAGGGGG - Intergenic
974051595 4:56946983-56947005 TTCTGTCTCTGGTGGGTAGATGG + Intergenic
975108071 4:70591822-70591844 CTCTGTGTGTGCTGGGGGGAAGG + Intergenic
976803329 4:89018328-89018350 CTCTCTCTTTGGTGTGCAGATGG - Intronic
977470611 4:97437981-97438003 TTCTGAGTCTGGTGGGGACATGG - Intronic
977883106 4:102228731-102228753 CTCTCTGTGTGGTGAGCAGCAGG - Intergenic
978328388 4:107585175-107585197 CACTGGGTCTGTTGGGCAGGGGG + Intergenic
979381430 4:120011249-120011271 CTGTGTGTCTGGTGAGAATATGG - Intergenic
979456406 4:120930392-120930414 CCCAGTTTCTGGTGGCCAGAAGG - Intergenic
980137231 4:128870313-128870335 GTCTGTGTCTGGTGAGCACTAGG + Intronic
982209865 4:153025539-153025561 CTCAGTGTCTCATGAGCAGAAGG + Intergenic
985285086 4:188329111-188329133 ATTTGTCTCTGCTGGGCAGAGGG + Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985627400 5:996497-996519 CTGTGTGGCTGGTGGGCATGTGG + Intergenic
986350834 5:6878142-6878164 GTGAGTGCCTGGTGGGCAGAGGG + Intergenic
987486258 5:18531329-18531351 ATTTGTGTCTAGTGGGCAGGGGG - Intergenic
987527338 5:19069824-19069846 CTCTGTGTGTGGTAGGATGAAGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990152936 5:52840908-52840930 ATCTGTGTCTGGTGGAAAGGAGG - Intronic
990536461 5:56728086-56728108 GTCTGTTTTTGGTGGGCGGATGG - Intergenic
990791697 5:59487966-59487988 CTGTGTGTCTGATGTGCAGAGGG - Intronic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995768214 5:115641390-115641412 CTAGGTGTCTTGTGGTCAGAAGG + Intergenic
996020514 5:118586315-118586337 CTCTGTGTCTGTTGGTGATAAGG - Intergenic
996282957 5:121754108-121754130 ATTTGTGTCTGGTGGGCTGGGGG + Intergenic
996312625 5:122123796-122123818 CTCTGAGACTGGTGGAAAGAAGG + Intergenic
997130044 5:131267515-131267537 ATGTGTGTCTGTTGGGGAGAGGG + Intronic
997401921 5:133610676-133610698 CTCTGGGTCTGGTTGGCGGGGGG - Intronic
997454416 5:134006272-134006294 CACTGAGACTGGTGGGCAGGGGG + Intergenic
997890402 5:137671424-137671446 CTCATAGACTGGTGGGCAGACGG - Intronic
998548213 5:143050100-143050122 CTATGTTGTTGGTGGGCAGAGGG + Intronic
998983991 5:147734896-147734918 CTCTGTGTAAAGTGGACAGATGG + Intronic
1000325627 5:160169932-160169954 CTGTCTGTCTGGTGGGCACTGGG - Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002915104 6:1522686-1522708 CCCTGTGGCTGGTCAGCAGACGG - Intergenic
1002967135 6:1978037-1978059 CTCTGTTGCTGGTGGCCAGCTGG - Intronic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003581526 6:7344677-7344699 TTCTGAGTCTGGTGGGAAGGTGG + Intronic
1003942071 6:11039308-11039330 CTGTGTGCCTGGTGAACAGAGGG - Intronic
1004266797 6:14155248-14155270 CTCTGTCTTTGATGGGAAGAGGG - Intergenic
1004704538 6:18112004-18112026 CTCTATGCCTGGTGGGCACATGG + Intergenic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1004901397 6:20197441-20197463 ATTTGTGTCACGTGGGCAGAGGG - Intronic
1004981374 6:21028468-21028490 CTCTGTTCCTGGTTTGCAGATGG + Intronic
1005604741 6:27465075-27465097 TTCTGTGTCTGGTTCGTAGATGG - Intronic
1005643897 6:27823556-27823578 CTCTTTGTGTGATGGGAAGATGG + Intergenic
1005729322 6:28681845-28681867 CTATGTGTAGGGTGGGGAGATGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006884600 6:37370620-37370642 CTCAGGGCTTGGTGGGCAGAGGG - Intronic
1006925481 6:37651999-37652021 CTCTGAGACAGGTGGGCAGCTGG - Exonic
1007165196 6:39824210-39824232 TTCTGTGCCTGCTGGGCAGTAGG + Intronic
1007369401 6:41416519-41416541 GTGTGTGTCTGGTGGGTGGAGGG - Intergenic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007499909 6:42288757-42288779 CTCTGTGGCAGGTGGGAACAAGG + Intronic
1007507984 6:42351812-42351834 CCCTGTGTCTGTTTGGCAGATGG - Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1009504208 6:64454252-64454274 CTCTGTGTTTGATTGGCTGAGGG - Intronic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1010828237 6:80498726-80498748 CTATGTTTCTAGTGTGCAGAAGG + Intergenic
1010831389 6:80534769-80534791 CTCTGTCTTTGGTTTGCAGATGG + Intergenic
1011801043 6:91016706-91016728 GTCTGTGGGTGGTGGGCTGAGGG - Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1014554569 6:122830081-122830103 TTATGTGTCTGTGGGGCAGAGGG - Intergenic
1014640930 6:123909486-123909508 CTCTGTGTCTGCTTGCCACATGG + Intronic
1014867068 6:126545696-126545718 ATTTGTGTCTGGTGGGCATGGGG - Intergenic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1016985008 6:149888538-149888560 ATCTGTGTCTGGTGGCAAAATGG - Exonic
1017065617 6:150526509-150526531 GTCTGTCTCAGGTGAGCAGAGGG - Intergenic
1018689989 6:166337078-166337100 CTCCAAGTCTGGTGTGCAGAGGG - Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1019537445 7:1536732-1536754 TTCTGTGCATGGTGGGGAGAGGG + Intronic
1019640021 7:2098394-2098416 CTTTGTGTCTGGTTGTCACAGGG - Intronic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1019721840 7:2577110-2577132 CTCTGTGTGTGGTGGGTGGGGGG - Intronic
1020052396 7:5090477-5090499 ATTTGTGTCTGGTGGGCAGGGGG + Intergenic
1020437149 7:8176561-8176583 CTTTGTGCCTCGTGGGCAGCAGG + Intronic
1020800203 7:12723689-12723711 CTGAGTGGCTGATGGGCAGAAGG - Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021375752 7:19904911-19904933 CTGTTAGTCTGATGGGCAGAAGG + Intergenic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1022229982 7:28405329-28405351 CTCTGAGTGATGTGGGCAGAAGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG + Intronic
1022908801 7:34880564-34880586 ATTTGTCTCAGGTGGGCAGAGGG - Intergenic
1023102799 7:36736225-36736247 CTCTGTATCTGGAGGGCAAGGGG - Intergenic
1023216335 7:37867107-37867129 ATTTGTGTCTGGTGAGCAGCGGG + Intronic
1024568119 7:50700917-50700939 GTCTCTGTCTGTTGGGTAGAGGG + Intronic
1024582888 7:50814445-50814467 ATTTGTCTCAGGTGGGCAGAGGG - Intergenic
1024812409 7:53227696-53227718 CTCTCTGTCTGGCTTGCAGATGG - Intergenic
1025802774 7:64802850-64802872 ATTTGTGTCTGTTGGGCAGGGGG - Intronic
1027499193 7:78926807-78926829 CTTTGTGTTTGGTGGGGAAAAGG + Intronic
1028232224 7:88319320-88319342 ATTTGTGCCAGGTGGGCAGAAGG + Intergenic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1029601571 7:101566594-101566616 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1030787698 7:113683484-113683506 CTCTGTCTCTGATGACCAGATGG + Intergenic
1031276298 7:119727763-119727785 ATTTGTGTCTGGTGGGCTGTGGG - Intergenic
1032801258 7:135318894-135318916 ATTTGTCTCTGGTGAGCAGAGGG - Intergenic
1033230670 7:139595013-139595035 CTCTCTGACTGGTGGAGAGACGG + Intronic
1033741952 7:144282819-144282841 CTCTGTGTCTAATGGCCAGTAGG - Intergenic
1033751950 7:144366795-144366817 CTCTGTGTCTAATGGCCAGTAGG + Intronic
1033961115 7:146914193-146914215 CTCTTTGACTGGTGGGCATTTGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034579046 7:152026556-152026578 ATCTGTCTCAGGTGAGCAGAAGG - Intronic
1034626854 7:152500113-152500135 CTTTGTCTCAGGTGAGCAGAGGG - Intergenic
1035056866 7:156041621-156041643 CCCTGTGTCTGGGGGGCCCAGGG - Intergenic
1035088748 7:156286300-156286322 CTCTCTTCCTGGTGTGCAGACGG - Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035555375 8:563546-563568 ATTTGTGCCAGGTGGGCAGAGGG - Intergenic
1036586583 8:10129815-10129837 CTCTGTGTCTGGCTTGCACAGGG + Intronic
1037833768 8:22204336-22204358 CACTATGACTGGTGGGGAGAAGG - Intronic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1042053682 8:64739014-64739036 TTCTGTCTCTGGCAGGCAGAGGG + Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1044562883 8:93630634-93630656 CCCAGTGTCTGGTAGGCAGTAGG - Intergenic
1044880584 8:96718985-96719007 TTCTGAGTCTGGTGGGGACATGG - Intronic
1046834782 8:118788279-118788301 ATTTGTGTCTGGTGGGCAGGGGG - Intergenic
1048009518 8:130444248-130444270 CTCTGTGTCCGGTTGGAATATGG + Intergenic
1048365359 8:133733512-133733534 CTCTGGGTCTGGTCGGGAGCAGG - Intergenic
1049097788 8:140558941-140558963 TTCTGTTGCTGATGGGCAGAAGG + Intronic
1049340598 8:142110380-142110402 CACTGTGTCTTTTGGTCAGAGGG - Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1052984769 9:34478862-34478884 CTCTGGGTCTGGTCTACAGAAGG - Intronic
1056782780 9:89563805-89563827 ATTTGTGTCTGGTGGGCGGGGGG + Intergenic
1057129604 9:92644390-92644412 CTCTGTGGCTGCTGGGCAGCTGG - Intronic
1060025499 9:120167459-120167481 GTGTGTGTCTGGTGTGTAGAAGG + Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061592229 9:131605064-131605086 CTCTGAGACTGGTGGGCAGGTGG + Intronic
1061595642 9:131627467-131627489 CTCCGAGTCTGCTGGGCAGGGGG - Intronic
1061697245 9:132385777-132385799 CTCTGTGCCTGGTATACAGAAGG + Intronic
1061817398 9:133205362-133205384 CTCTGTGTCTGGTGGTAGGGTGG + Exonic
1062243005 9:135549864-135549886 CTCTGTGTCTGGTGGTAGGGTGG - Exonic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062443148 9:136582482-136582504 CTCTGTGTCTGGTGTACAGCTGG - Intergenic
1062699409 9:137891133-137891155 GTCTGTGGCTGTTGGGCTGATGG + Intronic
1203770084 EBV:45448-45470 CTCGGTTTCTGGTAGGCAGGTGG + Intergenic
1203486735 Un_GL000224v1:63092-63114 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1203499357 Un_KI270741v1:4992-5014 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1188048402 X:25454491-25454513 CTGTGTGTTTGGTGAGGAGATGG - Intergenic
1189257365 X:39650930-39650952 CTCTGTGGATGGTGGGCCCAGGG + Intergenic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1189911183 X:45811904-45811926 CTCTCTGACTTGTGGGCATATGG - Intergenic
1190790726 X:53697370-53697392 TTCTGTGACTGGTGGGGTGAGGG + Intergenic
1191716177 X:64195210-64195232 CCCTGGGTCTGGTGGGAATAGGG + Intronic
1192811430 X:74550472-74550494 CACTGTCTCTGGTGGCCAGCAGG - Intergenic
1192980373 X:76332881-76332903 CTGTGTCTCTTGTAGGCAGAAGG - Intergenic
1193294510 X:79818971-79818993 ATTTGTGTCTGGTGGGCCAAAGG + Intergenic
1193295614 X:79828527-79828549 ATTTGTGTCTGGTGGGCCAAAGG + Intergenic
1195982127 X:110590562-110590584 ATTTGTGTCTGGTAGGCAGGGGG + Intergenic
1196845138 X:119891051-119891073 TCCTGTGTCTGGTGGGGAGGTGG + Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197386958 X:125813806-125813828 CTCTCTGTCTGGTAGGGTGAGGG - Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1198778523 X:140207907-140207929 ATATGTGTATGGTGGGCAGGAGG + Intergenic
1198787451 X:140304233-140304255 CACTGTGTCTGGTGGGTGGGTGG - Intergenic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1200142058 X:153907341-153907363 CTCTGTCTCGGGTGGGCAGGTGG - Intronic
1201697568 Y:16842670-16842692 TTTTTTGTCTGGTGGGCAGCAGG - Intergenic